Neurturin and persephin promote the survival of embryonic basal forebrain cholinergic neurons in vitro

Available online at www.sciencedirect.com R

Experimental Neurology 184 (2003) 447– 455

www.elsevier.com/locate/yexnr

Neurturin and persephin promote the survival of embryonic basal forebrain cholinergic neurons in vitro Judith P. Golden,a,* Jeffrey Milbrandt,b and Eugene M. Johnson Jr.a,c a

Department of Molecular Biology and Pharmacology, Washington University School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110, USA b Department of Pathology and Immunology, Washington University School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110, USA c Department of Neurology, Washington University School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110, USA Received 27 May 2003; revised 14 July 2003; accepted 17 July 2003

Abstract The GDNF family ligands (GFLs) are a group of neurotrophic factors that influence the development, survival, and maintenance of specific populations of neurons in the central and peripheral nervous systems. The cholinergic neurons of the basal forebrain provide cholinergic innervation to cortical structures and their integrity is vital to normal cognitive function. GDNF, the original member of the GFL family promotes the survival of developing basal forebrain cholinergic neurons in vitro. We have now found that neurturin (NRTN) and persephin (PSPN) also promote the survival of basal forebrain neurons including both cholinergic neurons and a population of noncholinergic neurons with an efficacy comparable to NGF. We also demonstrate that developing and mature basal forebrain cholinergic neurons (BFCN) express GFL receptors. Ret, the signaling component of the GFL-receptor complex, is expressed in most adult rat BFCN. In addition, Ret and the GFL co-receptors GFR␣1 and GFR␣2 are expressed in developing cholinergic neurons in cultures of embryonic basal forebrain. Our results suggest that the GFLs may be effective as neuroprotective agents for BFCNs in vivo. © 2003 Elsevier Inc. All rights reserved. Keywords: GDNF; NRTN; PSPN; Ret; GFR␣; VAChT; Neuronal survival; Cell culture

Introduction The GDNF family ligands (GFLs) include four neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF) (Lin et al., 1993), neurturin (NRTN) (Kotzbauer et al., 1996), persephin (PSPN) (Milbrandt et al., 1998), and artemin (ARTN) (Baloh et al., 1998b). The principal actions of the GFLs are in the central and peripheral nervous system and in the developing kidney (Airaksinen and Saarma, 2002; Airaksinen et al., 1999; Baloh et al., 2000). The receptor for the GFLs is a complex consisting of the Ret receptor tyrosine kinase and a high-affinity ligand-binding co-receptor (Durbec et al., 1996; Treanor et al., 1996; Trupp et al., 1996). Four co-receptors have been identified, GDNF family receptor ␣1– 4 (GFR␣1– 4) (Baloh et al., 1998a;

* Corresponding author. 4566 Scott Avenue, CB 8103, St. Louis, MO 63110-1031, USA. Fax: ⫹1-314-747-1772. E-mail address: [email protected] (J.P. Golden). 0014-4886/$ – see front matter © 2003 Elsevier Inc. All rights reserved. doi:10.1016/j.expneurol.2003.07.999

Baloh et al., 1997; Jing et al., 1996; Jing et al., 1997; Klein et al., 1997; Lindahl et al., 2001; Lindahl et al., 2000; Suvanto et al., 1997; Treanor et al., 1996). Each GFL has a preferred co-receptor to which it binds with highest affinity: GFR␣1/GDNF, GFR␣2/NRTN, GFR␣3/ARTN, and GFR␣4/PSPN. Gene deletion studies confirm the physiological pairing of receptors and ligands in vivo (Cacalano et al., 1998; Enomoto et al., 1998; Heuckeroth et al., 1999; Honma et al., 2002; Moore et al., 1996; Pichel et al., 1996; Rossi et al., 1999). In addition, in vitro experiments demonstrate low-affinity cross-reactivity, such that GDNF also binds to GFR␣2 (Baloh et al., 1997; Creedon et al., 1997) and NRTN and ARTN bind to GFR␣1 (Baloh et al., 1997; Baloh et al., 1998b; Creedon et al., 1997). The GFLs and their receptor components are expressed in the central and peripheral nervous systems and in the urogenital system (Golden et al., 1998; Golden et al., 1999; Nosrat et al., 1997; Trupp et al., 1997; Widenfalk et al., 1997; Yu et al., 1998). Experiments employing injury par-

