Neurotropin inhibits neuroinflammation via suppressing NF-κB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells

Journal of Pharmacological Sciences xxx (2018) 1e7

Contents lists available at ScienceDirect

Journal of Pharmacological Sciences journal homepage: www.elsevier.com/locate/jphs

Full paper

Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells Yuqiu Zheng a, Wenli Fang a, Shengnuo Fan a, Wang Liao a, Ying Xiong a, Shaowei Liao a, Yi Li a, Songhua Xiao a, **, Jun Liu a, b, c, *, 1 a b c

Department of Neurology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, 107 Yanjiang West Road, Guangzhou, China Laboratory of RNA and Major Diseases of Brain and Heart, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, 510120, China Guangdong Province Key Laboratory of Brain Function and Disease, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 December 2017 Received in revised form 26 January 2018 Accepted 13 February 2018 Available online xxx

Neurotropin (NTP) is a widely used drug in China and Japan mainly for the treatment of chronic pain and peripheral inflammation. Nevertheless, the effects of NTP on neuroinflammation have not been explored. In this study, we investigated the anti-inflammatory effects of NTP in lipopolysaccharide (LPS)-stimulated BV-2 microglial cells and its underlying mechanisms. BV-2 cells were pretreated with NTP for 12 h before exposure to LPS. The expression of pro-inflammatory cytokines (TNF-a and IL-6) were detected by RT-PCR and EILSA at mRNA and protein levels, respectively. Western blotting was conducted to measure the protein levels of major genes in MAPKs and NF-kB signaling pathways. Results demonstrated that NTP could attenuate the production of pro-inflammatory cytokines. Furthermore, NTP inhibited the activation of NF-kB signaling by decreasing the translocation of NF-kB p65 to the nucleus and suppressed the MAPKs signaling pathway via inhibition of the phosphorylation of p38, ERK and JNK. Taken together, these findings suggest that neurotropin exerts anti-inflammatory effects by suppressing the production of pro-inflammatory mediators via inhibition of NF-kB and MAPKs signaling pathways in LPS-stimulated BV-2 cells. © 2018 The Authors. Production and hosting by Elsevier B.V. on behalf of Japanese Pharmacological Society. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/).

Keywords: Neurotropin Neuroinflammation NF-kB MAPKs LPS

1. Introduction Neuroinflammation is a hallmark of several neurological diseases, such as Alzheimer's disease (AD), Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, stroke and acute brain injury and so on.1e3 Microglia, the major resident immunocompetent cells in the nervous system, are the first defense against pathological insults. However, once over-activated, microglia released excessive pro-inflammatory mediators, such as tumornecrosis factor-alpha (TNF-a), interleukin 1beta (IL-1b), interleukin 6 (IL-6), reactive oxygen species (ROS) and so on.4 Researches * Corresponding author. Department of Neurology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, 107 Yanjiang West Road, Guangzhou, China. Fax: þ86 020 81332620. ** Corresponding author. E-mail addresses: [email protected] (S. Xiao), [email protected] (J. Liu). Peer review under responsibility of Japanese Pharmacological Society. 1 Jun Liu will handle correspondence at all stages of refereeing, publication and post-publication.

demonstrated that inhibiting the excessive activation of microglia could attenuate the pathologies of various neurological diseases.5,6 Lipopolysaccharide (LPS), an endotoxin secreted by Gramnegative bacteria, is an activator of inflammation and usually used as a model of inflammation in many studies.7,8 In the inflammatory process simulated by LPS, mitogen-activated protein kinases (MAPKs) and nuclear factor kappa B (NF-kB) have been considered as two important signaling pathways. There are three major MAPKs signaling pathways, for example, p38 MAPK, extracellular signal-regulated kinases 1 and 2 (ERK1/2) and c-Jun N-terminal kinases (JNKs). MAPKs signaling has been reported to be involved in the cellular processes such as immune response, apoptosis, oxidative stress response and differentiation. Researches have demonstrated that natural products could display anti-inflammatory effects by prohibiting the MAPKs signaling pathway.9,10 Nuclear factor kappa B (NF-kB), a family of transcription factors and the downstream of TLRs signaling, is involved in the modulation of many inflammatory mediators. Under normal condition, NF-kB p65 is resident in the cytoplasm as an inactivation form by

https://doi.org/10.1016/j.jphs.2018.02.004 1347-8613/© 2018 The Authors. Production and hosting by Elsevier B.V. on behalf of Japanese Pharmacological Society. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004

