Neurotrophin-3 administration alters neurotrophin, neurotrophin receptor and nestin mRNA expression in rat dorsal root ganglia following axotomy

Neuroscience 147 (2007) 491–507

NEUROTROPHIN-3 ADMINISTRATION ALTERS NEUROTROPHIN, NEUROTROPHIN RECEPTOR AND NESTIN mRNA EXPRESSION IN RAT DORSAL ROOT GANGLIA FOLLOWING AXOTOMY L.-T. KUO,a M. J. GROVES,a* F. SCARAVILLI,a D. SUGDENb AND S. F. ANa

The cell bodies (perikarya) of spinal sensory neurons are located in the dorsal root ganglia (DRGs), and each perikaryon is in intimate contact with perineuronal satellite cells. The neuronal population can be divided into those with myelinated or unmyelinated afferents, and further subdivided on the basis of neurochemical marker expression (see Lawson, 2005). Permanent or transient transection of the adult rat sciatic nerve at mid-thigh level results in the loss of neurons in the ipsilateral L4 and L5 DRGs over the following months (Arvidsson et al., 1986; Schmalbruch, 1987; Rich et al., 1989; Groves et al., 1997, 2003; McKay Hart et al., 2002). The extent of neuronal loss has been estimated using stereological techniques to be 15–35% depending on the type of injury, and is associated with the appearance of apoptotic neurons that have a peak incidence at 2 weeks to 2 months after nerve injury (Groves et al., 1997, 2003; McKay Hart et al., 2002). The underlying causes of this neuronal apoptosis are unclear, although systemic (Kuo et al., 2005) or local administration of neurotrophin-3 (NT-3) to the proximal stump (Groves et al., 1999; Ljungberg et al., 1999) prevents the subsequent decrease in neuron number. It is not understood how NT-3 produces this effect, as neurotrophin administration does not reduce the number of neurons dying through apoptosis either in vitro or in vivo (Edström et al., 1996; Leclere et al., 1997; Kuo et al., 2005). NT-3 or nerve growth factor (NGF) administration actually increased the number of DRG neurons projecting axons to the site of an intercostal nerve injury (Ljungberg et al., 1999) and increased the number of DRG neurons immunoreactive for nestin following sciatic nerve transection (Kuo et al., 2005). Nestin is an intermediate filament protein expressed by neuronal precursor cells (Mujtaba et al., 1998; Fanarraga et al., 1999; Bauer et al., 2005) and immature neurons (Lendahl et al., 1990; Kato et al., 1999; Woodbury et al., 2000; Rice et al., 2003). Nestin expression in DRG neurons after nerve injury indicates either that they are recapitulating an immature state, or that the neurons are newly formed, with bromodeoxyuridine (BrdU) administration showing that at least occasional neurogenesis occurs in adult rat DRG after nerve injury (Groves et al., 2003). Different subpopulations of sensory neurons in DRG generally require different neurotrophins for their survival, proliferation and differentiation during development, and for modulating neuronal phenotype in the adult (Ernfors et al., 1994; Bothwell, 1995; Munson et al., 1997; Zhang et al., 2000). NT-3 can bind to and activate all three trk receptors with varying efficacy (Cordon-Cardo et al., 1991; Lamballe et al., 1991; Soppet et al., 1991), as well as the low-affinity p75

a

Department of Molecular Neuroscience, Division of Neuropathology, Institute of Neurology, University College London, Queen Square, London WC1N 3BG, UK

b

Division of Reproduction and Endocrinology, School of Biomedical and Health Sciences, Kings College London, London SE1 1UL, UK

Abstract—In the months following transection of adult rat peripheral nerve some sensory neurons undergo apoptosis. Two weeks after sciatic nerve transection some neurons in the L4 and L5 dorsal root ganglia begin to show immunoreactivity for nestin, a filament protein expressed by neuronal precursors and immature neurons, which is stimulated by neurotrophin-3 (NT-3) administration. The aim of this study was to examine whether NT-3 administration could be compensating for decreased production of neurotrophins or their receptors after axotomy, and to determine the effect on nestin synthesis. The levels of mRNA in the ipsilateral and contralateral L4 and L5 dorsal root ganglia were analyzed using real-time polymerase chain reaction, 1 day, 1, 2 and 4 weeks after unilateral sciatic nerve transection and NT-3 or vehicle administration via s.c. micro-osmotic pumps. In situ hybridization was used to identify which cells and neurons expressed mRNAs of interest, and the expression of full-length trkC and p75NTR protein was investigated using immunohistochemistry. Systemic NT-3 treatment increased the expression of brain-derived neurotrophic factor, nestin, trkA, trkB and trkC mRNA in ipsilateral ganglia compared with vehicletreated animals. Some satellite cells surrounding neurons expressed trkA and trkC mRNA and trkC immunoreactivity. NT-3 administration did not affect neurotrophin mRNA levels in the contralateral ganglia, but decreased the expression of trkA mRNA and increased the expression of trkB mRNA and p75NTR mRNA and protein. These data suggest that systemically administered NT-3 may counteract the decrease, or even increase, neurotrophin responsiveness in both ipsi- and contralateral ganglia after nerve injury. © 2007 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: real-time quantitative PCR, neurogenesis, immunohistochemistry, in situ hybridization, micro-osmotic pump.

*Corresponding author. Tel: ⫹44-0207-837-3611x4234; fax: ⫹440207-916-9546. E-mail address: [email protected] (M. Groves). Abbreviations: ANOVA, analysis of variance; BDNF, brain-derived neurotrophic factor; DRG, dorsal root ganglion; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IR, immunoreactivity; ISH, in situ hybridization; NGF, nerve growth factor; NT-3, neurotrophin-3; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; p75NTR, p75 neurotrophin receptor; SSC, salt and sodium citrate solution; TNF-␣, tumor necrosis factor-␣.

0306-4522/07$30.00⫹0.00 © 2007 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2007.04.023

491

492

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

neurotrophin receptor (p75NTR), and appears to be particularly important during the differentiation of sensory neurons (El Shamy et al., 1998; Fariñas et al., 2002). The main aim of the work described was to establish how much of the effects of NT-3 administration after axotomy involves alterations of neurotrophin synthesis and/or receptivity. A secondary aim was to establish whether NT-3 administration actually increased the synthesis of nestin. Real-time quantitative polymerase chain reaction (PCR; Bustin, 2002; Mackay et al., 2002) was used to quantify mRNAs for NGF, brain-derived neurotrophic factor (BDNF), NT-3, trkA, trkB, trkC, p75NTR and nestin in ipsi- and contralateral DRGs, up to 4 weeks after right sciatic nerve transection at mid-thigh level. In situ hybridization (ISH) was used to illustrate which cell types expressed the neurotrophins and neurotrophin receptor mRNAs, as well as immunohistochemistry for trkC and p75NTR protein.

EXPERIMENTAL PROCEDURES Animals Sixty-three male adult Sprague–Dawley rats 3– 6 months old weighing between 275 and 325 g were used in the study. Animals were housed singly with food and water available ad libitum, and kept in a colony room maintained at 22 °C with a 12-h alternating light/dark cycle. Experiments conformed to UK Home Office regulations, which conform to international standards on ethical use of animals. The number of animals used was the minimum necessary for accurate quantitation. All possible precautions were taken to minimize suffering to the animals used, and animals were monitored daily for signs of autotomy.

Surgery The right sciatic nerve of 56 adult male rats weighing 300 –350 g was ligated and transected under halothane anesthesia, and an “Alzet” microosmotic pump (Alza Corporation, Mountain View, CA, USA) containing solution of human recombinant NT-3 in vehicle (Regeneron Pharmaceuticals Inc.) or vehicle (4.5% mannitol, 0.5% sucrose and 10 mM histidine, pH 5.0 in sterile saline) was implanted in a s.c. “pocket” on the dorsum of the animal as described previously (Kuo et al., 2005). No cannula was attached to the pump opening, so that the NT-3 released diffused into the s.c. space. Treatment lasted for 1 week (pump model 2001, 100 ␮l 12.5mg/ml NT-3 or vehicle), 2 weeks (model 2002, 200 ␮l 12.5mg/ml NT-3 or vehicle), or 4 weeks (model 2004, 200 ␮l of 25 mg/ml NT-3 or vehicle). For the 1 day (24 h) one s.c. injection of 15 ␮l containing 0.18 mg of NT-3, or 15 ␮l of vehicle, was given immediately after the operation. Following the

operation, the animals were allowed to recover, and were monitored daily for signs of autotomy.

