- Email: [email protected]
Neurotoxin-conjugated upconversion nanoprobes for direct visualization of tumors under near-infrared irradiation
Biomaterials 31 (2010) 8724e8731
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Neurotoxin-conjugated upconversion nanoprobes for direct visualization of tumors under near-infrared irradiation Xue-Feng Yu a, b,1, Zhengbo Sun a,1, Min Li b, Yang Xiang b, Qu-Quan Wang b, *, Fenfen Tang a, Yingliang Wu a, Zhijian Cao a, *, Wenxin Li a, * a b
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China Key Laboratory of Artificial Micro- and Nano-structures of Ministry of Education and School of Physics and Technology, Wuhan University, Wuhan 430072, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 5 June 2010 Accepted 28 July 2010 Available online 21 August 2010
We report the development of neurotoxin-mediated upconversion nanoprobes for tumor targeting and visualization in living animals. The nanoprobes were synthesized by preparing polyethylenimine-coated hexagonal-phase NaYF4:Yb,Er/Ce nanoparticles and conjugating them with recombinant chlorotoxin, a typical peptide neurotoxin that could bind with high specificity to many types of cancer cells. Nanoprobes that specifically targeted glioma cells were visualized by laser scanning upconversion fluorescence microscopy. Good probe biocompatibility was displayed with cellular and animal toxicity determinations. Animal studies were performed using Balb-c nude mice injected intravenously with the nanoprobes. The obtained high-contrast images demonstrated highly specific tumor binding and direct tumor visualization with bright red fluorescence under 980-nm near-infrared irradiation. The high sensitivity and high specificity of the neurotoxin-mediated upconversion nanoprobes and the simplification of the required optical device for tumor visualization suggest an approach that may help improve the effectiveness of the diagnostic and therapeutic modalities available for tumor patients. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Upconversion nanoparticle Fluorescence Imaging Cancer targeting Chlorotoxin
1. Introduction Molecular targeting of nanoprobes to cancer cells and the tracking of such targeted probes in vivo have been suggested to be of potential utility in early-stage tumor diagnosis. Recent interdisciplinary research in this area has generated fluorescent probes that exhibit high sensitivity, high specificity, and good biocompatibility [1,2]. Rare-earth upconversion nanoparticles (UCNPs), which absorb low energy near-infrared (NIR) light and upconvert to emit in the visible spectrum, have recently been proposed as a new generation of probes for bioimaging [3]. Upconversion fluorescence possesses many advantages, including non-invasive and deep tissue penetration of the NIR excitation, sharp visible emission lines, long fluorescence lifetime, superior photo-stability, and the near absence of tissue autofluorescence resulting in a high signalto-background ratio [4]. Furthermore, the rare-earth elements of
* Corresponding authors. Tel.: þ86 27 68752481/8098; fax: þ86 27 68752569. E-mail addresses: [email protected] (Q.-Q. Wang), [email protected] (Z. Cao), [email protected] (W. Li). 1 X. F. Yu and Z. Sun contributed equally to this work. 0142-9612/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2010.07.099
the UCNPs generally have lower toxicity than semiconductor elements of the commonly used quantum dots [5]. Following significant progress in techniques for their synthesis [6e11] and surface modification [12e15], rare-earth UCNPs have recently been introduced for cell and animal imaging [16e22]. Zhang’s group has reported in vitro and in vivo tissue imaging in mice using NaYF4:Yb,Er UCNPs [17,18]. Prasad et al. have reported whole-body imaging of a Balb-c mouse using NIR (980 nm) to NIR (800 nm) upconversion fluorescence of NaYF4:Yb,Tm UCNPs [19]. Our group has achieved tissue-sensitive multicolor upconversion imaging in mice using water-soluble hexagonal-phase NaYF4:Yb,Er/ La UCNPs [22]. Notwithstanding these efforts, the visualization of tumors in vivo using upconversion fluorescence is still a great challenge due to the difficulties that exist both in synthesizing bright UCNPs bearing appropriate functional groups and in preparing corresponding bioconjugates with suitable tumorspecific agents. Recently, high-affinity polypeptide neurotoxins have been shown to be effective agents for probing biological systems with high specificity [23,24]. For preparing tumor-specific nanoprobes, small peptides are often more useful than the more commonly used antibodies because they provide better cellular uptake and tissue penetration when introduced to animals in vivo [25].
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
8725
Fig. 1. Expression, purification and characterization of CTX peptide. (a) Tricine-SDS-PAGE analysis of expression and purification of the recombinant CTX peptide. Lane 1: un-induced cell-free extract of E. coli carrying pGEX-6p-1-CTX; Lane 2: total cell-free extract of E. coli carrying pGEX-6p-1-CTX induced with IPTG for 4.0 h; Lane 3: the fusion protein purified using the GSH-agarose system; Lane 4: the fusion protein cleaved by enterokinase; Lane 5: the CTX peptide purified by HPLC; Lane 6: protein molecular weight markers. (b) Purification of the recombinant CTX peptide by HPLC. (c) MALDI-TOF-MS mass spectrum of the recombinant CTX peptide.
Furthermore, the conjugation of peptides to nanoparticles can overcome the limitations of short half-life in blood and poor tissue retention [26,27]. One peptide neurotoxin of interest with respect to such applications is an insect venom toxin known as chlorotoxin (CTX) isolated from the scorpion Leiurus quengestriatus [28]. CTX is thought to specifically target many types of cancers of neuroectodermal origin by binding to a surfaceebound complex that includes the matrix metalloproteinase 2 (MMP-2) endopeptidase [29,30]. CTX is of particular biological interest due to its potential ability to target primary brain tumors (glioma), one of the most deadly forms of cancer [31]. Olson’s group [32] and our group [33] have prepared Cy5.5-conjugated CTX and its analog for use in glioma tumor fluorescence imaging. CTX has also been suggested to be a suitable peptide for nanoparticle bioconjugation [24,27,34]. In this work, we prepared a tumor-specific and low-toxic fluorescence nanoprobe by conjugation of CTX peptides with rare-earth UCNPs, studied targeted imaging of cancer cells with such CTX:UCNP nanoprobes by using continuous wave (CW) NIR irradiation, and investigated the cytotoxicity and tissue distribution of the nanoprobes. Furthermore, we explored the use of the CTX:UCNP nanoprobes for upconversion fluorescence imaging of xenograft glioma tumors in Balb-c nude mice in vivo and ex vivo. 2. Materials and methods 2.1. Expression, purification and characterization of CTX peptide The CTX nucleotide sequence was generated from the natural CTX peptide by an overlapping PCR method [28]. A second PCR reaction was performed using the
products of the overlapping PCR as a template. The primers used were: sense primer 1,50 -GCCGGATCCCCGATGACGATGACAAAATGTGTATGCCGTGCTTCACTACC-30 ; sense primer 2, 50 -CGTAAATGTGACGATTGCTGTGGTGGCAAAGGTCGTGGTAAATGCTACGG30 ; antisense primer 1, 50 -CAATCGTCACATTTACGTGCCATCTGGTGATCGGTAGTGAG CACGGCAT-30 ; antisense primer 2, 50 -GCCCTCGAGTCAACGGCACAGACACTGCGGAC CGTAGCATTTACCACGAC-30 .After digestion with BamHI and XhoI, the PCR products were subcloned into pGEX-6p-1 at the BamHIeXhoI-cut site. The recombinant pGEX6p-1-CTX plasmid, confirmed by sequencing, was transformed into Escherichia coli Rosetta (DE3) cells and the transformed cells were cultured at 37 C in LB medium with ampicillin (100 mg mL1). When the cell density reached an OD of 0.6, 1.0 mM isopropyl thio-b-D-galactoside was added to induce expression at 28 C. Cells were harvested after 4 h and resuspended in 50 mM TriseHCl and 10 mM Na2EDTA (pH 8.0). Supernatant from the bacterial cell lysate was loaded onto a glutathione transferase (GST) binding column. The purified fusion protein was desalted using centrifugal filtration (Millipore) and cleaved by enterokinase (Biowisdom) at 25 C for 16 h. Protein samples were separated by HPLC on a C18 column (10 250 mm, 5 mm) (EliteHPLC) using a linear gradient from 10 to 80% acetonitrile with 0.1% trifluoroacetic acid for 60 min with detection at 230 nm. The CTX peptide eluted as a major peak at 21e24% acetonitrile. The molecular mass of the purified CTX peptide was obtained by MALDI-TOF-MS.
2.2. Synthesis of polyethylenimine-coated UCNPs UCNPs The water-soluble hexagonal-phase NaYF4:Yb,Er/Ce (Y:Yb:Er:Ce ¼ 72:20:5:3) coated with polyethylenimine (PEI) were synthesized using a modification of the method reported previously [22]. In brief, a growth solution was prepared by dissolving RECl3 (RE: Y, Yb, Er, and Ce) and NaCl in water at final RE and Naþ ion concentrations of 0.5 mol L1. Under vigorous agitation, 15.0 mL ethanol, 5.0 mL PEI solution (MW ¼ 10000, 5% by weight), and an appropriate amount of NH4F were added. The mixture was then transferred to a Teflon-lined autoclave. After purging of the air by N2 bubbling for 20 min, the mixture was sealed and heated at 200 C for 3 h. After cooling, the obtained UCNPs were washed several times with ethanol and water and dried in a vacuum. The particle surfaces were then re-functionalized with PEI by stirring
8726
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
Fig. 2. Characterization of UCNPs. (a) XRD spectrum of UCNPs. The inset line spectrum corresponds to the literature data for the hexagonal-phase NaYF4 crystal (JCPDS NO: 28-1192). (b) TEM image of UCNPs. (c) FTIR spectrum of UCNPs. The inset TEM image of one typical UCNP shows the PEI layer on the particle surface. in a 40 C oven for 1 h in the presence of a 5.0 g L1 PEI solution, followed by rinsing three times.