2

Y. Zheng et al. / Journal of Pharmacological Sciences xxx (2018) 1e7

integrating with NF-kB p50 and inhibitor kappa B alpha (IkBa). Once stimulated by inflammatory signals, the upper modulator of IkBa, inhibitor of nuclear factor kappa-B kinase (IKK), was activated and then IkBa is phosphorylated and degraded, resulting in the translocation of NF-kB p65 to the nucleus.11 The release of NF-kB regulates the transcriptions of its target genes, triggering expressions of pro-inflammatory mediators, such as TNF-a, IL-6, IL-1b and so on.12 Neurotropin (NTP), a non-protein bioactive agent extracted from inflamed rabbit skin inoculated with vaccinia virus, is widely used in Japan and China mainly for the treatment of chronic pain conditions, such as low back pain, post-herpetic neuralgia, fibromyalgia and primary headaches and so on.13e17 Furthermore, NTP has been reported to exert dominant effects on various neuropathic symptoms associated with subacute myelo-opticoneuropathy, diabetic neuropathy, chronic neurotoxicity and Alzheimer's disease.18e21 Recently, it has been revealed that NTP attenuated peripheral local inflammation by suppressing the production of pro-inflammatory factors in human intervertebral disc cells, hepatocytes and chronic constriction injury model of mouse sciatic nerve.22e24 However, the potential effects of NTP on neuroinflammation and its underlying mechanism remain to be explored. In this study, we used LPS-induced BV-2 microglial cells as the inflammatory cell model. BV-2 cells were pretreated with NTP before exposure to LPS. We then investigated the anti-inflammatory potentials of NTP on the expression of pro-inflammatory cytokines, including TNF-a and IL-6. The possible roles of MAPKs and NF-kB signaling pathways were also evaluated. 2. Materials and methods 2.1. Reagents and antibodies Neurotropin was provided from Nippon Zoki Pharmaceutic Co.Ltd. (Osaka, Japan). Lipopolysaccharides (LPS) from Escherichia coli O55:B5 was purchased from SigmaeAldrich Chemical (St. Louis, MO, USA). Dulbecco's modified Eagle medium (DMEM/ F12), fetal bovine serum (FBS) and 0.25% trypsin were obtained from Gibco (New York, NY, USA). A cell counting kit-8 (CCK-8) was purchased from Dojin Kagaku (Kumamato, Kyushu, Japan). Primers for RT-PCR were synthesized by the Beijing Genomics Institute (BGI). Enzyme-linked immunosorbent assay (ELISA) kits for TNF-a and IL-6 were purchased from Liuhe Biotech (Wuhan, China). A Nuclear and Cytoplasmic Extraction Kit was obtained from Comwin Biotech Co.Ltd (Beijing, China). The following primary antibodies against GAPDH, b-tubulin, histone H3, p38, p-p38, c-Jun N-terminal kinase (JNK), p-JNK, extracellular signal-regulated kinase (ERK), p-ERK, NF-kB p65, p-p65, IkBa,p-IkBa, IKKb,p-IKKb and secondary antibody horseradish peroxidase (HRP)-linked goat anti-rabbit and anti-mouse IgG were purchased from Cell Signaling Technology (Danvers, MA, USA). The immobilin western chemiluminescent horseradish peroxidase substrate was acquired from Millipore (Billericak, MA, USA). Other routine reagents were purchased from Takara Clontech, GE Healthcare life Sciences Hyclone Laboratories, Comwin Biotech Co.Ltd and Thermo Fisher Scientific. 2.2. BV-2 microglial cell culture and treatment Immortal BV-2 murine microglial cells, which possess all the characteristics of primary microglia, were kindly provided from Dr. Ying Chen (Sun Yat-sen University, GZ, China). BV-2 cells were cultured in Dulbecco's modified Eagle medium (DMEM/F12) supplemented with 10% FBS, 1% penicillin (100 U/mL)/streptomycin (100 mg/mL) and kept at 37  C incubator with 5% CO2. For RT-PCR, ELISA and western blotting, BV-2 cells were seeded in 6-well