Isolation of RNA and reverse transcription Nine groups of animals were used for the real-time quantitative PCR investigation: (i) unoperated rats (n⫽5); (ii) 1 day after axotomy with s.c. 15 ␮l vehicle injection (n⫽5); (iii) 1 day after axotomy with s.c. 0.18 mg/15 ␮l NT-3 injection (n⫽5); (iv) 1 week after axotomy with vehicle pump infusion (n⫽5); (v) 1 week after axotomy with NT-3 (1.25 mg) pump infusion (n⫽5); (vi) 2 weeks after axotomy with vehicle pump infusion (n⫽5); (vii) 2 weeks after axotomy with NT-3 (2.5 mg) pump infusion (n⫽5); (viii) 4 weeks after axotomy with vehicle pump infusion (n⫽5); (ix) 4 weeks after axotomy with NT-3 (5 mg) pump infusion (n⫽5). At the end of the period of treatment, rats were terminally anesthetized with pentobarbitone (i.p. injection of 60 mg/kg), and the right L4 and L5 DRGs removed rapidly and kept in RNAlater solution (Qiagen, Hilden, Germany) on ice before being cut up thoroughly with sterilized scissors: RNA was then isolated using a QIAshredder spin column, RNeasy Mini Kit and DNase Set (Qiagen). Total RNA content was quantitated by spectrophotometry and precipitated, using sodium acetate, pH 4.0, and isopropanol at ⫺20 °C overnight, and then resuspended in appropriate amount of RNase-free water. The cDNAs were synthesized using oligo (dT), RNase inhibitor and Omniscript RT Kit (Qiagen), and the resultant solution was diluted 10-fold in tRNA (10 ␮g/ml) and stored at ⫺20 °C for real-time PCR use.

Preparation of primers and probes PCR primers for trkA, trkB, trkC, p75NTR, NGF, BDNF, NT-3, nestin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH: used as an internal standard) were designed from published sequences (Table 1), and synthesized by MWG Biotech AG (Ebersberg, Germany) and Sigma (St. Louis, USA). Conventional PCR reactions were performed in a 30 ␮l solution using HotStarTaq Master Mix Kit (Qiagen) to optimize the reaction conditions. In all experiments, samples containing no template were included to serve as negative controls.

Real-time quantitative PCR Real-time quantitative PCR was performed using a LightCyclerTM rapid thermal cycler system (Roche Diagnostics, Lewes, UK). Reactions took place in a 10 ␮l volume containing 0.5 ␮M primers, dNTPs, FastStart TaqDNA polymerase, DNA double-strand-specific SYBR Green I dye, and reaction buffer provided in the LightCycler-FastStart DNA Master SYBR Green I mix (Roche Diagnostics). Preliminary experiments were performed to optimize the Mg2⫹ concentration to give the maximal yield of a single PCR product. The program included pre-incubation step at 95 °C for 10

Table 1. Oligonucleotide sequences used in real-time quantitative PCR reactions Gene product

Forward primer (5=–3=)

Reverse primer (3=–5=)

Product size (bp)

GenBank accession number

NGF BDNF NT-3 TrkA TrkB TrkC p75NTR Nestin GAPDH

ACAGGCAGAACCGTACACAG (337–356) CCGCAAACATGTCTATGAGG (2485–2504) AGAAGCCAGGCCAGTCAAAA (681–700) ATGGAGAACCCACAGTACTTC (1541–1561) AAAGGCCCAGCTTCCGTCAT (2054–2073) GGGAAGCAACCATGGTTC (2308–2325) TGCAGTGTGCAGATGTGCCT (428–447) TTGCGTCGGGGAAGAATCTT (136–155) CCCATCACCATCTTCCAGGAGC (241–262)

ATCCAGAGTGTCCGAAGAGG (595–576) GATTGGGTAGTTCGGCATTG (2767–2748) TCCCGAGAGCCCAATCACAA (1092–1073) CGTGCAGACTCCAAAGAAGC (1791–1810) GGGGGTTTTCAATGACAGGG (2183–2202) AAACGCTTGGCCACCAGT (2535–2552) GGGATCTCTTCGCATTCAGC (672–691) AGCTCTTCCGCAAGGTTGTC (371–390) CCAGTGAGCTTCCCGTTCAGC (713–693)

259 283 412 270 149 245 264 255 473

M36589 D10938 M33968 M85214 M55291 L03813 X05137 NM_012987 NM_017008-1

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507 min, denaturation at 95 °C for 10 s, annealing at 55 °C (GAPDH), 58 °C (BDNF, trkA, trkB, trkC and nestin) or 61 °C (NGF, NT-3, and p75NGFR) for 10 s, and extension at 72 °C for a variable time (10 s–21 s) depending on PCR product size. Fluorescent detection was carried out at the end of each cycle after a 3-s step 3–5 °C below the Tm of product. To confirm amplification specificity, the PCR products amplified by each primer pair were subjected to a melting curve analysis and subsequent 2% w/v agarose gel electrophoresis. To prepare standards for real-time quantitative PCR, each product was separated by 2% w/v agarose gel electrophoresis, cut and purified using a Qiaquick gel extraction kit (Qiagen). They were quantified on a 2% w/v agarose gel by densitometry and compared with reference bands of known size and amount: pBR322 DNA/BsuRI (HaeIII) Marker (Fermentas Inc., Hanover, MD, USA). Standards were made by 10-fold serial dilutions of each recovered PCR products in tRNA (101–106 copies/2 ␮l except GAPDH 102–107 copies/2 ␮l). After completion of PCR, the copy number of target genes was calculated by LightCycler software version 3.5.3, which quantifies the sample using extrapolation from the standard curve. The amounts of target gene cDNA were normalized against housekeeping gene GAPDH cDNA in the corresponding samples.

Statistical analysis The relative gene expression data (for ipsilateral and contralateral DRGs) of the axotomy⫹NT-3 group was compared with the axotomy⫹vehicle group and the unoperated control group using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc tests. All data are given as mean⫾S.E.M. Results were assumed to be significant if P⬍0.05.

ISH Five groups of animals were used for ISH and immunohistochemistry: (i) unoperated rats (n⫽2); (ii) rats killed 1 day after axotomy with s.c. injection of NT-3 (0.18 mg, n⫽2) or 15 ␮l vehicle; (iii) rats killed 1 week after axotomy with NT-3 (1.25 mg, n⫽2) or vehicle (n⫽2) pump infusion; (iv) rats killed 2 weeks after axotomy with NT-3 (2.5 mg, n⫽2) or vehicle (n⫽2) pump infusion; (v) rats killed 4 weeks after axotomy with NT-3 (5 mg, n⫽2) or vehicle (n⫽2) pump infusion. The rats were perfused transcardially with approximately 600 ml of 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) at room temperature for 15 min under terminal pentobarbitone anesthesia. The L4 and L5 DRGs were removed and allowed to fix in fixative for a further 24 h before being processed into paraffin

493

wax. Seven (ISH) and four (immunohistochemistry) micrometer thick sections were cut and mounted onto Superfrost slides (BDH) in strips of four and dried overnight at 37 °C. Oligonucleotide probes were synthesized by MWG Biotech AG or Sigma and purified by HPLC. The sequences were complementary to the mRNAs for NGF, BDNF, NT-3, trkA,p trkB, trkC and p75NTR (Table 2). The trkB and trkC probes were located in the tyrosine kinase domains of their catalytic isoforms. A digoxigenin oligonucleotide 3=-tailing kit (Roche) was used to label the oligonucleotide probes with an average of five digoxigenin molecules at the 3=-end, according to the manufacturer’s instructions. The digoxigenin-labeled probes were stored at ⫺20 °C until required. The paraffin sections were dewaxed in xylene and rehydrated in graded alcohols and distilled water before being incubated in 150 ␮l of 20 ␮g/ml proteinase K (Sigma) for 10 min at 37 °C. The slides were then washed in phosphate-buffered saline (PBS) before being immersed in 0.1 M citrate buffer, pH 6.0, and heated in a 650 W microwave oven for 15 min. After a brief wash in PBS, the sections were incubated in100 ␮l of 1000 units/ml deoxyribonuclease I (Invitrogen) for 30 min at 37 °C. For prehybridization, sections were covered with 100 ␮l hybridization mix, containing 2⫻ salt and sodium citrate solution (SSC), 5% dextran sulfate, 10% formamide, 200 ␮g/ml salt and sodium dodecanyl acetate and 0.1 mg/ml poly [A] (Roche) and incubated for 30 min at 37 °C. Poly [A] was used to block the non-specific hybridization of the digoxigenin conjugated D-uridine triphosphate; /dATP tail to related homologous sequences. The prehybridization mix was poured off and 100 ␮l hybridization mix containing 0.5 ␮g/ml sense (used as a negative control) or antisense probe in prehybridization solution was applied gently to the slides. The slides were carefully covered with Parafilm, put into a tape-sealed plastic container and incubated in a water bath incubator for 16 h at 37 °C. Post-hybridization washes consisted of 1⫻ SSC for 2 min at room temperature, 1⫻ SSC for 15 min at 55 °C, 0.5⫻ SSC for 15 min at 55 °C, and 0.5⫻ SSC for 10 min at room temperature. Non-specific antibody binding sites were blocked in 10% skimmed milk powder for 15 min at room temperature. Alkaline phosphatase-coupled sheep anti-digoxigenin IgG (Roche) diluted 1:200 in 2% milk in PBS was applied to the sections for 30 min at room temperature. The sections were washed in 3⫻5 min washes of tris-buffered saline (100 mM Tris–HCl, 150 mM NaCl, pH 7.5) before being incubated in the color reagent (5-bromo-4chloro-3-indolyl-phosphate and nitro blue tetrazolium chloride in 0.1 M Tris–HCl, 0.1 M NaCl, pH 9.5) containing 0.2 mg/ml of levamisole (Sigma) for 3–16 h at room temperature in the dark.