2.3. Preparation of CTX:UCNP bioconjugates The presence of free amine groups on the surface of the UCNPs facilitates bonding with the CTX peptide molecules. Typically, 150 mL of 1.0 mg mL1 CTX solution activated by EDC/NHS was dispersed in 10 mM phosphate buffer solution (PBS, PH ¼ 7.4) consisting of 8.06 mM sodium phosphate, 1.94 mM potassium phosphate, 2.7 mM KCl, and 0.137 M NaCl in high-purity dH2O. One hundred microliters of PBS containing 1.0 mg mL1 UCNPs were added; the resulting mixture was then activated by oscillation for 3.0 h at room temperature (25 C) in a reciprocating oscillator. The final CTX:UCNP bioconjugates were isolated by centrifugation, washed several times with PBS, and stored in a refrigerator at 4 C.
2.4. Characterization X-ray powder diffraction (XRD) analyses were performed using a Bruker D8advance X-ray diffractometer with Cu Ka irradiation (k ¼ 1.5406 Å). Transmission electron microscopy (TEM) observations were performed with a JEOL 2010 HT transmission electron microscope operated at 200 kV. Fourier transform infrared (FTIR) spectra were recorded on an Avatar-360 spectrometer. Emission spectra were obtained using a 980-nm CW laser and recorded by a spectrometer (Spectrapro 2500i, Acton) with a liquid nitrogen-cooled CCD (SPEC-10: 100B, Princeton).
2.5. Cell culture and preparation of cell suspension Rat glioma C6 cells obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) were maintained in DMEM (Gibco BRL, USA) with 1% streptomycin/penicillin and 5% fetal bovine serum (Everygreen, Hangzhou, China) at 37 C with 95% air, 5% CO2, and 100% humidity. Cells were digested with 0.5% trypsin when they reached 90% confluence. The cells were prepared for assay with modifications as described below. Cell suspensions were centrifuged at 4 C and 1000 g for 10 min and the supernatants were removed carefully and completely. Cell pellets were resuspended in serum and antibiotic-free DMEM, and cell number was counted using a hemocytometer. 2.6. MTT assay To assess the cytotoxicity of the CTX:UCNP nanoprobes, NIH 3T3 cells were grown in the presence of CTX:UCNPs and the cell viability was measured using the MTT assay. Cells were cultured in 96-well plates (approximately 1 104 cells per well) with medium containing various concentrations of the CTX:UCNPs for 48 h. Then, 20.0 mL of MTT solution (5 mg mL1 MTT in PBS, pH 7.4) was added to each well and the cells were incubated for 4 h at 37 C. After removal of the medium, 150 mL DMSO was added to each well to completely dissolve the MTT crystals. The absorbance of the cell lysate at 570 nm was then measured using an enzyme photometer. Cell viability was expressed as a percentage of the viability of control cells. The results presented represent the mean standard deviation (SD) of ten samples.
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
8727
Fig. 3. Schematic representation of CTX:UCNP binding to glioma cells. (a) Surface chemistry of CTX:UCNPs. (b) CTX:UCNPs binding to cell membranes of glioma cells containing MMP-2. 2.7. Animal toxicity test and tissue distribution analysis All animal studies were approved by the Institutional Animal Care and Use Committee at Wuhan University (Hubei, China). Ten Balb-c mice weighing 20e25 g were purchased from the Animal Experiment Center of Wuhan University and were raised in a cleaning-grade room kept at 24 C and 40%e70% humidity. The mice were divided into two groups (five in each group). After two days of adaptation, the CTX:UCNP nanoprobes were injected into the tail veins of all the mice. The probe concentration was 600 mg mL1 and the injection dose was 200.0 mL. At 24 h postinjection, the mice of one group were killed by cervical dislocation and the major organs (liver, spleen, lung, kidney, and heart) were obtained by dissection. The mice of the other group were carefully monitored daily for seven days and their weights recorded. At the end of the seven-day observation period, these mice were killed and the major tissues were obtained. Quantitative analyses were performed to determine Y concentrations in all the organ samples using quadrupole inductively coupled plasma-mass spectrometry (ICP-MS, Model Agilent 7500a, HewlettePackard, Yokogawa Analytical Systems, Tokyo, Japan) with a Babington nebulizer. 2.8. Upconversion imaging of tumors in vivo Xenograft tumors were established by the subcutaneous injection of a C6 cell suspension into the backs of Balb-c nude mice with 6 105 cells per mouse. CTX:UCNP and UCNP nanoprobes in PBS at the same concentration (200.0 mg mL1) were prepared for active and passive targeting, respectively. Each Balb-c nude mouse was injected with 100 mL of the probes through the tail vein. After allowing 24 h for probe circulation, the Balb-c nude mice were placed under anesthesia for in vivo studies by injection of 3% Nembutal at a dosage of 45 mg kg1. Illumination was provided by a 980-nm power-tunable diode laser (8 W, Wuhan ZJKC Technology Co., Ltd.); the power density at the animal was w500 mW cm2. The images were recorded using a DSLR CCD camera (EOS40D, Canon) equipped with a 300e750 nm band-pass filter (FSR-KG3, Newport) and a 515-nm long-pass filter (OG515, Newport) to reject the scatter from the laser. A fiber-optic spectrometer (Avaspec2048tec, Avantes) equipped with the same filters was used to record the emission spectra of CTX:UCNP probes in vivo.
3. Results and discussion 3.1. Expression and purification of CTX peptide The CTX peptide was prepared using the established recombination method [35]. The GST-CTX fusion protein was expressed in E.
Fig. 4. Fluorescence properties of CTX:UCNP nanoprobes dispersed in PBS at 1.0 mg mL1. (a) Upconversion emission spectrum of CTX:UCNPs. (b) Photostability test of CTX:UCNP nanoprobes under 980-nm, 10 W cm2 CW laser excitation. The inset photographs contain: (i) the solution under white light irradiation, showing its optical transparency; (ii) total upconversion fluorescence under 980-nm light irradiation; and (iii) upconversion fluorescence viewed through a red filter.
coli Rosetta (DE3) cells containing the pGEX-6p-1-CTX plasmid and was purified on a glutathione (GSH) affinity column. After purification, the fusion protein was cleaved by enterokinase to separate the GST protein and the recombinant CTX protein. On enterokinase cleavage, the fusion protein of about 30 kDa was split into two products, including the GST gene product portion at 26 kDa and a small protein at 4.0 kDa (see Fig. 1a). As shown in Fig. 1b, the chromatographic separation yielded two peaks corresponding, respectively, to CTX and GST. The molecular weight of the CTX peptide was determined by matrix-assisted-laser-desorption/ionization time-of-flight mass spectrometry (see Fig. 1c). 3.2. Structure and surface properties of UCNPs The UCNPs were synthesized using an established dopantcontrolled strategy in which the doped Yb, Er, and Ce ions acted as sensitizers, emitters, and phase-controllers, respectively [22]. As shown in the XRD spectrum in Fig. 2a, the peak positions of the synthesized NaYF4:Yb,Er/Ce UCNPs agree well with the literature data of hexagonal-phase NaYF4 crystal (JCPDS standard card 281192), which is generally regarded as the most efficient host
8728
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
Fig. 5. Bright-field, fluorescence, and superimposed images of C6 glioma cells obtained using laser scanning upconversion fluorescence microscopy under CW excitation at 980 nm (aed) C6 cells incubated with the CTX:UCNPs at concentrations of (a) 96 mg mL1, (b) 24 mg mL1, (c) 6.0 mg mL1, and (d) 1.5 mg mL1 (eeh) C6 cells incubated with the unconjugated UCNPs with concentrations of (e) 96 mg mL1, (f) 24 mg mL1, (g) 6.0 mg mL1, and (h) 1.5 mg mL1. The scale bar is 20 mm. All the images were obtained using identical system settings.