plates (1 x 10^5 cells/well) for 24 h and then administrated or not with NTP (0.1 NU/mL) 12 h prior to LPS treatment (100, 1000 ng/mL) for another 12 h. 2.3. CCK-8 assay for cell viability The effects of NTP and LPS on BV-2 cells viability were detected by CCK-8 assay. In brief, cells were cultured on a 96-well plate at a density of 1 x 10^4 per well for 24 h and then administrated with certain concentrations of NTP (0.001, 0.01, 0.1 and 1 NU/mL) or LPS (100, 1000 ng/mL) for another 24 h. The media were then removed and 110 mL of DMEM/F12 medium containing 10% CCK-8 reagent (10 mL) was added into each well. Then the cells were incubated at 37  C for 2 h and the absorbance values of the samples were measured at 450 nm by a multifunctional microplate reader (SpectraMax M5, Sunnyvale, CA, USA). 2.4. Quantitative RT-PCR analysis Total RNA was extracted using Trizol reagent (Takara, Tokyo, Japan) and then reverse transcribed to cDNA using primeScript™ Master Mix (Takara, Tokyo, Japan). Quantitative real-time polymerase chain reaction (RT-PCR) was performed by Roche LightCycler®96 PCR instrument (Roche, Basel, Switzerland) according to optimized PCR protocols. The PCR reaction system (10 mL in total) contained 1 mL of cDNA, 3 mL of DEPC-treated water, 0.5 mL of sense and antisense primer and 5 mL of SYBR® Premix Ex Taq™ II (Takara, Tokyo, Japan). The cycling conditions were as follows: a preincubation step at 95  C for 30 s, followed by 40 amplification cycles (95  C for 5 s, 60  C for 30 s), melting (95  C for 10 s, 65  C for 30 s, 97  C for 1 s) and then cooling (37  C for 30 s). Specific primers used for RT-PCR are as followed: TNF-a (F: ATGGCCTCCCTCTCATCAGT; R: TTTGCTACGACGTGGGCTAC); IL-6 (F: CCCAATTTCCAATGCTCTCCT; R: CGCACTAGGTTTGCCGAGTA); GAPDH (F: AGAGGGATGCTGCCCTTACC; R: AAATCCGTTCACACCGACCT). GAPDH is served as a normalization control. The relative RNA expression of each gene was analyzed using the 2△△CT method as previously reported.25 2.5. Enzyme-linked immunosorbent assay (ELISA) To detect the anti-inflammatory effect of NTP, cells (1 x 10^5) were treated or not with NTP for 12 h (0.01, 0.1 NU/mL) prior to LPS (100, 1000 ng/mL) treatment for another 12 h. Then the cell culture medium was centrifuged at 4  C at 1000  g for 20 min and the supernatant was collected. The concentrations of TNF-a and IL-6 were measured using the commercially available ELISA kits according to the manufacturer's protocols. 2.6. Western blot analysis Cells were washed three times using ice-cold PBS, and then suspended in 100 mL RIPA lysis buffer supplemented with 1% protease inhibitor and 1% phosphorylated protease inhibitor. After incubation on ice for 30 min, samples were centrifuged at 4  C at 12,000  g for 20 min to get total cellular protein. The extraction of cytoplasmic protein and nuclear protein was conducted using the Nuclear and Cytoplasmic Extraction Kit according to the manufacturer's instructions. The proteins were quantified using BCA protein assay, separated by SDS-PAGE and transferred to PVDF membranes. After that, the PVDF membranes were blocked with 5% BSA for 1 h and incubated with primary antibodies at 4  C overnight. After being washed with TBST three times, the membranes were incubated with secondary antibodies for 1 h and visualized with immobilin western chemiluminescent horseradish peroxidase substrate using the Digital Imaging System (Gel Logic 2200Pro,