Table 2. Oligonucleotide sequences used in ISH Probe

Probe sequence

GenBank accession number

NGF NGF control BDNF BDNF control NT-3 NT-3 control TrkA TrkA control TrkB TrkB control TrkC TrkC control P75NTR p75NTR control

CTG CGG GCT CTG CGG AGG GCT GTG TCA AGG GAA TGC TGA AGT TTA GTC CA (447–398) TGG ACT AAA CTT CAG CAT TCC CTT GAC ACA GCC CTC CGC AGA GCC CGC AG (398–447) CTC CAG AGT CCC ATG GGT CCG CAC AGC TGG GTA GGC CAA G (2255–2216) CTT GGC CTA CCC AGC TGT GCG GAC CCA TGG GAC TCT GGA G (2216–2255) TTT GTC ATC AAT CCC CCT GCA ACC GTT TTT GAC TGG CCT GGC T (726–684) AGC CAG GCC AGT CAA AAA CGG TTG CAG GGG GAT TGA TGA CAA A (684–726) AGG GTT GAA CTC AAA AGG GTT GTC CAT AAA GGC AGC CAT GAT G (1231–1189) CAT CAT GGC TGC CTT TAT GGA CAA CCC TTT TGA GTT CAA CCC T (1189–1231) CCA TTA TTC ATA TGA GTG GGG TTA TCC AGC TGG AGG CAG CCG TGG (1734–1690) CCA CGG CTG CCT CCA GCT GGA TAA CCC CAC TCA TAT GAA TAA TGG (1690–1734) TCC AAA GGC TCC CTC ACC CAG TTC TCT CTT CAA CAC GAT GTC TCT (1701–1657) AGA GAC ATC GTG TTG AAG AGA GAA CTG GGT GAG GGA GCC TTT GGA (1657–1701) CAC AAG GCC CAC GAC CAC AGC AGC CAA GAT GGA GCA ATA GAC AGG (918–873) CCT GTC TAT TGC TCC ATC TTG GCT GCT GTG GTC GTG GGC CTT GTG (873–918)

M36589 M36589 M36589 M85214 M55291 L03813 X05137

494

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

The sections were then washed with water, mounted in aqueous mounting medium and examined under a light microscope. Due to the small groups sizes of the animals used for ISH and the variable results obtained with the oligonucleotide DNA probes on paraffin sections we did not attempt to quantify the intensity of the hybridization signal or the proportions of stained/unstained cells and neurons.

Immunohistochemistry for trkC and p75NTR Paraffin sections 4 ␮m thick of DRGs were immunostained for trkC and p75NTR using a standard avidin– biotin method. The sections were dewaxed and rehydrated before being immersed in 600 ml of 0.1 M citrate buffer pH 6.0 and microwaved at full power in a 650 W microwave oven for 20 min. After cooling, the slides were washed in PBS, blocked in non-immune swine serum (1:10 in PBS, Dako, Glostrup, Denmark) and incubated in rabbit polyclonal anti-trkC (1:100, IgG, anti-human, rat, mouse and pig trkC raised against a peptide mapping near to the carboxy terminus of rat/human/pig trkC gp140, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) or anti-p75NTR (1:1000, IgG, anti-rat p75NTR raised against a synthetic peptide corresponding to amino acids 407– 425 of p75NTR of rat origin, Sigma) antibodies diluted in PBS containing 0.1% triton-X and 1.0% bovine serum albumin, for 1 h (anti-trkC) or overnight (anti- p75NTR) at room temperature. The sections were then washed in PBS before being incubated in biotinylated swine anti-rabbit secondary antibody (1:400 in PBS, Dako) for 1 h at room temperature, washed and incubated in peroxidase-conjugated streptavidin (1:300 in PBS, Sigma) for 1 h at room temperature. After washing in PBS, antibody binding was visualized by incubation in 0.05% diaminobenzidine with 0.04% NiCl2 and 0.01% H2O2 for 10 min. Slides were dehydrated, coverslipped and mounted in DPX mountant. Omission of antip75NTR primary antisera resulted in the abolition of immunostaining, as did prior incubation of the anti-trkC antibody with a 10-fold excess of the synthetic peptide it was raised against.

RESULTS Animals that received NT-3 appeared to tolerate it well and, when compared with animals receiving vehicle, increased in weight to an identical degree over 1 month. There was no noticeable difference in the incidence of autotomy or pain-related behavior (such as keeping the affected limb raised) in treated or untreated animals. Macroscopic examination of heart, lungs, kidney, liver and gastrointestinal tract showed no abnormalities for all groups of animals. Effects of axotomy and vehicle treatment on ipsilateral DRGs In DRGs from unoperated animals BDNF mRNA was expressed at far higher copy numbers than those for NGF and NT-3, the levels of which were so low as to make statistical interpretation uncertain (Fig. 1). The expression of NT-3 and NGF mRNAs showed no significant difference (P⬎0.05) between unoperated and contralateral ganglia in operated groups at any time point. ISH showed BDNF mRNA expression in occasional neurons of various sizes, especially those of small diameter (Fig. 2A), and no basal expression of NT-3 was detectable (Fig. 2B). No definite signal was seen in satellite cells for NGF or NT-3 mRNA, although faint signal for BDNF mRNA may be present in occasional satellite cells around large DRG neurons (Fig. 2A).

One day after sciatic transection levels of NGF and BDNF mRNA in the ipsilateral DRG increased by 4.7 and 4.2 times respectively (P⬍0.05, Fig. 1, Fig. 2C). By 1 week NGF mRNA expression was 2.5 times higher than controls (P⬍0.05) while the level of BDNF mRNA expression had declined to control levels; at 4 weeks NGF mRNA levels had also returned to control levels. The expression of NT-3 mRNA was doubled 1 day after axotomy (P⬍0.05), ISH indicating that this mainly occurred in small and some large neurons as well as some satellite cells (Fig. 2D). This declined to control levels by 1 week. The mRNAs of all neurotrophin receptors were detectable in DRGs from unoperated animals by real-time quantitative PCR, with trkA showing the highest expression in terms of copy number and trkB the lowest (Fig. 3). ISH showed trkA mRNA expression in small diameter neurons and some satellite cells, faint trkB mRNA expression in small to medium diameter neurons and some satellite cells, p75NTR mRNA in various sizes of neuron and trkC mRNA mainly in large diameter neurons and some satellite cells (Figs. 4A–D). The level of mRNA for trkA in ipsilateral ganglia was reduced by ⬃55% at 2 weeks after sciatic transection (P⬍0.05, Fig. 3), after which it recovered to control levels. TrkB mRNA expression decreased to 30% of unoperated control levels 2 weeks after sciatic transection (P⬍0.05), returning to control levels by 4 weeks. ISH showed slightly increased trkB signal in small diameter neurons and some satellite cells around large neurons 2 weeks after axotomy and vehicle treatment (Fig. 4E). One day after sciatic transection the level of trkC mRNA expression increased to sixfold that of unoperated ganglia (P⬍0.05). The levels then decreased slowly but still remained significantly higher than normal (P⬍0.05) until 4 weeks after axotomy, by which time they had returned to normal levels. ISH showed that the initial increase in trkC mRNA occurred in neurons of all sizes as well as in some satellite cells, particularly those associated with large neurons (Fig. 4F). The expression of p75NTR mRNA had decreased to a level below 10% of control values by 1 day in both ipsilateral and contralateral DRGs (P⬍0.05, Fig. 3). The level remained depressed on both sides for at least 1 week and did not return to unoperated control levels until 2 weeks (P⬎0.05). ISH showed a lower expression in ipsilateral neurons and a higher expression in satellite cells around some large neurons 1 week after axotomy and vehicle treatment. By 2 weeks after axotomy and vehicle treatment, p75NTR mRNA started to be expressed again in neurons. Nestin mRNA expression in unoperated rat DRGs was low with no difference between ipsi- and contralateral sides. The expression of nestin mRNA after axotomy was significantly higher at 1 day, although the increased expression at 2 weeks is probably a more significant result due to the higher copy numbers (P⬍0.05; Fig. 5). TrkC immunoreactivity (IR) in DRGs from unoperated animals was located in the vicinity of the plasma mem-