material for supporting upconversion fluorescence [4]. The TEM image in Fig. 2b shows that the NaYF4:Yb,Er/Ce UCNPs are wellformed nanorods with an average diameter of w55 nm and length of w25 nm. The inset TEM image in Fig. 2c displays the PEI layer (w0.5 nm) coated on the particle surface. The effect of the PEI layer is demonstrated by the presence of absorption bands from internal vibration of NH2 bonds (1380e1630 cm1) and CH2 stretching vibrations (2850e2950 cm1) in the FTIR spectrum. The intense absorption peak at about 1523 cm1 suggests that there are still a number of free amine groups available on the UCNPs [13]. PEI is known to be an effective transfection medium in gene delivery [36], and has recently been used to modify the particle surface of quantum dots [37] and rare-earth NPs [13,22,38]. It has been demonstrated that our PEI-coated NaYF4 UCNPs are non-cytotoxic with mammalian cells [22]. 3.3. Surface chemistry and optical properties of CTX:UCNP bioconjugates The CTX-conjugated UCNPs can be synthesized according to a facile reaction scheme that takes advantage of the favorable surface conditions exhibited by the prepared UCNPs. As shown in Fig. 3a, the PEI-coated UCNPs are cross-linked with the CTX peptide (4.0 kDa); this cross-linking involves a condensation reaction between the activated carboxyl groups of the CTX peptide and amino groups on the surface of the UCNPs using a standard protocol [39]. No obvious change in fluorescence properties of the UCNPs was observed after the CTX was conjugated, and the resulting CTX:UCNPs were stable for several days when dispersed in a PBS buffer solution. The scheme used to label glioma cells with the CTXconjugated UCNPs is illustrated in Fig. 3b. The CTX peptide
specifically targets glioma cells through its primary receptor, MMP2, which is highly expressed on glioma cell membranes [29]. The membrane-bound MMP-2 complex is co-localized on lipid rafts with the Cl ion channel involved in cell volume regulation during invasion. Fig. 4a presents the upconversion fluorescence spectrum of the CTX:UCNP nanoprobes excited at 980 nm in PBS. The spectrum displays characteristic narrow emission bands assigned to the 4fe4f transitions of Er3þ ions doped in the UCNPs. The green emission originating from the 2H11/2, 4S3/2/4I15/2 transition is observed at w550 nm, whereas the red fluorescence at w660 nm is attributed to the 4F9/2/4I15/2 transition [6]. When the solution of CTX:UCNP nanoprobes in PBS was continually exposed to a 980-nm focused laser beam for over 1 h, there was no reduction in emission intensity, demonstrating their good photo-stability (see Fig. 4b). The inset photographs in Fig. 4b demonstrate both the optical transparency and bright upconversion fluorescence of the CTX:UCNP nanoprobes. Their total fluorescence appears light green in color due to a combination of green and red emissions. Whereas the green emission is filtered when using a red filter, the remaining red emission is still very bright. 3.4. Targeted imaging of cancer cells with CTX:UCNP nanoprobes The ability of CTX:UCNP bioconjugates to label glioma cells was evaluated using laser scanning upconversion fluorescence microscopy under excitation at 980 nm. Live C6 glioma cells were incubated with either CTX:UCNPs or unconjugated UCNPs at different concentrations (1.5e96 mg mL1) at 37 C and 5% CO2 for 60 min. As shown in Fig. 5, the live C6 glioma cells incubated with the CTX:UCNPs show intense upconversion fluorescence signals under 980-nm excitation. Superimposition of images obtained under
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
8729
analyzed using ICP-MS 24 h and 7 days after intravenous injection of the CTX:UCNPs (200.0 mL of 1.0 mg mL1 per mouse) [40]. As shown in Fig. 6b, high concentrations of Y were found in the lung and spleen 24 h post-injection, whereas Y concentrations in all the organs declined to very low levels (below 20 mg g1 dry weight) 7 days post-injection. It was also observed that the health status and behavior of all the animals were normal during the 7 day period and that their weight increased continuously. These results suggest that there are no potentially damaging retention profiles associated with administration of these nanoprobes and that they can be safely used for in vivo applications. 3.6. Tumor targeting and visualizing with CTX:UCNP nanoprobes
Fig. 6. Biocompatibility test of CTX:UCNPs. (a) Cell viability of NIH 3T3 cells treated with different concentrations of CTX:UCNPs; viability was determined using the MTT method. (b) Organ and tissue distribution of Y concentration at 24 h and 7 days postinjection of CTX:UCNPs into Balb-c mice.
different probe concentrations indicates that the upconversion signal distributions are strongly correlated with the C6 glioma cells, which is attributed to the highly specific interaction between CTX and MMP-2 in the cell membranes. In contrast, C6 glioma cells incubated with unconjugated UCNPs display a much weaker fluorescence signal, suggesting low, non-specific particle binding to the cells. These results indicate that the prepared CTX:UCNP nanoprobes specifically target glioma cells. Furthermore, it should be noted that no autofluorescence signal was measured in the upconversion signal of cell images. This feature cannot be obtained in conventional fluorescence bioimaging based on the downconversion mechanism. 3.5. Biocompatibility of CTX:UCNP nanoprobes Fig. 6a shows the viability of NIH 3T3 cells grown for 24 h in the presence of CTX:UCNPs at concentrations ranging from 5.0 to 300.0 mg mL1. The CTX:UCNPs are not toxic to NIH 3T3 cells even at the relatively high concentration of 300.0 mg mL1, which is much higher than the highest concentration used above for glioma cell imaging. To further investigate the biocompatibility of the CTX:UCNP nanoprobes in living animals, Y concentrations in the organs (including liver, spleen, lung, kidney, and heart) of Balb-c mice were
The suitability of the CTX:UCNP nanoprobes for the targeting and visualization of tumors in vivo was evaluated by fluorescence imaging with Balb-c nude mice bearing xenograft glioma tumors. The mice bearing xenograft tumors 3 weeks post-inoculation of 5 106 C6 cells on the back (tumor size about 0.5e1.0 cm) were divided into two groups (three animals in each group). CTX:UCNPs or unconjugated UCNPs (w20.0 mg per animal) were administered to animals of the two groups through tail vein injection. At about 24 h post-injection, the mice were imaged using the established upconversion imaging system [22]. The excitation was provided by a CW laser at 980 nm with a power density at the animal of w550 mW cm2. This power density is below the conservative limit set for human skin exposure at 980 nm of 726 mW cm2 [41]. As shown in Fig. 7a, significant upconversion fluorescence was found in the xenograft tumors of the CTX:UCNPs-injected Balb-c nude mice (n ¼ 3); this red fluorescence can be directly observed by the naked eye, demonstrating the direct visualization of the tumor in vivo. In contrast, no obvious fluorescence signal was observed in the tumors of the UCNPs-injected Balb-c nude mice, proving the specificity of the CTX-based probes for targeting xenograft gliomas. The resulting high-contrast true-color image is due to the characteristic upconversion fluorescence from the tumor and the near absence of autofluorescence from normal tissues. The high signalto-background ratio is further demonstrated by the upconversion emission spectra recorded at the tumor site and normal tissue site (See Fig. 7b). In accordance with the red output color of the fluorescence, the red emission band at w660 nm is almost exclusively obtained from the tumor site due to its much deeper tissue penetration than that of the w550 nm green band [22]. In fact, most of the 660-nm emission band falls within the so-called “optical window” of biological tissues (from 650 nm to infrared) [42], which generally support deep tissue penetrability (over 1 cm) of the probe fluorescence. For quantification of the signal contrast, the truecolor images were converted to pseudo-color images using ImagePro Plus software. The obtained pseudo-color image of the CTX:UCNPs-injected Balb-c nude mouse clearly shows an irregular distribution of the fluorescence signal around the tumor, suggesting the possible diffusion of the cancer. After in vivo studies, all the tumors in the two groups were dissected and rinsed with PBS and then imaged using identical system settings. The representative images of the dissected tumors are shown in Fig. 7c. The brightly visible red upconversion fluorescence can be found only in the tumors from the CTX:UCNPs-injected mice (n ¼ 3), further demonstrating the much higher cancer specificity of the CTX:UCNP nanoprobes compared with that of the unconjugated UCNPs. Fig. 8 shows representative ex vivo fluorescence images of dissected tumors and organs of nude mice killed 24 h post-injection of CTX:UCNPs or unconjugated UCNPs. Compared with the strong red fluorescence seen in tumors of the CTX:UCNPs-injected mice, upconversion signals are rarely seen in the kidney, heart, and liver, indicating that the probes sustained sufficient circulation time for
8730
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
Fig. 7. Tumor targeting and visualization in Balb-c nude mice under 980-nm CW light irradiation. (a) In vivo upconversion imaging of a representative Balb-c nude mouse after intravenous injection of CTX:UCNPs (top) or unconjugated UCNPs (bottom) for 24 h. Pseudo-color images were converted from corresponding true-color images using Image-Pro Plus software. (b) Upconversion emission spectra recorded at the tumor site (top) or normal tissue site (bottom). (c) Imaging of the dissected tumors from a representative Balb-c nude mouse injected with CTX:UCNPs (top) or unconjugated UCNPs (bottom).
targeting. Though some deposition in lung and spleen can be observed, the fluorescence images demonstrate that the CTX:UCNPs were primarily localized to tumor tissue, with little macrophage uptake.
4. Conclusions The prepared CTX:UCNP nanoprobes exhibit bright upconversion fluorescence, specific targeting of tumor cells, and exhibit low toxicity for both cells and small animals. After intravenous injection of the CTX:UCNP nanoprobes, we have achieved direct visualization of tumors in vivo using the highly efficient NIR-to-red upconversion fluorescence. The results suggest that the neurotoxin-conjugated upconversion nanoprobes may provide an approach to improve the effectiveness of tumor diagnostic and therapeutic modalities.
Acknowledgments This work was supported by grants from the NSFC (no.s 10904119 and 30971500), the National Basic Research Program of China (no.s 2010CB529800 and 2010CB530100), the China postdoctoral science foundation (no. 20090451076), and the Program for Changjiang Scholars and Innovative Research Team in University (no. IRT0745).
Appendix
Fig. 8. Representative NIR-to-red upconversion fluorescence images of the dissected tumors and organs from Balb-c nude mice 24 h after intravenous injection of CTX:UCNPs (a) or unconjugated UCNPs (b).