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004

Y. Zheng et al. / Journal of Pharmacological Sciences xxx (2018) 1e7

Kodak, USA). Primary antibodies and dilution ratios used were listed as follows: GAPDH, 1:1000; b-tubulin, 1:1000; histone H3, 1:1000; p-NF-kB p65 (Ser536), 1:1000; NF-kB p65, 1:1000; p-IkBa (Ser32), 1:1000; IkBa, 1:1000; p-IKKb (Ser180), 1:1000; IKKb, 1:1000;, p-p38 (Thr180/Tyr182), 1:1000; p38, 1:1000; p-JNK (Thr183/Tyr185), 1:500; JNK, 1:1000; p-ERK (Thr202/Tyr204), 1:1000; and ERK, 1:2000. The densitometric values of the bands were calculated using the Image J software (National Institutes of Health, USA). 2.7. Statistical analysis The results were expressed as mean ± standard deviation from three independent experiments and difference among groups was assessed by the one-way analysis of variance (ANOVA) followed by Fisher's LSD tests. A p-value of <0.05 was considered as statistically significant. SPSS 20.0 (SPSS, Inc, Chicago, IL, USA) and Graphpad Prism 6.0 (Graphpad Software, San Diego, CA, USA) were used for statistical analysis and graph generation. 3. Results 3.1. Cell viability To examine the cytotoxicity of NTP and LPS on BV-2 cells and avoid the direct influence of cytotoxicity on subsequent experiments, a CCK-8 assay was used to detect the effects of NTP and LPS on cell viability in BV-2 cells. As shown in Fig. 1, cell viabilities following administration with NTP at 0.001 NU/mL (96.373% ± 19.984%), 0.01 NU/mL (97.254% ± 8.828%), 0.1 NU/mL (95.198% ± 10.195%), 1 NU/mL (117.941% ± 28.557%) and LPS at 100 ng/mL (98.236% ± 16.571%), 1000 ng/mL (102.756% ± 12.139%) for 24 h were not significantly different from control groups, implying that the anti-inflammatory effects of NTP were not caused by the reduction of cell viability. Thus, we chose the concentrations of 0.01 NU/mL, 0.1 NU/mL, 100 ng/mL and 1000 ng/mL for the following experiments. 3.2. Neurotropin reduced the expressions of pro-inflammatory cytokines in LPS-stimulated BV-2 cells To evaluate the potential anti-inflammatory effects of NTP on LPS-stimulated BV-2 microglial cells, ELISA assays for detecting