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

495

Fig. 1. Mean⫾S.E.M. levels of NGF (A), BDNF (B) and NT-3 (C) mRNA in ipsilateral DRGs after axotomy and NT-3 or vehicle treatment. * Significant difference from unoperated control DRGs, ** significant difference from vehicle treated; P⬍0.05, ANOVA with Tukey’s post hoc analysis.

branes of many large and small neurons, some satellite cells surrounding large DRG neurons and within motor and some sensory axons (Fig. 6A). One day after axotomy trkC-IR was less intense and in fewer neurons in ipsilateral DRGs, but appeared to be intense in occasional elongated cells adjacent to blood vessels and within the capsule of the ganglia (Fig. 6B). These cells were also seen in the contralateral ganglia in similar locations, but by 1 week they had disappeared from both ipsi- and contralateral ganglia and far fewer ipsilateral neurons showed any obvious trkC-IR. A greater proportion of

neurons showed trkC-IR in the region of their plasma membranes in ipsi- and contralateral ganglia at 1 month (Fig. 6C). IR for p75NTR in ganglia from unoperated animals was mainly present in small and medium diameter neurons, as well as some large diameter neurons and satellite cells around large neurons (Fig. 6E). One week after axotomy the number of p75NTR immunoreactive (p75NTR-IR) neurons in ipsilateral DRGs was greatly reduced (Fig. 6F), while the contralateral ganglia appeared less affected. This pattern of p75NTR IR persisted to 4 weeks after axotomy,

496

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

Fig. 2. ISH for BDNF (A, C) and NT-3 (B, D) mRNAs in right L4 or L5 DRGs from unoperated (A, B) and 1 day after axotomy and vehicle administration (C, D). Signal for BDNF mRNA appears to present in occasional satellite cells in unoperated ganglia (A, arrows) NT-3 mRNA is present in some satellite cells after axotomy (D, arrows). Scale bar⫽10 ␮m.

although more p75NTR-IR satellite cells appeared around some large neurons. Effect of axotomy and NT-3 administration on ipsilateral DRGs Systemic administration of NT-3 reduced the increase in NGF mRNA seen at 1 day after sciatic transection and vehicle, but increased NGF mRNA content relative to vehicle at 1 and 2 weeks (P⬍0.05, Fig. 1). ISH indicated that this was due to increased synthesis in medium-to-large neurons and satellite cells. By 4 weeks there was no significant difference in ipsilateral NGF mRNA levels between NT-3-treated and vehicle-treated groups. BDNF mRNA expression was increased at all time points by NT-3 administration, compared with vehicle (P⬍0.05). ISH showed that this increase occurred in most small neurons and a greater proportion of medium-to-large neurons, compared with DRGs from vehicle-treated rats, but did not show any convincing increase in expression in satellite cells (Fig. 2C). The level of NT-3 mRNA expression in ipsilateral ganglia was not altered by NT-3 administration when compared with vehicle-treated rats (P⬎0.1). NT-3 administration produced no effect on the expression of trkA and trkB mRNA at 1 day and 1 week after injury compared with vehicle administration (Fig. 3). However, at 2 weeks both trkA and trkB mRNA expression increased

(P⬍0.05), and at 4 weeks were ⬃90% (trkA) and ⬃290% (trkB) higher than unoperated control levels (P⬍0.05). ISH showed that this up-regulation occurred in neurons of all sizes and also showed apparent trkA and trkB mRNA in some satellite cells around large neurons (Fig. 7B, C). Expression of trkC mRNA remained at unoperated control levels in DRGs from NT-3-treated animals 1 day and 1 week after sciatic transection. At 2 weeks trkC mRNA levels had increased when compared with unoperated controls (P⬍0.05, Fig. 3), but were still significantly lower than in ganglia from vehicle-treated animals (P⬍0.05). By 4 weeks trkC mRNA levels were elevated threefold over unoperated control levels, and were significantly higher than those produced by vehicle treatment (P⬍0.05). TrkC mRNA was detectable in many neurons of all sizes and some satellite cells around large neurons 1 day after axotomy with NT-3 administration. By 1 week, most small- and medium-sized and some large neurons showed trkC mRNA expression, with weaker signal in satellite cells. After 2 weeks increased trkC mRNA expression was observed in all sizes of neuron, especially smallto-medium neurons, but not in satellite cells (Fig. 7D). NT-3 administration had no effect on p75NTR mRNA levels after sciatic transection (P⬎0.05, Fig. 3). Nestin mRNA expression in NT-3-treated ipsilateral ganglia was significantly increased at 1 week and 2 weeks

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

497

Fig. 3. Mean⫾S.E.M. levels of trkA (A), trkB (B), trkC (C) and p75NTR (D) mRNA in ipsilateral DRGs after axotomy and NT-3 or vehicle administration. * Significant difference from unoperated control DRGs, ** significant difference from vehicle treated; P⬍0.05, ANOVA with Tukey’s post hoc analysis.

498

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

Fig. 4. ISH for trkA (A), trkB (B), p75NTR (C) and trkC (D) mRNAs in right L4 or L5 DRGs from unoperated rats, trkB mRNA 2 weeks after axotomy and vehicle administration (E) or trkC mRNA 1 day after axotomy and vehicle administration (F). Arrows indicate possible signal in satellite cells. Scale bar⫽10 ␮m.

after axotomy when compared with vehicle-treated ganglia, but at 4 weeks it was significantly increased only when compared with those from unoperated animals (Fig. 5). One day after axotomy and NT-3 administration trkC IR in ipsilateral ganglia was distributed in a similar pattern to that seen in untreated controls, although the IR in the non-neuronal cells in the ganglion capsule and around blood vessels was less obvious. These were absent in contralateral ganglia. At 1 week after axotomy and NT-3 administration there appeared to be more trkC-IR neurons in the ipsilateral ganglia than in the contralateral ganglia, but there were no trkC-IR non-neuronal cells near to blood vessels. At 4 weeks the majority of ipsilateral DRG neu-

rons were trkC-IR, as were all vacuolated neurons (Fig. 6D). The expression of p75NTR-IR appeared identical to those from animals after axotomy and vehicle administration at 1 and 2 weeks, with decreased numbers of p75NTR-IR neurons. A moderate increase in the number of p75NTR-IR neurons was apparent at 4 weeks. Contralateral ganglia The contralateral ganglia showed no change in the expression of mRNA of NGF or NT-3. BDNF mRNA levels were significantly elevated at 1 day (P⬍0.05), and had returned to control levels by 1 week (Fig. 8).

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

499

Fig. 5. Mean⫾S.E.M. levels of nestin mRNA in L4 and L5 DRG after sciatic nerve transection with systemic vhicle or NT-3 administration. * Significantly different from unoperated control ganglia, ** significantly different from same side ganglia from vehicle-treated animals; P⬍0.05, ANOVA with Tukey’s post hoc analysis.

The level of trkA mRNA expression in contralateral ganglia was significantly elevated 1 day after sciatic transection, whereas at 1, 2 and 4 weeks levels were not significantly different from unoperated ganglia (P⬎0.05). The level of trkB mRNA expression did not change significantly at any time point, and trkC mRNA expression was increased at 1 day and at 4 weeks (P⬍0.05). ISH indicated that the increased trkC mRNA synthesis occurred in neurons of all sizes, but not in satellite cells. Nestin mRNA expression remained at the same levels after sciatic nerve transection. NT-3 administration did not alter the profile of NGF or NT-3 mRNA expression, but did prevent the elevation in BDNF mRNA seen at 1 day. The increased expression of trkA mRNA at 1 day after axotomy and vehicle treatment did not occur following NT-3 administration (Fig. 9); conversely, the expression of trkB mRNA was significantly increased at 1 week, and at 2 and 4 weeks was identical to that in the ipsilateral ganglia (Fig. 9). ISH indicated that this up-regulation in trkB mRNA occurred mainly in small- and medium-sized neurons, and some satellite cells around large neurons. No discernable effect on trkC mRNA expression was observed in contralateral ganglia after NT-3 administration. In contrast to the lack of effect on ipsilateral DRGs, p75NTR mRNA levels in contralateral ganglia were significantly increased by NT-3 treatment at all time points (P⬍0.05), and at 4 weeks were 2.5-fold higher compared with unoperated control ganglia. ISH showed that this increase was due to increased synthesis in neurons and satellite cells (Fig. 6G). The proportion of trkC-IR neurons in contralateral ganglia from NT-3-treated animals was similar to that seen in ganglia from vehicle-treated or unoperated animals at all time points. Conversely, a greater number of p75NTR-IR neurons were evident in contralateral ganglia from NT-3treated animals at 1, 2 and 4 weeks than in ipsilateral ganglia from animals that had vehicle or NT-3 administration (Fig. 6H).