Figures with essential color discrimination. Figs. 3e5, 7, 8 in this article are difficult to interpret in black and white. The full color images can be found in the online version, at doi:10.1016/j. biomaterials.2010.07.099.
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
References [1] Gao X, Cui Y, Levenson RM, Chung LWK, Nie S. In vivo cancer targeting and imaging with semiconductor quantum dots. Nat Biotechnol 2004;22(8):969e76. [2] le Masne de Chermont Q, Chanéac C, Seguin J, Pellé F, Maîtrejean S, Jolivet JP, et al. Nanoprobes with near-infrared persistent luminescence for in vivo imaging. Proc Natl Acad Sci USA 2007;104(22):9266e71. [3] van de Rijek F, Zijlmans H, Li S, Vail T, Raap AK, Niedbala RS, et al. Up-converting phosphor reporters for nucleic acid microarrays. Nat Biotechnol 2001;19(3):273e6. [4] Wang F, Liu X. Recent advances in the chemistry of lanthanide-doped up-conversion nanocrystals. Chem Soc Rev 2009;38(4):976e89. [5] Palmer RJ, Butenhoff JL, Stevens JB. Cytotoxicity of the rare-earth-metals cerium, lanthanum, and neodymium in vitro-comparisons with cadmium in a pulmonary macrophage primary culture system. Environ Res 1987;43(1):142e56. [6] Heer S, Kömpe K, Güdel HU, Haase M. Highly efficient multicolor upconversion emission in transparent colloids of lanthanide-doped NaYF4 nanocrystals. Adv Mater 2004;16(23e24):2102e5. [7] Zeng JH, Su J, Li ZH, Yan RX, Li YD. Synthesis and upconversion luminescence of hexagonal-phase NaYF4:Yb, Er3þ phosphors of controlled size and morphology. Adv Mater 2005;17(17):2119e23. [8] Mai HX, Zhang YW, Si R, Yan ZG, Sun LD, You LP, et al. High-quality sodium rare-earth fluoride nanocrystals: controlled synthesis and optical properties. J Am Chem Soc 2006;128(19):6426e36. [9] Yi GS, Chow GM. Synthesis of hexagonal-phase NaYF4:Yb, Er and NaYF4:Yb, Tm nanocrystals with efficient up-conversion fluorescence. Adv Funct Mater 2006;16(18):2324e9. [10] Boyer JC, Cuccia LA, Capobianco JA. Synthesis of colloidal upconverting NaYF4: Er3þ/Yb3þ and Tm3þ/Yb3þ monodisperse nanocrystals. Nano Lett 2007;7 (3):847e52. [11] Wang HQ, Nann T. Monodisperse upconverting nanocrystals by microwaveassisted synthesis. Acs Nano 2009;3(11):3804e8. [12] Li ZQ, Zhang Y. Monodisperse silica-coated polyvinylpyrrolidone/NaYF4 nanocrystals with multicolor upconversion fluorescence emission. Angew Chem Int Ed 2006;45(46):7732e5. [13] Wang F, Chatterjee DK, Li Z, Zhang Y, Fan X, Wang M. Synthesis of polyethylenimine/NaYF4 nanoparticles with up-conversion fluorescence. Nanotechnology 2006;17(23):5786e91. [14] Wang F, Liu X. Upconversion multicolor fine-tuning: visible to near-Infrared emission from lanthanide-doped NaYF4 nanoparticles. J Am Chem Soc 2008;130(17):5642e3. [15] Chen Z, Chen H, Hu H, Yu M, Li F, Zhang Q, et al. Versatile synthesis strategy for carboxylic acid-functionalized upconverting nanophosphors as biological labels. J Am Chem Soc 2008;130(10):3023e9. [16] Lim SF, Riehn R, Ryu WS, Khanarian N, Tung CK, Tank D, et al. In vivo and scanning electron microscopy imaging of upconverting nanophosphors in caenorhabditis elegans. Nano Lett 2006;6(2):169e74. [17] Chatterjeea DK, Rufaihaha AJ, Zhang Y. Upconversion fluorescence imaging of cells and small animals using lanthanide doped nanocrystals. Biomaterials 2008;29(30):937e43. [18] Jalil RA, Zhang Y. Biocompatibility of silica coated NaYF4 up-conversion fluorescent nanocrystals. Biomaterials 2008;29(30):4122e8. [19] Nyk M, Kumar R, Ohulchanskyy TY, Bergey EJ, Prasad PN. High contrast in vitro and in vivo photoluminescence bioimaging using near infrared to near infrared up-conversion in Tm3þ and Yb3þ doped fluoride nanophosphors. Nano Lett 2008;8(11):3834e8. [20] Xiong LQ, Chen ZG, Yu MX, Li FY, Liu C, Huang CH. Synthesis, characterization, and in vivo targeted imaging of amine-functionalized rare-earth up-converting nanophosphors. Biomaterials 2009;30(29):5592e600.
8731
[21] Xiong L, Chen Z, Tian Q, Cao T, Xu C, Li F. High contrast upconversion luminescence targeted imaging in vivo using peptide-labeled nanophosphors. Anal Chem 2009;81(21):8687e94. [22] Yu XF, Li M, Xie MY, Chen LD, Li Y, Wang QQ. Dopant-controlled synthesis of water-soluble hexagonal NaYF4 nanorods with efficient up-conversion fluorescence for multicolor bioimaging. Nano Res 2010;3(1):51e60. [23] Iyer G, Michalet X, Chang YP, Pinaud FF, Matyas SE, Payne G, et al. High affinity scFv-hapten pair as a tool for quantum dot labeling and tracking of single proteins in live cells. Nano Lett 2008;8(12):4618e23. [24] Orndorff RL, Rosenthal SJ. Neurotoxin quantum dot conjugates detect endogenous targets expressed in live cancer cells. Nano Lett 2009;9 (7):2589e99. [25] Aina OH, Sroka TC, Chen ML, Lam KS. Therapeutic cancer targeting peptides. Biopolymers 2002;66(3):184e99. [26] Yamamoto Y, Tsutsumi Y, Mayumi T. Molecular design of bioconjugated cell adhesion peptide with a water-soluble polymeric modifier for enhancement of antimetastatic effect. Curr Drug Targets 2002;3(2):123e30. [27] Veiseh O, Sun C, Gunn J, Kohler N, Gabikian P, Lee D, et al. Optical and MRI multifunctional nanoprobe for targeting gliomas. Nano Lett 2005;5 (6):1003e8. [28] DeBin JA, Maggio JE, Strichartz GR. Purification and characterization of chlorotoxin, a chloride channel ligand from the venom of the scorpion. Am J Physiol 1993;264(2):C361e9. [29] Deshane J, Garner CC, Sontheimer H. Chlorotoxin inhibits glioma cell invasion via matrix metalloproteinase-2. J Biol Chem 2003;278(6):4135e44. [30] McFerrin MB, Sontheimer H. A role for ion channels in glioma cell invasion. Neuron Glia Biol 2006;2(1):39e49. [31] Kurpad SN, Zhao XG, Wikslrand CJ, Balra SK, McLendon RE, Bigner DD. Tumor antigens in astrocytic gliomas. Glia 1995;15(3):244e56. [32] Veiseh M, Gabikian P, Bahrami SB, Veiseh O, Zhang M, Hackman RC, et al. Tumor paint: a chlorotoxin:Cy5.5 bioconjugate for intraoperative visualization of cancer foci. Cancer Res 2007;67(14):6882e8. [33] Fan S, Sun Z, Jiang D, Dai C, Ma Y, Zhao Z, et al. BmKCT toxin inhibits glioma proliferation and tumor metastasis. Cancer Lett 2010;291 (2):158e66. [34] Veiseh O, Gunn JW, Kievit FM, Sun C, Fang C, Lee JSH, et al. Inhibition of tumor-cell invasion with chlorotoxin-bound superparamagnetic nanoparticles. Small 2009;5(2):256e64. [35] Han S, Yi H, Yin SJ, Chen ZY, Liu H, Cao ZJ, et al. Structural basis of a potent peptide inhibitor designed for Kv1.3 channel, a therapeutic target of autoimmune disease. J Biol Chem 2008;283(27):19058e65. [36] Babacan S, Pivarnik P, Letcher S, Rand AG. Evaluation of antibody immobilization methods for piezoelectric biosensor application. Biosens Bioelectron 2000;15(11e12):615e21. [37] Smith AM, Duan H, Rhyner MN, Ruan G, Nie S. A systematic examination of surface coatings on the optical and chemical properties of semiconductor quantum dots. Phys Chem Chem Phys 2006;8(33):3895e903. [38] Setua S, Menon D, Asok A, Nair S, Koyakutty M. Folate receptor targeted, rareearth oxide nanocrystals for bi-modal fluorescence and magnetic imaging of cancer cells. Biomaterials 2010;31(4):714e29. [39] Hermanson GT. Bioconjugate techniques. 2nd ed. New York: Academic Press; 2008. [40] Chen LD, Liu J, Yu XF, He M, Pei XF, Tang ZY, et al. The biocompatibility of quantum dot probes used for the targeted imaging of hepatocellular carcinoma metastasis. Biomaterials 2008;29(31):4170e6. [41] American National Standard for safe use of lasers, ANSI Z136. 1-2000. Orlando: American National Standard Institute; 2000. [42] Smith AM, Mancini MC, Nie S. Bioimaging: second window for in vivo imaging. Nat Nano 2009;4(11):710e1.