3

TNF-a and IL-6 protein levels in culture media were conducted. As shown in Fig. 2 (A, C), LPS significantly increased the protein levels of TNF-a and IL-6 when compared with the control group in a dose-dependently manner, while pretreatment with NTP could decrease the secretion of TNF-a and IL-6. However, the antiinflammatory effect of NTP at 0.1 NU/mL was not significant different from that at 0.01 NU/mL, indicating that the effect was not dose-dependent. Therefore, we chose the concentration of 0.1 NU/mL for the following experiments. In addition, RT-PCR was also performed to measure the expression of TNF-a and IL-6 genes at mRNA level. Results demonstrated that NTP could also inhibit the LPS-induced mRNA expression of TNF-a and IL-6 (Fig. 2B, D). 3.3. Neurotropin inhibited the activation of NF-kB signaling pathway and the nuclear translocation of NF-kB p65 The activation of NF-kB signaling pathway and the nuclear translocation of NF-kB p65 are involved in the modulation of pro-inflammatory cytokines production, therefore we detected the expression levels of the phosphorylated proteins and total proteins of NF-kB signaling pathway and the nuclear translocation of p65 protein by western blotting. Results indicated that LPS would enhance the phosphorylation of IKKb, IkBa and p65, while NTP could inhibit this phenomenon (Fig. 3A, C, D, E). Furthermore, NTP cloud decrease the translocation of NF-kB p65 from cytoplasm to nuclear (Fig. 3B, F). Taken together, these findings indicated that NTP might exert its anti-inflammatory effects through the inhibition of NF-kB signaling. 3.4. Neurotropin inhibited the activation of MAPKs signaling pathway in LPS-stimulated BV-2 cells The activation of MAPKs, such as p38, ERK1/2 and JNK1/2, is known to participate in the production of pro-inflammatory cytokines in activated microglial cells. Therefore, we investigated the interventional effects of NTP on LPS-stimulated activation of MAPKs signaling pathway. As shown in Fig. 4, LPS markedly activated the MAPKs signaling pathway by strengthening the phosphorylation of p38, ERK1/2 and JNK1/2. However, the pretreatment with NTP significantly decreased the phosphorylation levels of these kinases, indicating that p38, ERK1/2 and JNK1/2 might be the targets for the anti-inflammatory effect of NTP.

Fig. 1. Cytotoxicity of NTP and LPS. Effects of NTP and LPS on cell viability in BV-2 microglial cells were measured by a CCK-8 assay. (A) Exposure to NTP ranging from 0.001 NU/mL to 1 NU/mL for 24 h showed no cytotoxicity on BV-2 cells. (B) LPS treatment for 24 h at a concentration of 100 or 1000 ng/mL did not influence cell viability of BV-2 cells. NS indicated no significant difference.

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004

4

Y. Zheng et al. / Journal of Pharmacological Sciences xxx (2018) 1e7

Fig. 2. NTP reduced the expressions of pro-inflammatory cytokines in LPS-induced BV-2 cells. Cells were challenged or not with NTP (0.01, 0.1 NU/mL) for 12 h prior to LPS treatment (100, 1000 ng/mL) for another 12 h. The expressions of cytokines at mRNA and protein levels were measured by ELISA kits and RT-PCR. Results showed that NTP could suppress the secretion of TNF-a (A) and IL-6 (C) by inhibiting the mRNA expression levels of TNF-a (B) and IL-6 (D). NS indicated no significant difference. *p < 0.05 indicated significant difference versus the control group. #p < 0.05 indicated significant difference compared to the LPS-stimulated group (1000 ng/mL).

4. Discussion Neurotropin has been widely applied for the treatment of chronic pain in Japan and China. Recently, its efficacy in modulating neurological pathologies has attracted much attention of researchers. A double-blind clinical study from De Reuck et al. found that the size of the infarct and the edema zones decreased more in neurotropin-treated group than in the placebo-treated group in acute ischemic stroke.26 Fukuda et al. demonstrated that neurotropin was able to stimulate the hippocampal brain-derived neurotrophic factor (BDNF) expression in Ts65Dn mice, a model of Down's syndrome.27 Our previous study found that neurotropin alleviated hippocampal neuron damage and amyloid-beta (Ab) burden in HT22 cell and APP/PS1 mice.20 Furthermore, Nishimoto S et al. revealed that neurotropin could attenuate peripheral nerve inflammation induced by the chronic constriction injury of the mouse sciatic nerve.23 However, there are few studies investigating the function of neurotropin in neuroinflammation in the central nervous system. Therefore, the aim of this study was to explore the potential anti-neuroinflammatory effects and the underlying mechanisms of NTP on LPS-induced BV-2 microglial cells.