DISCUSSION Our results show that systemic NT-3 administration prolonged the axotomy-induced up-regulation of BDNF mRNA and counteracted the decrease in trkA, trkB, trkC and nestin mRNA expression in ipsilateral DRGs at later time points after axotomy. NT-3 administration also produced significant changes in the expression of certain neurotrophin receptor mRNAs in the contralateral ganglia. The copy numbers of NGF, NT-3 and trkB mRNAs are probably too low to form significant conclusions about the changes seen. Methodological considerations This study largely utilized s.c. micro-osmotic pumps to deliver human recombinant NT-3 to the systemic circulation for up to 1 month after sciatic nerve transection. This method of administration has been shown to produce a stable plasma concentration of murine NGF (2.5S subunit) within 3 days of s.c. implantation into adult rats (Tria et al., 1994). In this study the pumps were removed after 12 days so it is not known whether stable plasma levels of NGF would be maintained for 1 month: it is possible that increased clearance and/or metabolism as a result of the administration could result in gradually decreasing levels of NGF or NT-3 in plasma. Human recombinant NT-3 has a shorter plasma half-life in rats than 2.5S murine NGF (1.28⫾0.07 min vs. 7.20⫾0.30 min: Poduslo and Curran, 1996), indicating that a stable plasma concentration might be attained more quickly than NGF. However, without measurement of the pharmacokinetic profile of NT-3 administered by s.c. pumps it is not possible to be certain of this. Furthermore, the NT-3 pharmacokinetic profile of the 1 day time point will be different as it was administered as a single s.c. injection equivalent to the amount a pump would expel in a 24 h period, so the peak concentration would be higher, after which the plasma concentration would decline relatively quickly.

500

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

Fig. 6. Immunohistochemistry for trkC (A–D) and p75NTR (E–G). TrkC immunoreactive neurons have a rim of IR in the vicinity of their plasma membrane (A). DRG from unoperated rats have occasional trkC immunoreactive satellite cells (arrows in A and inset). Ipsilateral DRG 1 day after axotomy and vehicle administration (B) showing intensely trkC-IR cells near to blood vessels (arrows). Ipsilateral DRG 4 weeks after axotomy with vehicle administration (C) showing occasional immunoreactive satellite cells (arrow), and 4 weeks after axotomy and NT-3 administration (D). Sections of DRG from unoperated rats (E) or ipsilateral DRG 1 week after axotomy and vehicle administration (F) immunostained for p75NTR. ISH for p75NTR mRNA (G: arrows indicate signal in satellite cells) or immunohistochemistry for p75NTR protein (H) in contralateral DRG 2 weeks after axotomy and NT-3 administration. Scale bar⫽10 ␮m.

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

501

Fig. 7. ISH of sections of ipsilateral DRG using a sense probe for trkA (A) and anti-sense probes for trkA (B), trkB (C) and trkC (D) 2 weeks after axotomy and NT-3 administration. Arrows indicate possible signal in satellite cells. Scale bar⫽10 ␮m.

NT-3 has a higher permeability coefficient across the blood–nerve barrier, and would contact sensory axons soon after reaching the circulation of adult rats (Poduslo and Curran, 1996). DRGs have fenestrated capillaries that allow the passage of proteins with a molecular weight of at least 40,000, so NT-3 would contact neuronal perikarya within 5 min of entering the circulation (Jacobs et al., 1976). Furthermore, systemically administered NT-3 prevented overall neuronal loss at the dose level used in this study, and at a 75% lower dose level (Kuo et al., 2005). Levels of mRNA were standardized in relation to GAPDH as a housekeeping gene, as levels of this mRNA remain constant following nerve injury (Araki et al., 2001; MacDonald et al., 2001). We have also found that levels of ␤-actin, another housekeeping gene commonly used for standardization, are affected by our injury paradigm and NT-3 treatment in a DNA microarray study, whereas GAPDH levels remained constant (L.-T. Kuo, unpublished observations). Effects of axotomy on neurotrophin signaling Our data are broadly consistent with previous reports using blotting, reverse-transcriptase/PCR and ISH methods that showed some neuronal expression of mRNA for NGF, BDNF and NT-3 in uninjured DRG neurons (Zhou et al., 1999; Michael et al., 1999; Karchewski et al., 2002), and increased NGF and BDNF mRNA expression in ipsilateral DRGs by 24 h after sciatic or spinal nerve trauma (Sebert

and Shooter, 1993; Zhou et al., 1999; Michael et al., 1999; Karchewski et al., 2002). However, the copy numbers of NGF and NT-3 are so low that these results should be treated with great caution. Others have reported up-regulation in NGF and NT-3 mRNA in small neurons and some satellite cells of large DRG neurons after axotomy, and BDNF mRNA in small- and medium-sized neurons (Zhou et al., 1999; Michael et al., 1999; Karchewski et al., 2002). Effects of NT-3 administration on neurotrophin mRNA expression after axotomy NT-3 administration increased the expression of BDNF mRNA in ipsilateral ganglia and reduced the up-regulation in BDNF mRNA in contralateral ganglia. This finding correlates with in vitro studies using transfected PC12 cells showing that neurotrophins can induce secretion of themselves and other neurotrophins (Krüttgen et al., 1998). These data may represent a broad effect of exogenous NT-3 on a wide range of cells and neurons after axotomy in inducing trophic support for regenerating neurons, while NT-3 levels in the sciatic nerve are depressed (Funakoshi et al., 1993). The increased levels of neurotrophins produced by NT-3 administration might then both stimulate axonal regeneration and myelination (Edström et al., 1996; see Terenghi, 1999; Zhang et al., 2000; Romero et al., 2001), as well as having neuroprotective effects (Helgren et al., 1997; Munson et al., 1997; Mizisin et al., 1997).

502

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

Fig. 8. Mean⫾S.E.M. levels of NGF (A), BDNF (B) and NT-3 (C) mRNA in contralateral DRGs after axotomy and NT-3 or vehicle treatment. * Significant difference from unoperated control DRGs, ** significant difference from vehicle treated; P⬍0.05.

Effects of NT-3 on neurotrophin receptor mRNA in ipsilateral ganglia Levels of trkB mRNA copy numbers are low as to make the interpretation of any changes unreliable, although the decrease in trkA, trkB and p75NTR mRNA expression in the ipsilateral ganglia after axotomy is in broad agreement with some previous reports (Krekoski et al., 1996; Shen et al., 1999; Bergman et al., 1999; Deng and Zhou, 2000). Increased (Ernfors et al., 1993) or unaltered (Sebert and Shooter, 1993) trkB and trkC mRNA levels have been reported after sciatic nerve crush, and ISH for trkC mRNA showed that the initial increase 1 day after axotomy and

vehicle treatment was largely due to up-regulation in small neurons. Systemic NT-3 administration increased trkA mRNA expression in ipsilateral ganglia: NGF administration had a similar effect on trkA mRNA expression in DRG after axotomy (Deng and Zhou, 2000). The rapid up-regulation of trkC mRNA seen in ipsilateral ganglia after axotomy was transformed by NT-3 administration to a gradual rise in trkC mRNA in both ipsilateral and contralateral ganglia over 1 month. These effects are at variance with those reported in CNS neurons, where continuous exposure to NT-3 decreases the expression of trk A, B and C mRNA

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

503

Fig. 9. Mean⫾S.E.M. levels of trkA (A), trkB (B), trkC (C) and p75NTR (D) mRNA in contralateral DRGs after axotomy and NT-3 or vehicle treatment. * Significant difference from unoperated control DRGs, ** significant difference from vehicle treated; P⬍0.05).