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Neurotoxin-conjugated upconversion nanoprobes for direct visualization of tumors under near-infrared irradiation Xue-Feng Yu a, b,1, Zhengbo Sun a,1, Min Li b, Yang Xiang b, Qu-Quan Wang b, *, Fenfen Tang a, Yingliang Wu a, Zhijian Cao a, *, Wenxin Li a, * a b
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China Key Laboratory of Artificial Micro- and Nano-structures of Ministry of Education and School of Physics and Technology, Wuhan University, Wuhan 430072, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 5 June 2010 Accepted 28 July 2010 Available online 21 August 2010
We report the development of neurotoxin-mediated upconversion nanoprobes for tumor targeting and visualization in living animals. The nanoprobes were synthesized by preparing polyethylenimine-coated hexagonal-phase NaYF4:Yb,Er/Ce nanoparticles and conjugating them with recombinant chlorotoxin, a typical peptide neurotoxin that could bind with high specificity to many types of cancer cells. Nanoprobes that specifically targeted glioma cells were visualized by laser scanning upconversion fluorescence microscopy. Good probe biocompatibility was displayed with cellular and animal toxicity determinations. Animal studies were performed using Balb-c nude mice injected intravenously with the nanoprobes. The obtained high-contrast images demonstrated highly specific tumor binding and direct tumor visualization with bright red fluorescence under 980-nm near-infrared irradiation. The high sensitivity and high specificity of the neurotoxin-mediated upconversion nanoprobes and the simplification of the required optical device for tumor visualization suggest an approach that may help improve the effectiveness of the diagnostic and therapeutic modalities available for tumor patients. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Upconversion nanoparticle Fluorescence Imaging Cancer targeting Chlorotoxin
1. Introduction Molecular targeting of nanoprobes to cancer cells and the tracking of such targeted probes in vivo have been suggested to be of potential utility in early-stage tumor diagnosis. Recent interdisciplinary research in this area has generated fluorescent probes that exhibit high sensitivity, high specificity, and good biocompatibility [1,2]. Rare-earth upconversion nanoparticles (UCNPs), which absorb low energy near-infrared (NIR) light and upconvert to emit in the visible spectrum, have recently been proposed as a new generation of probes for bioimaging [3]. Upconversion fluorescence possesses many advantages, including non-invasive and deep tissue penetration of the NIR excitation, sharp visible emission lines, long fluorescence lifetime, superior photo-stability, and the near absence of tissue autofluorescence resulting in a high signalto-background ratio [4]. Furthermore, the rare-earth elements of
* Corresponding authors. Tel.: þ86 27 68752481/8098; fax: þ86 27 68752569. E-mail addresses: [email protected] (Q.-Q. Wang), [email protected] (Z. Cao), [email protected] (W. Li). 1 X. F. Yu and Z. Sun contributed equally to this work. 0142-9612/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2010.07.099
the UCNPs generally have lower toxicity than semiconductor elements of the commonly used quantum dots [5]. Following significant progress in techniques for their synthesis [6e11] and surface modification [12e15], rare-earth UCNPs have recently been introduced for cell and animal imaging [16e22]. Zhang’s group has reported in vitro and in vivo tissue imaging in mice using NaYF4:Yb,Er UCNPs [17,18]. Prasad et al. have reported whole-body imaging of a Balb-c mouse using NIR (980 nm) to NIR (800 nm) upconversion fluorescence of NaYF4:Yb,Tm UCNPs [19]. Our group has achieved tissue-sensitive multicolor upconversion imaging in mice using water-soluble hexagonal-phase NaYF4:Yb,Er/ La UCNPs [22]. Notwithstanding these efforts, the visualization of tumors in vivo using upconversion fluorescence is still a great challenge due to the difficulties that exist both in synthesizing bright UCNPs bearing appropriate functional groups and in preparing corresponding bioconjugates with suitable tumorspecific agents. Recently, high-affinity polypeptide neurotoxins have been shown to be effective agents for probing biological systems with high specificity [23,24]. For preparing tumor-specific nanoprobes, small peptides are often more useful than the more commonly used antibodies because they provide better cellular uptake and tissue penetration when introduced to animals in vivo [25].
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
8725
Fig. 1. Expression, purification and characterization of CTX peptide. (a) Tricine-SDS-PAGE analysis of expression and purification of the recombinant CTX peptide. Lane 1: un-induced cell-free extract of E. coli carrying pGEX-6p-1-CTX; Lane 2: total cell-free extract of E. coli carrying pGEX-6p-1-CTX induced with IPTG for 4.0 h; Lane 3: the fusion protein purified using the GSH-agarose system; Lane 4: the fusion protein cleaved by enterokinase; Lane 5: the CTX peptide purified by HPLC; Lane 6: protein molecular weight markers. (b) Purification of the recombinant CTX peptide by HPLC. (c) MALDI-TOF-MS mass spectrum of the recombinant CTX peptide.
Furthermore, the conjugation of peptides to nanoparticles can overcome the limitations of short half-life in blood and poor tissue retention [26,27]. One peptide neurotoxin of interest with respect to such applications is an insect venom toxin known as chlorotoxin (CTX) isolated from the scorpion Leiurus quengestriatus [28]. CTX is thought to specifically target many types of cancers of neuroectodermal origin by binding to a surfaceebound complex that includes the matrix metalloproteinase 2 (MMP-2) endopeptidase [29,30]. CTX is of particular biological interest due to its potential ability to target primary brain tumors (glioma), one of the most deadly forms of cancer [31]. Olson’s group [32] and our group [33] have prepared Cy5.5-conjugated CTX and its analog for use in glioma tumor fluorescence imaging. CTX has also been suggested to be a suitable peptide for nanoparticle bioconjugation [24,27,34]. In this work, we prepared a tumor-specific and low-toxic fluorescence nanoprobe by conjugation of CTX peptides with rare-earth UCNPs, studied targeted imaging of cancer cells with such CTX:UCNP nanoprobes by using continuous wave (CW) NIR irradiation, and investigated the cytotoxicity and tissue distribution of the nanoprobes. Furthermore, we explored the use of the CTX:UCNP nanoprobes for upconversion fluorescence imaging of xenograft glioma tumors in Balb-c nude mice in vivo and ex vivo. 2. Materials and methods 2.1. Expression, purification and characterization of CTX peptide The CTX nucleotide sequence was generated from the natural CTX peptide by an overlapping PCR method [28]. A second PCR reaction was performed using the
products of the overlapping PCR as a template. The primers used were: sense primer 1,50 -GCCGGATCCCCGATGACGATGACAAAATGTGTATGCCGTGCTTCACTACC-30 ; sense primer 2, 50 -CGTAAATGTGACGATTGCTGTGGTGGCAAAGGTCGTGGTAAATGCTACGG30 ; antisense primer 1, 50 -CAATCGTCACATTTACGTGCCATCTGGTGATCGGTAGTGAG CACGGCAT-30 ; antisense primer 2, 50 -GCCCTCGAGTCAACGGCACAGACACTGCGGAC CGTAGCATTTACCACGAC-30 .After digestion with BamHI and XhoI, the PCR products were subcloned into pGEX-6p-1 at the BamHIeXhoI-cut site. The recombinant pGEX6p-1-CTX plasmid, confirmed by sequencing, was transformed into Escherichia coli Rosetta (DE3) cells and the transformed cells were cultured at 37 C in LB medium with ampicillin (100 mg mL1). When the cell density reached an OD of 0.6, 1.0 mM isopropyl thio-b-D-galactoside was added to induce expression at 28 C. Cells were harvested after 4 h and resuspended in 50 mM TriseHCl and 10 mM Na2EDTA (pH 8.0). Supernatant from the bacterial cell lysate was loaded onto a glutathione transferase (GST) binding column. The purified fusion protein was desalted using centrifugal filtration (Millipore) and cleaved by enterokinase (Biowisdom) at 25 C for 16 h. Protein samples were separated by HPLC on a C18 column (10 250 mm, 5 mm) (EliteHPLC) using a linear gradient from 10 to 80% acetonitrile with 0.1% trifluoroacetic acid for 60 min with detection at 230 nm. The CTX peptide eluted as a major peak at 21e24% acetonitrile. The molecular mass of the purified CTX peptide was obtained by MALDI-TOF-MS.
2.2. Synthesis of polyethylenimine-coated UCNPs UCNPs The water-soluble hexagonal-phase NaYF4:Yb,Er/Ce (Y:Yb:Er:Ce ¼ 72:20:5:3) coated with polyethylenimine (PEI) were synthesized using a modification of the method reported previously [22]. In brief, a growth solution was prepared by dissolving RECl3 (RE: Y, Yb, Er, and Ce) and NaCl in water at final RE and Naþ ion concentrations of 0.5 mol L1. Under vigorous agitation, 15.0 mL ethanol, 5.0 mL PEI solution (MW ¼ 10000, 5% by weight), and an appropriate amount of NH4F were added. The mixture was then transferred to a Teflon-lined autoclave. After purging of the air by N2 bubbling for 20 min, the mixture was sealed and heated at 200 C for 3 h. After cooling, the obtained UCNPs were washed several times with ethanol and water and dried in a vacuum. The particle surfaces were then re-functionalized with PEI by stirring
8726
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
Fig. 2. Characterization of UCNPs. (a) XRD spectrum of UCNPs. The inset line spectrum corresponds to the literature data for the hexagonal-phase NaYF4 crystal (JCPDS NO: 28-1192). (b) TEM image of UCNPs. (c) FTIR spectrum of UCNPs. The inset TEM image of one typical UCNP shows the PEI layer on the particle surface. in a 40 C oven for 1 h in the presence of a 5.0 g L1 PEI solution, followed by rinsing three times.