The present study showed that NTP markedly decreased the production of pro-inflammatory cytokines (TNF-a and IL-6) at mRNA and protein levels, which was consistent from other studies. For example, Zhang B et al. demonstrated that neurotropin suppressed the expressions of IL-6, NOS2, CXCL1, CXCL5 and CXCL2 in hepatocytes.24 This implied that neurotropin exerted anti-inflammatory effects mainly through the inhibition of pro-inflammatory cytokines. Based on the findings above, we further explored the antiinflammatory mechanisms of NTP. There were plenty of evidence showing that NF-kB p65 and MAPKs modulated the gene expression of pro-inflammatory cytokines, such as TNF-a, IL-6 and IL-1b and so on.28,29 Tetrandrine is a major bisbenzylisoquinoline alkaloid isolated from Stephania tetrandrae S. Moore and widely used as an antirheumatic herbal drug in China. Gao L et al. revealed that tetrandrine suppressed the productions of proinflammatory factors via the inhibition of NF-kB p65.30 Another study from Kim et al. demonstrated that 5-Bromo-2-hydroxy-4methyl-benzaldehyde, a kind of simple phenolic compounds mainly extracted from plants, suppressed LPS-induced production of pro-inflammatory factors via the inactivation of ERK, p38, and NF-kB pathways in RAW 264.7 macrophages.31 Similar to the

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004

Y. Zheng et al. / Journal of Pharmacological Sciences xxx (2018) 1e7

5

Fig. 3. NTP inhibited the activation of NF-kB signaling. BV-2 cells were challenged or not with NTP (0.1 NU/mL), stimulated by LPS (100, 1000 ng/mL) and the protein levels of NF-kB signaling pathway were determined by western blotting. (A) Western blot bands of IKKb, p-IKKb, IkBa, p-IkBa, NF-kB p65, p-NF-kB p65 and GAPDH. (B) Western blot bands of NF-kB p65 in the cytoplasm and nuclear, GAPDH and histone H3. (CeE) The comparison of phosphorylation level versus total level of IKKb, IkBa and NF-kB p65 proteins. (F) The ratios of NF-kB p65 in the nuclear versus in the cytoplasm. GAPDH and histone H3 genes were considered as the internal control genes of cytoplasm and nuclear. *p < 0.05 indicated significant difference versus the control group. #p < 0.05 indicated significant difference compared to the LPS-stimulated group (1000 ng/mL).

above findings, our study revealed that NTP suppressed the nuclear translocation of NF-kB p65 by inhibiting the phosphorylation of IKKb and IkBa. Since NF-kB could highly induce proinflammatory factors by enhancing their transcription and our study demonstrated that NTP could inhibit the production of pro-inflammatory mediators and NF-kB signaling pathways, these

suggested that NF-kB signaling pathway might be involved in the regulation of the production of pro-inflammatory mediators by NTP. Furthermore, NTP decreased the phosphorylation of p38, ERK1/2 and JNK1/2 strengthened by LPS-stimulation, implying that MAPKs signaling pathway also participated in the regulation of anti-inflammation by NTP.

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004

6

Y. Zheng et al. / Journal of Pharmacological Sciences xxx (2018) 1e7

Fig. 4. NTP attenuated the LPS-activated MAPKs signaling by inhibiting the phosphorylation levels of MAPKs. Cells were pretreated for 12 h with NTP (0, 0.1 NU/mL) and then stimulated for 12 h with indicated concentration of LPS (100, 1000 ng/mL). (A) The protein levels of p38, p-p38, ERK1/2, p-ERK1/2, JNK1/2 and p-JNK1/2 were determined by western blotting and the band intensities were quantified by densitometry and normalized to b-tublin. (BeD) The comparison of phosphorylation versus total levels of p38, ERK1/2 and JNK1/2 proteins. *p < 0.05 indicated significant difference versus the control group. #p < 0.05 indicated significant difference compared to the LPS-stimulated group (1000 ng/mL).

Taken together, these finding have revealed that neurotropin exerted anti-inflammatory effects on LPS-stimulated BV-2 cells by inhibiting the expressions of pro-inflammatory cytokines regulated by MAPKs and NF-kB signaling pathways, indicating that neurotropin might be a potential choice for the treatment of neuroinflammation. Conflict of interest All authors declare that they have on conflict of interest. Acknowledgements This research was supported by grants to Jun Liu from the National Natural Science Foundation of China (No. 81372919) and Guangzhou Science Technology and Innovation Commission (No. 201604020100). References 1. Heneka MT, Carson MJ, El Khoury J, et al. Neuroinflammation in Alzheimer's disease. Lancet Neurol. 2015;14(4):388e405.