504

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

(Knusel et al., 1997; Xu et al., 2002), and suggests that the role of NT-3 in the peripheral nervous system is quite different. Our finding that some satellite cells appear to express trkA mRNA would be in keeping with reports of trkA protein in some satellite cells (Pannese and Procacci, 2002). ISH and trkC immunohistochemistry showed that some satellite cells also appeared to express trkC mRNA and protein (and possibly trkB mRNA) in normal and axotomized ganglia. More work is needed to definitively identify these cells that express trkA, B and C as satellite cells, ideally by double labeling for GFAP and the trk receptors. It is an important question, as the expression of trkA or trkC enables neuronal differentiation upon exposure to NGF or NT-3 respectively in cultured SH-SY5Y neuroblastoma cells (Edsjo et al., 2001), and ectopic expression of a truncated isoform of trkC (known as trkC NC2; Menn et al., 1998) in cultured neural crest cells promoted sensory neuron differentiation (Hapner et al., 1998). Satellite cell expression of trkC and trkA in vivo would be a potential mechanism by which NT-3 or NGF could stimulate differentiation into neurons, although other factors are likely to be required as we have not observed any evidence for neurogenesis in intact (contralateral) DRGs from NT-3-treated animals. In the adult brain certain astrocytes (those derived from radial glia), a cell population with similarities to satellite cells, are also thought to have neuronal precursor cell properties (see Mori et al., 2005). Moreover, certain adult bone marrow cells have recently been shown to express trk receptors and nestin and are able to differentiate into neurons and glia in vitro (Woodbury et al., 2000), and in DRGs in vivo (Corti et al., 2002), making the question of satellite cell trk expression all the more urgent. This question of satellite cells or bone marrow cells as sensory neuron precursors is probably best addressed by a transgenic approach, using reporter genes to label specific cell populations. The increased expression of p75NTR mRNA and IR in satellite cells surrounding large diameter neurons in ipsiand contralateral ganglia and decreased expression in neurons agrees with previous work (Zhou et al., 1996). This satellite cell population appears to be the same one that expresses nestin (Kuo et al., 2005) and glial fibrillary acidic protein IR (Zhou et al., 1996), and NGF and NT-3 mRNA (Zhou et al., 1999) after injury. Co-expression of p75NTR and nestin is a marker for embryonic sensory neuron precursor cells (Mujtaba et al., 1998), indicating that this subset of satellite cells is a candidate sensory neuron precursor cell population, the presence of which in adult DRG has been suggested by others (Ciaroni et al., 2000; Namaka et al., 2001; Guena et al., 2002). A resident nestin immunoreactive cell population also appears to be responsible for axotomy-induced neurogenesis in the dorsal vagal complex of the rat (Bauer et al., 2005), and in the postnatal retina (Fischer and Reh, 2001; Walcott and Provis, 2003). More recent work has shown that embryonic stem cells from the cerebral cortex can differentiate into neurons and glia when transplanted into DRG cavities after removal of the DRG in adult rats (Brännvall et al., 2006).

Interestingly, no evidence of neurogenesis was observed in this study when these stem cells were transplanted into intact ganglia of adult rats. If some satellite cells do differentiate into sensory neurons after nerve injury, the expression of NGF and NT-3 mRNA in satellite cells may represent an autocrine or paracrine signaling mechanism. It is tempting to speculate whether sensory neurogenesis could explain intraganglionic axonal sprouting seen after nerve injury, and which could contribute to hyperalgesia and allodynia caused by certain nerve injuries (McLachlan and Hu, 1998; Zhou et al., 1999; Li and Zhou, 2001). The presence of nestin in neurons indicates that these are immature and have either regressed, or have recently differentiated from nestin immunoreactive precursors (Lendahl et al., 1990; Kato et al., 1999; Woodbury et al., 2000; Rice et al., 2003). Systemic NT-3 administration for 1 month increased the number of nestin-immunoreactive DRG neurons in ipsilateral ganglia after 2 weeks, so that by 4 weeks the number of nestin immunoreactive neurons was twice that seen in vehicle-treated controls (Kuo et al., 2005). Stereological estimates of neuronal number and rates of apoptosis also indicated that new sensory neuron formation began between 2 and 4 weeks after injury and NT-3 administration (Kuo et al., 2005), but it was not clear from nestin immunostaining which cells are responsible for the upregulation in nestin mRNA produced by NT-3 administration in this study. In the uninjured CNS nestin IR is largely observed in some endothelial and subventricular cells (Sahin Kaya et al., 1999) that may indicate a “vascular niche” for CNS neurogenesis (Palmer et al., 2000), but we have not observed nestin IR in any endothelial cells in adult rat DRG. We did not observe any obvious correlation between the changes in nestin mRNA levels and changes in any of the neurotrophin or receptor mRNAs examined, with the possible exception of trkC. Satellite cell proliferation peaks during the week following nerve injury, whereas the peak proliferative activity of Schwann cells and other non-neuronal cell types is during the second week after injury (Friede and Johnstone, 1967; Lu and Richardson, 1991). The increase in nestin mRNA could equally be due to an influx of cells from outside the DRG, as to cells resident in the DRG. Whatever the source of the increase in nestin mRNA, more work is needed using retrograde tracing or immunohistochemistry for other neuronal differentiation markers (such as the neurogenins or doublecortin) to determine whether nestin immunoreactive neurons are newly formed or not. Contralateral DRGs The few reports examining contralateral ganglia found either no significant change in trkA and trkB mRNA levels after crushing the sciatic nerve (Sebert and Shooter, 1993) or a reduction in numbers of trkA immunoreactive neurons after L4 and L5 spinal nerve transection (Deng and Zhou, 2000). Our finding that sciatic transection increases trkA and (transiently) trkC mRNA expression in small- to medium-sized neurons, and decreases p75NTR mRNA is evi-

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

dence of effects of nerve injury on contralateral ganglia (see Koltzenburg et al., 1999; Takahashi et al., 2003). The decrease in trkA mRNA in contralateral ganglia after 2 weeks in NT-3-treated animals is similar to that reported in uninjured DRG neurons (Gratto and Verge, 2003), although it is not clear how much the effect on NGF signaling is counteracted by the up-regulation of p75NTR mRNA. Recent work has shown tumor necrosis factor-␣ (TNF-␣) injected into the sciatic nerve is transported to, and induces gene expression in, the contralateral ganglia via a transpinal route and not via the systemic circulation (Shubayev et al., 2005). NT-3 administration may have modulated the production and/or transport of a transported molecule such as TNF-␣, or may have modulated the response to it in the contralateral ganglia. The p75NTR receptor is normally co-expressed with trkA and B receptors in DRG neurons, as well as half of the trkC-expressing neurons (Wright and Snider, 1995), and p75NTR IR was observed in neurons of all sizes, as well as satellite cells around large DRG neurons after axotomy and vehicle/NT-3 treatment. Some of its functions may be to enhance the binding affinity of trk receptors (Hempstead et al., 1991; Benedetti et al., 1993) and facilitate the retrograde transport of certain neurotrophins (Curtis et al., 1995). These changes may affect the response or sensitivity of ipsilateral and contralateral neurons to neurotrophin signaling in opposite ways, as increased p75NTR expression may enhance the specificity of trkA activation by NGF and trkB activation by BDNF, and reduce the likelihood of trkA and trkB activation by NT-3 (Davies et al., 1993; Barker and Shooter, 1994; Bibel et al., 1999; Mischel et al., 2001). This is the first study to quantify the effect of administration of a neurotrophin on the expression of neurotrophin, neurotrophin receptor or nestin mRNA following axotomy. The main findings are that unilateral axotomy has significant effects on the contralateral ganglia, that systemic administration of NT-3 counteracts many of the changes in the expression of neurotrophin and neurotrophin receptor mRNA that occur after peripheral axotomy, and that some satellite cells may be responsive to neurotrophins. The overall effect of NT-3 administration is likely to increase the production of, and responsiveness to, neurotrophins in the ipsilateral ganglia and so counteract some of the effects of axotomy on neurotrophin signaling. NT-3 administration may also increase the sensitivity and specificity of neurotrophin signaling in the contralateral ganglia. The increase in nestin mRNA produced by NT-3 administration is probably due to an increase in the number of cells or neurons that express nestin. These results strongly suggest that exogenous NT-3 would have synergistic effects when administered with other neurotrophins, particularly NGF. Acknowledgments—We would like to thank Regeneron Pharmaceuticals Inc. (NY, USA) and Amgen for providing the NT-3. This work was supported by the Brain Research Trust.