2.3. Preparation of CTX:UCNP bioconjugates The presence of free amine groups on the surface of the UCNPs facilitates bonding with the CTX peptide molecules. Typically, 150 mL of 1.0 mg mL1 CTX solution activated by EDC/NHS was dispersed in 10 mM phosphate buffer solution (PBS, PH ¼ 7.4) consisting of 8.06 mM sodium phosphate, 1.94 mM potassium phosphate, 2.7 mM KCl, and 0.137 M NaCl in high-purity dH2O. One hundred microliters of PBS containing 1.0 mg mL1 UCNPs were added; the resulting mixture was then activated by oscillation for 3.0 h at room temperature (25 C) in a reciprocating oscillator. The final CTX:UCNP bioconjugates were isolated by centrifugation, washed several times with PBS, and stored in a refrigerator at 4 C.
2.4. Characterization X-ray powder diffraction (XRD) analyses were performed using a Bruker D8advance X-ray diffractometer with Cu Ka irradiation (k ¼ 1.5406 Å). Transmission electron microscopy (TEM) observations were performed with a JEOL 2010 HT transmission electron microscope operated at 200 kV. Fourier transform infrared (FTIR) spectra were recorded on an Avatar-360 spectrometer. Emission spectra were obtained using a 980-nm CW laser and recorded by a spectrometer (Spectrapro 2500i, Acton) with a liquid nitrogen-cooled CCD (SPEC-10: 100B, Princeton).
2.5. Cell culture and preparation of cell suspension Rat glioma C6 cells obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) were maintained in DMEM (Gibco BRL, USA) with 1% streptomycin/penicillin and 5% fetal bovine serum (Everygreen, Hangzhou, China) at 37 C with 95% air, 5% CO2, and 100% humidity. Cells were digested with 0.5% trypsin when they reached 90% confluence. The cells were prepared for assay with modifications as described below. Cell suspensions were centrifuged at 4 C and 1000 g for 10 min and the supernatants were removed carefully and completely. Cell pellets were resuspended in serum and antibiotic-free DMEM, and cell number was counted using a hemocytometer. 2.6. MTT assay To assess the cytotoxicity of the CTX:UCNP nanoprobes, NIH 3T3 cells were grown in the presence of CTX:UCNPs and the cell viability was measured using the MTT assay. Cells were cultured in 96-well plates (approximately 1 104 cells per well) with medium containing various concentrations of the CTX:UCNPs for 48 h. Then, 20.0 mL of MTT solution (5 mg mL1 MTT in PBS, pH 7.4) was added to each well and the cells were incubated for 4 h at 37 C. After removal of the medium, 150 mL DMSO was added to each well to completely dissolve the MTT crystals. The absorbance of the cell lysate at 570 nm was then measured using an enzyme photometer. Cell viability was expressed as a percentage of the viability of control cells. The results presented represent the mean standard deviation (SD) of ten samples.
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
8727
Fig. 3. Schematic representation of CTX:UCNP binding to glioma cells. (a) Surface chemistry of CTX:UCNPs. (b) CTX:UCNPs binding to cell membranes of glioma cells containing MMP-2. 2.7. Animal toxicity test and tissue distribution analysis All animal studies were approved by the Institutional Animal Care and Use Committee at Wuhan University (Hubei, China). Ten Balb-c mice weighing 20e25 g were purchased from the Animal Experiment Center of Wuhan University and were raised in a cleaning-grade room kept at 24 C and 40%e70% humidity. The mice were divided into two groups (five in each group). After two days of adaptation, the CTX:UCNP nanoprobes were injected into the tail veins of all the mice. The probe concentration was 600 mg mL1 and the injection dose was 200.0 mL. At 24 h postinjection, the mice of one group were killed by cervical dislocation and the major organs (liver, spleen, lung, kidney, and heart) were obtained by dissection. The mice of the other group were carefully monitored daily for seven days and their weights recorded. At the end of the seven-day observation period, these mice were killed and the major tissues were obtained. Quantitative analyses were performed to determine Y concentrations in all the organ samples using quadrupole inductively coupled plasma-mass spectrometry (ICP-MS, Model Agilent 7500a, HewlettePackard, Yokogawa Analytical Systems, Tokyo, Japan) with a Babington nebulizer. 2.8. Upconversion imaging of tumors in vivo Xenograft tumors were established by the subcutaneous injection of a C6 cell suspension into the backs of Balb-c nude mice with 6 105 cells per mouse. CTX:UCNP and UCNP nanoprobes in PBS at the same concentration (200.0 mg mL1) were prepared for active and passive targeting, respectively. Each Balb-c nude mouse was injected with 100 mL of the probes through the tail vein. After allowing 24 h for probe circulation, the Balb-c nude mice were placed under anesthesia for in vivo studies by injection of 3% Nembutal at a dosage of 45 mg kg1. Illumination was provided by a 980-nm power-tunable diode laser (8 W, Wuhan ZJKC Technology Co., Ltd.); the power density at the animal was w500 mW cm2. The images were recorded using a DSLR CCD camera (EOS40D, Canon) equipped with a 300e750 nm band-pass filter (FSR-KG3, Newport) and a 515-nm long-pass filter (OG515, Newport) to reject the scatter from the laser. A fiber-optic spectrometer (Avaspec2048tec, Avantes) equipped with the same filters was used to record the emission spectra of CTX:UCNP probes in vivo.
3. Results and discussion 3.1. Expression and purification of CTX peptide The CTX peptide was prepared using the established recombination method [35]. The GST-CTX fusion protein was expressed in E.
Fig. 4. Fluorescence properties of CTX:UCNP nanoprobes dispersed in PBS at 1.0 mg mL1. (a) Upconversion emission spectrum of CTX:UCNPs. (b) Photostability test of CTX:UCNP nanoprobes under 980-nm, 10 W cm2 CW laser excitation. The inset photographs contain: (i) the solution under white light irradiation, showing its optical transparency; (ii) total upconversion fluorescence under 980-nm light irradiation; and (iii) upconversion fluorescence viewed through a red filter.
coli Rosetta (DE3) cells containing the pGEX-6p-1-CTX plasmid and was purified on a glutathione (GSH) affinity column. After purification, the fusion protein was cleaved by enterokinase to separate the GST protein and the recombinant CTX protein. On enterokinase cleavage, the fusion protein of about 30 kDa was split into two products, including the GST gene product portion at 26 kDa and a small protein at 4.0 kDa (see Fig. 1a). As shown in Fig. 1b, the chromatographic separation yielded two peaks corresponding, respectively, to CTX and GST. The molecular weight of the CTX peptide was determined by matrix-assisted-laser-desorption/ionization time-of-flight mass spectrometry (see Fig. 1c). 3.2. Structure and surface properties of UCNPs The UCNPs were synthesized using an established dopantcontrolled strategy in which the doped Yb, Er, and Ce ions acted as sensitizers, emitters, and phase-controllers, respectively [22]. As shown in the XRD spectrum in Fig. 2a, the peak positions of the synthesized NaYF4:Yb,Er/Ce UCNPs agree well with the literature data of hexagonal-phase NaYF4 crystal (JCPDS standard card 281192), which is generally regarded as the most efficient host
8728
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
Fig. 5. Bright-field, fluorescence, and superimposed images of C6 glioma cells obtained using laser scanning upconversion fluorescence microscopy under CW excitation at 980 nm (aed) C6 cells incubated with the CTX:UCNPs at concentrations of (a) 96 mg mL1, (b) 24 mg mL1, (c) 6.0 mg mL1, and (d) 1.5 mg mL1 (eeh) C6 cells incubated with the unconjugated UCNPs with concentrations of (e) 96 mg mL1, (f) 24 mg mL1, (g) 6.0 mg mL1, and (h) 1.5 mg mL1. The scale bar is 20 mm. All the images were obtained using identical system settings.