2. Tiwari PC, Pal R. The potential role of neuroinflammation and transcription factors in Parkinson disease. Dialogues Clin Neurosci. 2017;19(1):71e80. 3. Toth M, Little P, Arnberg F, et al. Acute neuroinflammation in a clinically relevant focal cortical ischemic stroke model in rat: longitudinal positron emission tomography and immunofluorescent tracking. Brain Struct Funct. 2016;221(3):1279e1290. 4. Nebel C, Aslanidis A, Rashid K, et al. Activated microglia trigger inflammasome activation and lysosomal destabilization in human RPE cells. Biochem Biophys Res Commun. 2017;484(3):681e686. 5. Torika N, Asraf K, Roasso E, et al. Angiotensin converting enzyme inhibitors ameliorate brain inflammation associated with microglial activation: possible implications for Alzheimer's Disease. J Neuroimmune Pharmacol. 2016;11(4):774e785. 6. Yang Y, Salayandia VM, Thompson JF, et al. Attenuation of acute stroke injury in rat brain by minocycline promotes blood-brain barrier remodeling and alternative microglia/macrophage activation during recovery. J Neuroinflammation. 2015;12:26. 7. Kosovrasti VY, Nechev LV, Amiji MM. Peritoneal macrophage-specific TNFalpha gene silencing in LPS-induced acute inflammation model using CD44 targeting hyaluronic acid nanoparticles. Mol Pharm. 2016;13(10):3404e3416. 8. Tianzhu Z, Shumin W. Esculin inhibits the inflammation of LPS-induced acute lung injury in mice via regulation of TLR/NF-kappaB pathways. Inflammation. 2015;38(4):1529e1536. 9. Lai JL, Liu YH, Liu C, et al. Indirubin inhibits LPS-induced inflammation via TLR4 abrogation mediated by the NF-kB and MAPK signaling pathways. Inflammation. 2017;40(1):1e12. 10. Meng Z, Yan C, Deng Q, et al. Curcumin inhibits LPS-induced inflammation in rat vascular smooth muscle cells in vitro via ROS-relative TLR4-MAPK/NFkappaB pathways. Acta Pharmacol Sin. 2013;34(7):901e911.

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004

Y. Zheng et al. / Journal of Pharmacological Sciences xxx (2018) 1e7 11. Zhang NN, Sun QS, Chen Z, et al. Homeostatic regulatory role of Pokemon in NF-kappaB signaling: stimulating both p65 and IkappaBalpha expression in human hepatocellular carcinoma cells. Mol Cell Biochem. 2013;372(1e2): 57e64. 12. Lee HJ, Shin JS, Lee WS, et al. Chikusetsusaponin IVa methyl ester isolated from the roots of Achyranthes japonica suppresses LPS-induced iNOS, TNF-alpha, IL-6, and IL-1beta expression by NF-kappaB and AP-1 inactivation. Biol Pharm Bull. 2016;39(5):657e664. 13. Zhu M, Zhou F, Li L, et al. Success with neurotropin in treating pediatric lower extremity pain induced by spinal cord injury after epidural anesthesia. J Pain Res. 2017;10:1391e1394. 14. Nasu T, Murase S, Takeda-Uchimura Y, et al. Intramuscularly injected neurotropin reduced muscular mechanical hyperalgesia induced by repeated cold stress in rats. Behav Pharmacol. 2017 Jul 31. https://doi.org/10.1097/FBP. 0000000000000313. PMID: 28763302. 15. Toda K, Tobimatsu Y. Efficacy of neurotropin in fibromyalgia: a case report. Pain Med. 2008;9(4):460e463. 16. Saito Y, Fukumura S, Saito T, et al. Effect of neurotropin on chronic headaches in childre. No To Hattatsu. 2012;44(6):477e481. 17. Masuguchi K, Watanabe H, Kawashiri T, et al. Neurotropin(R) relieves oxaliplatin-induced neuropathy via Gi protein-coupled receptors in the monoaminergic descending pain inhibitory system. Life Sci. 2014;98(1):49e54. 18. Hanakago R, Sobue I, Ugawa N. Clinical evaluation of neurotropin in the treatment of sequelae of subacute myelo-optico-neuropathy d a double-blind cross-over study. Pain. 1987;30(30). S278eS278. 19. Ning G, Zou DJ, Liu W, et al. Multicenter, randomized, positive-controlled clinical study for the effects of nerotropin on diabetic neuropathy. Zhonghua Yi Xue Za Zhi. 2004;84(21):1785e1787. 20. Fang WL, Zhao DQ, Wang F, et al. Neurotropin(R) alleviates hippocampal neuron damage through a HIF-1alpha/MAPK pathway. CNS Neurosci Ther. 2017;23(5):428e437. 21. Zhang RX, Lu ZH, Wan DS, et al. Neuroprotective effect of neurotropin on chronic oxaliplatin-induced neurotoxicity in stage II and stage III colorectal