505

REFERENCES Araki T, Nagarajan R, Milbrandt J (2001) Identification of genes induced in peripheral nerve after injury. J Biol Chem 276: 34131–34141. Arvidsson J, Ygge J, Grant G (1986) Cell loss in lumbar dorsal root ganglia and transganglionic degeneration after sciatic nerve resection in the rat. Brain Res 373:15–21. Barker PA, Shooter EM (1994) Disruption of NGF binding to the low affinity neurotrophin receptor p75LNTR reduces NGF binding to trkA on PC12 cells. Neuron 13:203–215. Bauer S, Hay M, Amilhon B, Jean A, Moyse E (2005) In vivo neurogenesis in the dorsal vagal complex of the adult rat brainstem. Neuroscience 130:75–90. Benedetti M, Levi A, Chao MV (1993) Differential expression of nerve growth factor receptors leads to altered binding affinity and neurotrophin responsiveness. Proc Natl Acad Sci U S A 90:7859 –7863. Bergman E, Fundin BT, Ulfhake B (1999) Effects of aging and axotomy on the expression of neurotrophin receptors in primary sensory neurons. J Comp Neurol 410:368 –386. Bibel M, Hoppe E, Barde Y-A (1999) Biochemical and functional interactions between the neurotrophin receptors trk and p75NTR. EMBO J 18:616 – 622. Bothwell M (1995) Functional interactions of neurotrophins and neurotrophin receptors. Annu Rev Neurosci 18:223–253. Brännvall K, Sandelin M, Wallenquist U, Forsberg-Nilsson K, Aldskogius H, Kozlova EN (2006) Central nervous system stem/progenitor cells form neurons and peripheral glia after transplantation to the dorsal root ganglion. Neuroreport 17:623– 628. Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 29:23–39. Ciaroni S, Cecchini T, Cuppini R, Ferri P, Ambrogini P, Bruno C, Del Grande P (2000) Are there proliferating neuronal precursors in adult rat dorsal root ganglia? Neurosci Lett 281:69 –71. Cordon-Cardo C, Tapley P, Jing S, Nanduri V, O’Rourke E, Lamballe F, Kovary K, Klein R, Jones KR, Reichardt LF, Barbacid M (1991) The trk tyrosine protein kinase mediates the mitogenic properties of nerve growth factor and neurotrophin-3. Cell 66:173–183. Corti S, Locatelli F, Donadoni C, Strazzer S, Salani S, Del Bo R, Caccialanza M, Bresolin N, Scarlato G, Comi GP (2002) Neuroectodermal and microglial differentiation of bone marrow cells in the mouse spinal cord and sensory ganglia. J Neurosci Res 70: 721–733. Curtis R, Adryan KM, Stark JL, Park JS, Compton DL, Weskamp G, Huber LJ, Chao MV, Jaenisch R, Lee K-F, Lindsay RM, DiStefano PS (1995) Differential role of the low affinity neurotrophin receptor (p75) in retrograde axonal transport of the neurotrophins. Neuron 14:1201–1211. Davies AM, Lee K-F, Jaenisch R (1993) p75-Deficient trigeminal sensory neurons have an altered response to NGF but not to other neurotrophins. Neuron 11:565–574. Deng LLYS, Zhou X-F (2000) Downregulation of trkA expression in primary sensory neurons after unilateral lumbar spinal nerve transection and some rescuing effects of nerve growth factor infusion. Neurosci Res 38:183–191. Edsjo A, Hallberg B, Fagerstrom S, Larsson C, Axelson H, Pahlman S (2001) Differences in early and late responses between neurotrophin-stimulated trkA- and trkC-transfected SH-SY5Y neuroblastoma cells. Cell Growth Differ 12:39 –50. Edström A, Ekström PAR, Tonge D (1996) Axonal outgrowth and neuronal apoptosis in cultured adult mouse dorsal root ganglion preparations: effects of neurotrophins, of inhibition of neurotrophin actions and of prior axotomy. Neuroscience 75:1165–1174. El Shamy WM, Fridvall LK, Ernfors P (1998) Growth arrest failure, G1 restriction point override, and S phase death of sensory precursor cells in the absence of neurotrophin-3. Neuron 21:1003–1015.

506

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507

Ernfors P, Rosario CM, Merlio JP, Grant G, Aldskogius H, Persson H (1993) Expression of mRNAs for neurotrophin receptors in the dorsal root ganglion and spinal cord during development and following peripheral or central axotomy. Brain Res Mol Brain Res 17:217–226. Ernfors P, Lee K-F, Kucera J, Jaenisch R (1994) Lack of neurotrophin-3 leads to deficiencies in the peripheral nervous system and loss of limb proprioceptive afferents. Cell 77:503–512. Fanarraga ML, Avila J, Zabala JC (1999) Expression of unphosphorylated class III ␤-tubulin isotype in neuroepithelial cells demonstrates neuroblast commitment and differentiation. Eur J Neurosci 11:517–527. Fariñas I, Cano-Jaimez M, Bellmunt E, Soriano M (2002) Regulation of neurogenesis by neurotrophins in developing spinal sensory ganglia. Brain Res Bull 57:809 – 816. Fischer AJ, Reh TA (2001) Müller glia are a potential source of neural regeneration in the postnatal chicken retina. Nat Neurosci 4:247–252. Friede RL, Johnstone MA (1967) Responses of thymidine labeling of nuclei in gray matter and nerve following sciatic transection. Acta Neuropathol 7:218 –231. Funakoshi H, Frisén J, Barbany G, Timmusk T, Zachrisson O, Verge VMK, Persson H (1993) Differential expression of mRNAs for neurotrophins and their receptors after axotomy of the sciatic nerve. J Cell Biol 123:455– 465. Gratto KA, Verge VMK (2003) Neurotrophin-3 down-regulates trkA mRNA, NGF high-affinity binding sites, and associated phenotype in adult DRG neurons. Eur J Neurosci 18:1535–1548. Groves MJ, Christopherson T, Giometto B, Scaravilli F (1997) Axotomy-induced apoptosis in adult rat primary sensory neurons. J Neurocytol 26:615– 624. Groves MJ, An S-F, Giometto B, Scaravilli F (1999) Inhibition of sensory neuron apoptosis and prevention of loss by NT-3 administration following axotomy. Exp Neurol 155:284 –294. Groves MJ, Schänzer A, Simpson AJ, An S-F, Kuo L-T, Scaravilli F (2003) Profile of adult rat sensory neuron loss, apoptosis and replacement after sciatic nerve crush. J Neurocytol 32:113–122. Guena S, Borrione P, Filogamo G (2002) Postnatal histogenesis in the peripheral nervous system. Int J Dev Neurosci 20:475– 479. Hapner SJ, Boeshore KL, Large TH, Lefcort F (1998) Neural differentiation promoted by truncated trkC receptors in collaboration with p75NTR. Dev Biol 201:90 –100. Helgren ME, Cliffer KD, Torrento K, Cavnor C, Curtis R, DiStefano PS, Wiegand SJ, Lindsay RM (1997) Neurotrophin-3 administration attenuates deficits of pyridoxine-induced large-fiber sensory neuropathy. J Neurosci 17:372–382. Hempstead BL, Martin-Zanca D, Kaplan DR, Parada LF, Chao MV (1991) High-affinity NGF binding requires coexpression of the trk proto-oncogene and the low-affinity NGF receptor. Nature 350: 678 – 683. Jacobs JM, MacFarlane RM, Cavanagh JB (1976) Vascular leakage in the dorsal root ganglia of the rat, studied with horseradish peroxidase. J Neurol Sci 29:95–107. Karchewski LA, Gratto KA, Wetmore C, Verge VMK (2002) Dynamic patterns of BDNF expression in injured sensory neurons: differential modulation by NGF and NT-3. Eur J Neurosci 16:1449 –1462. Kato T, Yokouchi K, Li Z, Fukushima N, Kawagishi K, Moriizumi T (1999) Calretinin-immunoreactive neurons in rostral migratory stream: neuronal differentiation. Neuroreport 10:2769 –2772. Knusel B, Gao H, Okazaki T, Yoshida T, Mori N, Hefti F, Kaplan DR (1997) Ligand-induced down-regulation of trk messenger RNA, protein and tyrosine phosphorylation in rat cortical neurons. Neuroscience 78:851– 862. Koltzenburg M, Wall PD, McMahon SB (1999) Does the right side know what the left is doing? Trends Neurosci 22:122–127. Krekoski CA, Parhad IM, Clark AW (1996) Attenuation and recovery of nerve growth factor receptor mRNA in dorsal root ganglion neurons following axotomy. J Neurosci Res 43:1–11.