material for supporting upconversion fluorescence [4]. The TEM image in Fig. 2b shows that the NaYF4:Yb,Er/Ce UCNPs are wellformed nanorods with an average diameter of w55 nm and length of w25 nm. The inset TEM image in Fig. 2c displays the PEI layer (w0.5 nm) coated on the particle surface. The effect of the PEI layer is demonstrated by the presence of absorption bands from internal vibration of NH2 bonds (1380e1630 cm1) and CH2 stretching vibrations (2850e2950 cm1) in the FTIR spectrum. The intense absorption peak at about 1523 cm1 suggests that there are still a number of free amine groups available on the UCNPs [13]. PEI is known to be an effective transfection medium in gene delivery [36], and has recently been used to modify the particle surface of quantum dots [37] and rare-earth NPs [13,22,38]. It has been demonstrated that our PEI-coated NaYF4 UCNPs are non-cytotoxic with mammalian cells [22]. 3.3. Surface chemistry and optical properties of CTX:UCNP bioconjugates The CTX-conjugated UCNPs can be synthesized according to a facile reaction scheme that takes advantage of the favorable surface conditions exhibited by the prepared UCNPs. As shown in Fig. 3a, the PEI-coated UCNPs are cross-linked with the CTX peptide (4.0 kDa); this cross-linking involves a condensation reaction between the activated carboxyl groups of the CTX peptide and amino groups on the surface of the UCNPs using a standard protocol [39]. No obvious change in fluorescence properties of the UCNPs was observed after the CTX was conjugated, and the resulting CTX:UCNPs were stable for several days when dispersed in a PBS buffer solution. The scheme used to label glioma cells with the CTXconjugated UCNPs is illustrated in Fig. 3b. The CTX peptide
specifically targets glioma cells through its primary receptor, MMP2, which is highly expressed on glioma cell membranes [29]. The membrane-bound MMP-2 complex is co-localized on lipid rafts with the Cl ion channel involved in cell volume regulation during invasion. Fig. 4a presents the upconversion fluorescence spectrum of the CTX:UCNP nanoprobes excited at 980 nm in PBS. The spectrum displays characteristic narrow emission bands assigned to the 4fe4f transitions of Er3þ ions doped in the UCNPs. The green emission originating from the 2H11/2, 4S3/2/4I15/2 transition is observed at w550 nm, whereas the red fluorescence at w660 nm is attributed to the 4F9/2/4I15/2 transition [6]. When the solution of CTX:UCNP nanoprobes in PBS was continually exposed to a 980-nm focused laser beam for over 1 h, there was no reduction in emission intensity, demonstrating their good photo-stability (see Fig. 4b). The inset photographs in Fig. 4b demonstrate both the optical transparency and bright upconversion fluorescence of the CTX:UCNP nanoprobes. Their total fluorescence appears light green in color due to a combination of green and red emissions. Whereas the green emission is filtered when using a red filter, the remaining red emission is still very bright. 3.4. Targeted imaging of cancer cells with CTX:UCNP nanoprobes The ability of CTX:UCNP bioconjugates to label glioma cells was evaluated using laser scanning upconversion fluorescence microscopy under excitation at 980 nm. Live C6 glioma cells were incubated with either CTX:UCNPs or unconjugated UCNPs at different concentrations (1.5e96 mg mL1) at 37 C and 5% CO2 for 60 min. As shown in Fig. 5, the live C6 glioma cells incubated with the CTX:UCNPs show intense upconversion fluorescence signals under 980-nm excitation. Superimposition of images obtained under
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
8729
analyzed using ICP-MS 24 h and 7 days after intravenous injection of the CTX:UCNPs (200.0 mL of 1.0 mg mL1 per mouse) [40]. As shown in Fig. 6b, high concentrations of Y were found in the lung and spleen 24 h post-injection, whereas Y concentrations in all the organs declined to very low levels (below 20 mg g1 dry weight) 7 days post-injection. It was also observed that the health status and behavior of all the animals were normal during the 7 day period and that their weight increased continuously. These results suggest that there are no potentially damaging retention profiles associated with administration of these nanoprobes and that they can be safely used for in vivo applications. 3.6. Tumor targeting and visualizing with CTX:UCNP nanoprobes
Fig. 6. Biocompatibility test of CTX:UCNPs. (a) Cell viability of NIH 3T3 cells treated with different concentrations of CTX:UCNPs; viability was determined using the MTT method. (b) Organ and tissue distribution of Y concentration at 24 h and 7 days postinjection of CTX:UCNPs into Balb-c mice.
different probe concentrations indicates that the upconversion signal distributions are strongly correlated with the C6 glioma cells, which is attributed to the highly specific interaction between CTX and MMP-2 in the cell membranes. In contrast, C6 glioma cells incubated with unconjugated UCNPs display a much weaker fluorescence signal, suggesting low, non-specific particle binding to the cells. These results indicate that the prepared CTX:UCNP nanoprobes specifically target glioma cells. Furthermore, it should be noted that no autofluorescence signal was measured in the upconversion signal of cell images. This feature cannot be obtained in conventional fluorescence bioimaging based on the downconversion mechanism. 3.5. Biocompatibility of CTX:UCNP nanoprobes Fig. 6a shows the viability of NIH 3T3 cells grown for 24 h in the presence of CTX:UCNPs at concentrations ranging from 5.0 to 300.0 mg mL1. The CTX:UCNPs are not toxic to NIH 3T3 cells even at the relatively high concentration of 300.0 mg mL1, which is much higher than the highest concentration used above for glioma cell imaging. To further investigate the biocompatibility of the CTX:UCNP nanoprobes in living animals, Y concentrations in the organs (including liver, spleen, lung, kidney, and heart) of Balb-c mice were
The suitability of the CTX:UCNP nanoprobes for the targeting and visualization of tumors in vivo was evaluated by fluorescence imaging with Balb-c nude mice bearing xenograft glioma tumors. The mice bearing xenograft tumors 3 weeks post-inoculation of 5 106 C6 cells on the back (tumor size about 0.5e1.0 cm) were divided into two groups (three animals in each group). CTX:UCNPs or unconjugated UCNPs (w20.0 mg per animal) were administered to animals of the two groups through tail vein injection. At about 24 h post-injection, the mice were imaged using the established upconversion imaging system [22]. The excitation was provided by a CW laser at 980 nm with a power density at the animal of w550 mW cm2. This power density is below the conservative limit set for human skin exposure at 980 nm of 726 mW cm2 [41]. As shown in Fig. 7a, significant upconversion fluorescence was found in the xenograft tumors of the CTX:UCNPs-injected Balb-c nude mice (n ¼ 3); this red fluorescence can be directly observed by the naked eye, demonstrating the direct visualization of the tumor in vivo. In contrast, no obvious fluorescence signal was observed in the tumors of the UCNPs-injected Balb-c nude mice, proving the specificity of the CTX-based probes for targeting xenograft gliomas. The resulting high-contrast true-color image is due to the characteristic upconversion fluorescence from the tumor and the near absence of autofluorescence from normal tissues. The high signalto-background ratio is further demonstrated by the upconversion emission spectra recorded at the tumor site and normal tissue site (See Fig. 7b). In accordance with the red output color of the fluorescence, the red emission band at w660 nm is almost exclusively obtained from the tumor site due to its much deeper tissue penetration than that of the w550 nm green band [22]. In fact, most of the 660-nm emission band falls within the so-called “optical window” of biological tissues (from 650 nm to infrared) [42], which generally support deep tissue penetrability (over 1 cm) of the probe fluorescence. For quantification of the signal contrast, the truecolor images were converted to pseudo-color images using ImagePro Plus software. The obtained pseudo-color image of the CTX:UCNPs-injected Balb-c nude mouse clearly shows an irregular distribution of the fluorescence signal around the tumor, suggesting the possible diffusion of the cancer. After in vivo studies, all the tumors in the two groups were dissected and rinsed with PBS and then imaged using identical system settings. The representative images of the dissected tumors are shown in Fig. 7c. The brightly visible red upconversion fluorescence can be found only in the tumors from the CTX:UCNPs-injected mice (n ¼ 3), further demonstrating the much higher cancer specificity of the CTX:UCNP nanoprobes compared with that of the unconjugated UCNPs. Fig. 8 shows representative ex vivo fluorescence images of dissected tumors and organs of nude mice killed 24 h post-injection of CTX:UCNPs or unconjugated UCNPs. Compared with the strong red fluorescence seen in tumors of the CTX:UCNPs-injected mice, upconversion signals are rarely seen in the kidney, heart, and liver, indicating that the probes sustained sufficient circulation time for
8730
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
Fig. 7. Tumor targeting and visualization in Balb-c nude mice under 980-nm CW light irradiation. (a) In vivo upconversion imaging of a representative Balb-c nude mouse after intravenous injection of CTX:UCNPs (top) or unconjugated UCNPs (bottom) for 24 h. Pseudo-color images were converted from corresponding true-color images using Image-Pro Plus software. (b) Upconversion emission spectra recorded at the tumor site (top) or normal tissue site (bottom). (c) Imaging of the dissected tumors from a representative Balb-c nude mouse injected with CTX:UCNPs (top) or unconjugated UCNPs (bottom).
targeting. Though some deposition in lung and spleen can be observed, the fluorescence images demonstrate that the CTX:UCNPs were primarily localized to tumor tissue, with little macrophage uptake.
4. Conclusions The prepared CTX:UCNP nanoprobes exhibit bright upconversion fluorescence, specific targeting of tumor cells, and exhibit low toxicity for both cells and small animals. After intravenous injection of the CTX:UCNP nanoprobes, we have achieved direct visualization of tumors in vivo using the highly efficient NIR-to-red upconversion fluorescence. The results suggest that the neurotoxin-conjugated upconversion nanoprobes may provide an approach to improve the effectiveness of tumor diagnostic and therapeutic modalities.
Acknowledgments This work was supported by grants from the NSFC (no.s 10904119 and 30971500), the National Basic Research Program of China (no.s 2010CB529800 and 2010CB530100), the China postdoctoral science foundation (no. 20090451076), and the Program for Changjiang Scholars and Innovative Research Team in University (no. IRT0745).
Appendix
Fig. 8. Representative NIR-to-red upconversion fluorescence images of the dissected tumors and organs from Balb-c nude mice 24 h after intravenous injection of CTX:UCNPs (a) or unconjugated UCNPs (b).
Figures with essential color discrimination. Figs. 3e5, 7, 8 in this article are difficult to interpret in black and white. The full color images can be found in the online version, at doi:10.1016/j. biomaterials.2010.07.099.