22.

23.

24.

25.

26. 27.

28.

29.

30.

31.

7

cancer patients: results from a prospective, randomised, single-centre, pilot clinical trial. Int J Colorectal Dis. 2012;27(12):1645e1650. Yoshida T, Park JS, Yokosuka K, et al. Effect of a nonprotein bioactive agent on the reduction of cyclooxygenase-2 and tumor necrosis factor-alpha in human intervertebral disc cells in vitro. J Neurosurg Spine. 2008;9(5):411e418. Nishimoto S, Okada K, Tanaka H, et al. Neurotropin attenuates local inflammatory response and inhibits demyelination induced by chronic constriction injury of the mouse sciatic nerve. Biologicals. 2016;44(4):206e211. Zhang B, Roh YS, Liang S, et al. Neurotropin suppresses inflammatory cytokine expression and cell death through suppression of NF-kappaB and JNK in hepatocytes. PLoS One. 2014;9(12). e114071. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402e408. De Reuck J, Decoo D, Vanderdonckt P, et al. A double-blind study of neurotropin in patients with acute ischemic stroke. Acta Neurol Scand. 1994;89(5):329e335. Fukuda Y, Berry TL, Nelson M, et al. Stimulated neuronal expression of brainderived neurotrophic factor by Neurotropin. Mol Cell Neurosci. 2010;45(3): 226e233. Cao W, Hu C, Wu L, et al. Rosmarinic acid inhibits inflammation and angiogenesis of hepatocellular carcinoma by suppression of NF-kB signaling in H22 tumor-bearing mice. J Pharmacol Sci. 2016 Oct;132(2):131e137. He X, Li L, Tan H, et al. Atorvastatin attenuates contrast-induced nephropathy by modulating inflammatory responses through the regulation of JNK/p38/ Hsp27 expression. J Pharmacol Sci. 2016 May;131(1):18e27. Gao LN, Feng QS, Zhang XF, et al. Tetrandrine suppresses articular inflammatory response by inhibiting pro-inflammatory factors via NF-kappaB inactivation. J Orthop Res. 2016;34(9):1557e1568. Kim KN, Ko SC, Ye BR, et al. 5-Bromo-2-hydroxy-4-methyl-benzaldehyde inhibited LPS-induced production of pro-inflammatory mediators through the inactivation of ERK, p38, and NF-kappaB pathways in RAW 264.7 macrophages. Chem Biol Interact. 2016;258:108e114.

Please cite this article in press as: Zheng Y, et al., Neurotropin inhibits neuroinflammation via suppressing NF-kB and MAPKs signaling pathways in lipopolysaccharide-stimulated BV2 cells, Journal of Pharmacological Sciences (2018), https://doi.org/10.1016/j.jphs.2018.02.004