Krüttgen A, Möller JC, Heymach JV, Shooter EM (1998) Neurotrophins induce release of neurotrophins by the regulated secretory pathway. Proc Natl Acad Sci U S A 95:9614 –9619. Kuo L-T, Simpson A, Schänzer A, Tse J, An S-F, Scaravilli F, Groves MJ (2005) Effects of systemically administered NT-3 on sensory neuron loss and nestin expression following axotomy. J Comp Neurol 482:320 –332. Lamballe F, Klein R, Barbacid M (1991) TrkC, a new member of the trk family of tyrosine protein kinases, is a receptor for neurotrophin-3. Cell 66:967–979. Lawson SN (2005) The peripheral sensory nervous system: Dorsal root ganglion neurons. In: Peripheral neuropathy, 4th edition, Vol. 1 (Dyck PJ, Thomas PK, eds), pp 163–202. Philadelphia: Elsevier Saunders. Leclere P, Ekström P, Edström A, Priestley JV, Averill S, Tonge DA (1997) Effects of glial cell line-derived neurotrophic factor on axonal growth and apoptosis in adult mammalian sensory neurons in vitro. Neuroscience 82:545–558. Lendahl U, Zimmerman LB, McKay RDG (1990) CNS stem cells express a new class of intermediate filament protein. Cell 60: 585–595. Li L, Zhou X-F (2001) Pericellular Griffonia simplicifolia I isolectin B4-binding ring structures in the dorsal root ganglia following peripheral nerve injury in rats. J Comp Neurol 439:259 –274. Ljungberg C, Novikov L, Kellerth JO, Ebendal T, Wiberg M (1999) The neurotrophins NGF and NT-3 reduce sensory neuronal loss in adult rat after peripheral nerve lesion. Neurosci Lett 262:29 –32. Lu X, Richardson PM (1991) Inflammation near the nerve cell body enhances axonal regeneration. J Neurosci 11:972–978. MacDonald R, Bingham S, Bond BC, Parsons AA, Philpott KL (2001) Determination of changes in mRNA expression in a rat model of neuropathic pain by Taqman™ quantitative RT-PCR. Mol Brain Res 90:48 –56. Mackay IM, Arden KE, Nitsche A (2002) Real-time PCR in virology. Nucleic Acids Res 30:1292–1305. McKay Hart A, Brannstrom T, Wiberg M, Terenghi G (2002) Primary sensory neurons and satellite cells after peripheral axotomy in the adult rat. Exp Brain Res 142:308 –318. McLachlan EM, Hu P (1998) Axonal sprouts containing calcitonin gene-related peptide and substance P form pericellular baskets around large diameter neurons after sciatic nerve transection in the rat. Neuroscience 84:961–965. Menn B, Timsit S, Calothy G, Lamballe F (1998) Differential expression of trkC catalytic and noncatalytic isoforms suggests that they act independently or in association. J Comp Neurol 401:47– 64. Michael GJ, Averill S, Shortland PJ, Yan Q, Priestley JV (1999) Axotomy results in major changes in BDNF expression by dorsal root ganglion cells: BDNF expression in large trkB and trkC cells, in pericellular baskets, and in projections to deep dorsal horn and dorsal column nuclei. Eur J Neurosci 11:3539 –3551. Mischel PS, Smith SG, Vining ER, Valletta JS, Mobley WC, Reichardt LF (2001) The extracellular domain of p75NTR is necessary to inhibit neurotrophin-3 signaling through TrkA. J Biol Chem 276: 11294 –11301. Mizisin AP, Bache M, DiStefano PS, Acheson A, Lindsay RM, Calcutt NA (1997) BDNF attenuates functional and structural disorders in nerves of galactose-fed rats. J Neuropathol Exp Neurol 56: 1290 –1301. Mori T, Buffo A, Gotz M (2005) The novel roles of glial cells revisited: the contribution of radial glia and astrocytes to neurogenesis. Curr Top Dev Biol 69:67–99. Mujtaba T, Mayer-Proschel M, Rao MS (1998) A common neural progenitor for the CNS and PNS. Dev Biol 200:1–15. Munson JB, Shelton DL, McMahon SB (1997) Adult mammalian sensory and motor neurons: roles of endogenous neurotrophins and rescue by exogenous neurotrophins after axotomy. J Neurosci 17:470 – 476.

L.-T. Kuo et al. / Neuroscience 147 (2007) 491–507 Namaka MP, Sawchuk M, MacDonald SC, Jordan LM, Hochman S (2001) Neurogenesis in postnatal mouse dorsal root ganglia. Exp Neurol 172:60 – 69. Palmer TD, Willhoite AR, Gage FH (2000) Vascular niche for adult hippocampal neurogenesis. J Comp Neurol 425:479 – 494. Pannese E, Procacci P (2002) Ultrastructural localization of NGF receptors in satellite cells of the rat spinal ganglia. J Neurocytol 31:755–763. Poduslo JF, Curran GL (1996) Permeability at the blood-brain and blood-nerve barriers of the neurotrophic factors: NGF, CNTF, NT-3, BDNF. Mol Brain Res 36:280 –286. Rice AC, Khaldi A, Harvey HB, Salman NJ, White F, Fillmore H, Bullock MR (2003) Proliferation and neuronal differentiation of mitotically active cells following traumatic brain injury. Exp Neurol 183:406 – 417. Rich KM, Disch SP, Eichler ME (1989) The influence of regeneration and nerve growth factor on the neuronal cell body reaction to injury. J Neurocytol 18:569 –576. Romero MI, Rangappa N, Garry MG, Smith GM (2001) Functional regeneration of chronically injured sensory afferents into adult spinal cord after neurotrophin gene therapy. J Neurosci 21:8408– 8416. Sahin Kaya S, Mahmood A, Li Y, Yavuz E, Chopp M (1999) Expression of nestin after traumatic brain injury in rat brain. Brain Res 840:153–157. Schmalbruch H (1987) Loss of sensory neurons after sciatic nerve section in the rat. Anat Rec 219:323–329. Sebert ME, Shooter EM (1993) Expression of mRNA for neurotrophic factors and their receptors in the rat dorsal root ganglion and sciatic nerve following nerve injury. J Neurosci Res 36:357–367. Shen H, Chung JM, Coggeshall RE, Chung K (1999) Changes in trkA expression in the dorsal root ganglion after peripheral nerve injury. Exp Brain Res 127:141–146. Shubayev VI, Dolkas J, Angert M, Myers RR (2005) TNF-alpha retrograde axonal transport activates ipsilateral and contralateral spinal glia and DRG gene expression after peripheral nerve injury. J Peripher Nerv Syst 10:86. Soppet D, Escandon E, Maragos J, Middlemas DS, Reid SW, Blair J, Burton LE, Stanton BR, Kaplan DR, Hunter T, Nikolics K, Parada

507

LF (1991) The neurotrophic factors brain-derived neurotrophic factor and neurotrophin-3 are ligands for the trkB tyrosine kinase receptor. Cell 65:895–903. Takahashi N, Kikuchi S, Dai Y, Kobayashi K, Fukuoka T, Noguchi K (2003) Expression of auxiliary beta subunits of sodium channels in primary afferent neurons and the effect of nerve injury. Neuroscience 121:441– 450. Terenghi G (1999) Peripheral nerve regeneration and neurotrophic factors. J Anat 194:1–14. Tria MA, Fusco M, Vantini G, Mariot R (1994) Pharmacokinetics of nerve growth factor (NGF) following different routes of administration to adult rats. Exp Neurol 127:178 –183. Walcott JC, Provis JM (2003) Muller cells express the neuronal progenitor cell marker nestin in both differentiated and undifferentiated human foetal retina. Clin Exp Ophthalmol 31:246 –249. Woodbury D, Schwarz EJ, Prockop DJ, Black IB (2000) Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 61:364 –370. Wright DE, Snider WD (1995) Neurotrophin receptor mRNA expression defines distinct populations of neurons in rat dorsal root ganglia. J Comp Neurol 351:329 –338. Xu B, Michalski B, Racine RJ, Fahnestock M (2002) Continuous infusion of neurotrophin-3 triggers sprouting, decreases the level of TrkA and TrkC and inhibits epileptogenesis and activity-dependent axonal growth in adult rats. Neuroscience 115:1295–1308. Zhang J-Y, Luo X-G, Xian CJ, Liu Z-H, Zhou X-F (2000) Endogenous BDNF is required for myelination and regeneration of injured sciatic nerve in rodents. Eur J Neurosci 12:4171– 4180. Zhou X-F, Rush RA, McLachlan EM (1996) Differential expression of the p75 nerve growth factor receptor in glia and neurons of the rat dorsal root ganglia after peripheral nerve transection. J Neurosci 16:2901–2911. Zhou X-F, Deng YS, Chie E, Xue Q, Zhong JH, McLachlan EM, Rush RA, Xian CJ (1999) Satellite-cell-derived nerve growth factor and neurotrophin-3 are involved in noradrenergic sprouting in the dorsal root ganglia following peripheral nerve injury in the rat. Eur J Neurosci 11:1711–1722.

(Accepted 13 April 2007) (Available online 29 May 2007)