X.-F. Yu et al. / Biomaterials 31 (2010) 8724e8731
References [1] Gao X, Cui Y, Levenson RM, Chung LWK, Nie S. In vivo cancer targeting and imaging with semiconductor quantum dots. Nat Biotechnol 2004;22(8):969e76. [2] le Masne de Chermont Q, Chanéac C, Seguin J, Pellé F, Maîtrejean S, Jolivet JP, et al. Nanoprobes with near-infrared persistent luminescence for in vivo imaging. Proc Natl Acad Sci USA 2007;104(22):9266e71. [3] van de Rijek F, Zijlmans H, Li S, Vail T, Raap AK, Niedbala RS, et al. Up-converting phosphor reporters for nucleic acid microarrays. Nat Biotechnol 2001;19(3):273e6. [4] Wang F, Liu X. Recent advances in the chemistry of lanthanide-doped up-conversion nanocrystals. Chem Soc Rev 2009;38(4):976e89. [5] Palmer RJ, Butenhoff JL, Stevens JB. Cytotoxicity of the rare-earth-metals cerium, lanthanum, and neodymium in vitro-comparisons with cadmium in a pulmonary macrophage primary culture system. Environ Res 1987;43(1):142e56. [6] Heer S, Kömpe K, Güdel HU, Haase M. Highly efficient multicolor upconversion emission in transparent colloids of lanthanide-doped NaYF4 nanocrystals. Adv Mater 2004;16(23e24):2102e5. [7] Zeng JH, Su J, Li ZH, Yan RX, Li YD. Synthesis and upconversion luminescence of hexagonal-phase NaYF4:Yb, Er3þ phosphors of controlled size and morphology. Adv Mater 2005;17(17):2119e23. [8] Mai HX, Zhang YW, Si R, Yan ZG, Sun LD, You LP, et al. High-quality sodium rare-earth fluoride nanocrystals: controlled synthesis and optical properties. J Am Chem Soc 2006;128(19):6426e36. [9] Yi GS, Chow GM. Synthesis of hexagonal-phase NaYF4:Yb, Er and NaYF4:Yb, Tm nanocrystals with efficient up-conversion fluorescence. Adv Funct Mater 2006;16(18):2324e9. [10] Boyer JC, Cuccia LA, Capobianco JA. Synthesis of colloidal upconverting NaYF4: Er3þ/Yb3þ and Tm3þ/Yb3þ monodisperse nanocrystals. Nano Lett 2007;7 (3):847e52. [11] Wang HQ, Nann T. Monodisperse upconverting nanocrystals by microwaveassisted synthesis. Acs Nano 2009;3(11):3804e8. [12] Li ZQ, Zhang Y. Monodisperse silica-coated polyvinylpyrrolidone/NaYF4 nanocrystals with multicolor upconversion fluorescence emission. Angew Chem Int Ed 2006;45(46):7732e5. [13] Wang F, Chatterjee DK, Li Z, Zhang Y, Fan X, Wang M. Synthesis of polyethylenimine/NaYF4 nanoparticles with up-conversion fluorescence. Nanotechnology 2006;17(23):5786e91. [14] Wang F, Liu X. Upconversion multicolor fine-tuning: visible to near-Infrared emission from lanthanide-doped NaYF4 nanoparticles. J Am Chem Soc 2008;130(17):5642e3. [15] Chen Z, Chen H, Hu H, Yu M, Li F, Zhang Q, et al. Versatile synthesis strategy for carboxylic acid-functionalized upconverting nanophosphors as biological labels. J Am Chem Soc 2008;130(10):3023e9. [16] Lim SF, Riehn R, Ryu WS, Khanarian N, Tung CK, Tank D, et al. In vivo and scanning electron microscopy imaging of upconverting nanophosphors in caenorhabditis elegans. Nano Lett 2006;6(2):169e74. [17] Chatterjeea DK, Rufaihaha AJ, Zhang Y. Upconversion fluorescence imaging of cells and small animals using lanthanide doped nanocrystals. Biomaterials 2008;29(30):937e43. [18] Jalil RA, Zhang Y. Biocompatibility of silica coated NaYF4 up-conversion fluorescent nanocrystals. Biomaterials 2008;29(30):4122e8. [19] Nyk M, Kumar R, Ohulchanskyy TY, Bergey EJ, Prasad PN. High contrast in vitro and in vivo photoluminescence bioimaging using near infrared to near infrared up-conversion in Tm3þ and Yb3þ doped fluoride nanophosphors. Nano Lett 2008;8(11):3834e8. [20] Xiong LQ, Chen ZG, Yu MX, Li FY, Liu C, Huang CH. Synthesis, characterization, and in vivo targeted imaging of amine-functionalized rare-earth up-converting nanophosphors. Biomaterials 2009;30(29):5592e600.
8731
[21] Xiong L, Chen Z, Tian Q, Cao T, Xu C, Li F. High contrast upconversion luminescence targeted imaging in vivo using peptide-labeled nanophosphors. Anal Chem 2009;81(21):8687e94. [22] Yu XF, Li M, Xie MY, Chen LD, Li Y, Wang QQ. Dopant-controlled synthesis of water-soluble hexagonal NaYF4 nanorods with efficient up-conversion fluorescence for multicolor bioimaging. Nano Res 2010;3(1):51e60. [23] Iyer G, Michalet X, Chang YP, Pinaud FF, Matyas SE, Payne G, et al. High affinity scFv-hapten pair as a tool for quantum dot labeling and tracking of single proteins in live cells. Nano Lett 2008;8(12):4618e23. [24] Orndorff RL, Rosenthal SJ. Neurotoxin quantum dot conjugates detect endogenous targets expressed in live cancer cells. Nano Lett 2009;9 (7):2589e99. [25] Aina OH, Sroka TC, Chen ML, Lam KS. Therapeutic cancer targeting peptides. Biopolymers 2002;66(3):184e99. [26] Yamamoto Y, Tsutsumi Y, Mayumi T. Molecular design of bioconjugated cell adhesion peptide with a water-soluble polymeric modifier for enhancement of antimetastatic effect. Curr Drug Targets 2002;3(2):123e30. [27] Veiseh O, Sun C, Gunn J, Kohler N, Gabikian P, Lee D, et al. Optical and MRI multifunctional nanoprobe for targeting gliomas. Nano Lett 2005;5 (6):1003e8. [28] DeBin JA, Maggio JE, Strichartz GR. Purification and characterization of chlorotoxin, a chloride channel ligand from the venom of the scorpion. Am J Physiol 1993;264(2):C361e9. [29] Deshane J, Garner CC, Sontheimer H. Chlorotoxin inhibits glioma cell invasion via matrix metalloproteinase-2. J Biol Chem 2003;278(6):4135e44. [30] McFerrin MB, Sontheimer H. A role for ion channels in glioma cell invasion. Neuron Glia Biol 2006;2(1):39e49. [31] Kurpad SN, Zhao XG, Wikslrand CJ, Balra SK, McLendon RE, Bigner DD. Tumor antigens in astrocytic gliomas. Glia 1995;15(3):244e56. [32] Veiseh M, Gabikian P, Bahrami SB, Veiseh O, Zhang M, Hackman RC, et al. Tumor paint: a chlorotoxin:Cy5.5 bioconjugate for intraoperative visualization of cancer foci. Cancer Res 2007;67(14):6882e8. [33] Fan S, Sun Z, Jiang D, Dai C, Ma Y, Zhao Z, et al. BmKCT toxin inhibits glioma proliferation and tumor metastasis. Cancer Lett 2010;291 (2):158e66. [34] Veiseh O, Gunn JW, Kievit FM, Sun C, Fang C, Lee JSH, et al. Inhibition of tumor-cell invasion with chlorotoxin-bound superparamagnetic nanoparticles. Small 2009;5(2):256e64. [35] Han S, Yi H, Yin SJ, Chen ZY, Liu H, Cao ZJ, et al. Structural basis of a potent peptide inhibitor designed for Kv1.3 channel, a therapeutic target of autoimmune disease. J Biol Chem 2008;283(27):19058e65. [36] Babacan S, Pivarnik P, Letcher S, Rand AG. Evaluation of antibody immobilization methods for piezoelectric biosensor application. Biosens Bioelectron 2000;15(11e12):615e21. [37] Smith AM, Duan H, Rhyner MN, Ruan G, Nie S. A systematic examination of surface coatings on the optical and chemical properties of semiconductor quantum dots. Phys Chem Chem Phys 2006;8(33):3895e903. [38] Setua S, Menon D, Asok A, Nair S, Koyakutty M. Folate receptor targeted, rareearth oxide nanocrystals for bi-modal fluorescence and magnetic imaging of cancer cells. Biomaterials 2010;31(4):714e29. [39] Hermanson GT. Bioconjugate techniques. 2nd ed. New York: Academic Press; 2008. [40] Chen LD, Liu J, Yu XF, He M, Pei XF, Tang ZY, et al. The biocompatibility of quantum dot probes used for the targeted imaging of hepatocellular carcinoma metastasis. Biomaterials 2008;29(31):4170e6. [41] American National Standard for safe use of lasers, ANSI Z136. 1-2000. Orlando: American National Standard Institute; 2000. [42] Smith AM, Mancini MC, Nie S. Bioimaging: second window for in vivo imaging. Nat Nano 2009;4(11):710e1.