448

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

adigms in vivo as well as cell-culture studies show that the GFLs can influence the survival of several populations of PNS and CNS neurons including sympathetic neurons, sensory neurons, motor neurons, basal forebrain cholinergic neurons (BFCN), and midbrain dopaminergic neurons (Airaksinen and Saarma, 2002; Baloh et al., 2000; Saarma and Sariola, 1999). Analysis of GFL and GFL-receptor knockout animals reveals that GFL proteins have an essential role in the development/maintenance of PNS and CNS neuronal populations including sensory, autonomic, enteric, and spinal and trigeminal motor neurons (Cacalano et al., 1998; Enomoto et al., 1998; Enomoto et al., 2000; Heuckeroth et al., 1999; Honma et al., 2002; Moore et al., 1996; Rossi et al., 1999). The cholinergic neurons of the basal forebrain provide the principal cholinergic innervation to the neocortex and hippocampus; loss of this cholinergic innervation is associated with the cognitive decline observed in normal aging and in disease (Coyle et al., 1983; Fischer et al., 1992; Fischer et al., 1989; Mesulam et al., 1983a; Mesulam et al., 1983b). Although numerous reports demonstrate that nerve growth factor (NGF) influences the development, survival, and recovery after injury of BFCNs (Hartikka and Hefti, 1988; Hefti, 1986, 1994), the extent to which BFCNs require NGF in vivo is unclear (Crowley et al., 1994). While other neurotrophic factors influence BFCN survival, no one factor is found to be required to support the survival of BFCNs in vivo suggesting that these neurons may be responsive to multiple factors for survival, development, and maintenance (Alderson et al., 1990; Anderson et al., 1988; Kanda et al., 2000; Knusel et al., 1992). GFL receptors are expressed in the areas of the forebrain where cholinergic neurons are located and the GFLs are expressed in the principal targets of cholinergic forebrain neurons including neocortex and hippocampus (Araujo et al., 1997; Golden et al., 1998; Golden et al., 1999; Trupp et al., 1997; Widenfalk et al., 1997; Yu et al., 1998). This expression pattern of GFLs and their receptors suggests that these factors could serve as target-derived trophic factors for BFCNs. GDNF is involved in the development and survival of cholinergic neurons of the basal forebrain. GDNF supports the survival of BFCNs in vitro (Ha et al., 1996) and in vivo studies show that GDNF protects BFCNs in the medial septal nucleus (MS) and the nucleus of the vertical limb of the diagonal band (VDB) from axotomy-induced degeneration (Williams et al., 1996). In addition, mice heterozygous for GDNFgene deletion exhibit impaired function in the Morris water maze (Gerlai et al., 2001), a phenotype that could potentially be caused by functional cholinergic deficits. In the present study, we examined GFL family members, NRTN and PSPN, in an in vitro assay for cholinergic neuronal survival. We found that both these proteins support the survival of BFCNs in cultures prepared from embryonic rat brain with an efficacy comparable to NGF. We also report that GFL receptors are co-localized with the cholinergic

marker, vesicular acetylcholine transporter (VAChT), in developing and mature BFCNs.

Materials and methods All reagents, unless otherwise stated were purchased from Sigma (St. Louis, MO, USA). Animal use and procedures were approved under the Animal Studies Committee of Washington University. Basal forebrain primary cultures The basal forebrain (BF) was dissected from embryonicday-16 (E16) rats and placed in cold L-15 medium with 6 mg/ml of glucose. The area of the BF was dissected by placing the brain on its dorsal surface and excising a column of tissue between the hypothalamus and the anterior border of the olfactory tubercle. The lateral border of the excised tissue was just beyond the anterior horn of the lateral ventricles. The excised BF was treated with trypsin for 10 min at room temperature, followed by trituration in 0.5% BSA in Hank’s balanced salt solution (HBSS) containing DNAse I (43 U/ml). The cell suspension was layered on a solution of 4% BSA in HBSS and centrifuged at 800 ⫻ g for 10 min. The cell pellet was resuspended in serum-free N2 medium [DMEM/F12 (1:1) containing 6 mg/ml glucose, 1 mg/ml of bovine serum albumin, 100 U/ml penicillin, 100 ␮g/ml streptomycin, and N-2 supplement (Bottenstein and Sato, 1979)]. Cells were plated on lysine- and laminin-coated 8-well chamber slides at a low density [30,000 cells per well (0.81 cm2)]. To obtain optimum survival of the BF neurons, the N2 medium was supplemented with 2.5 ␮g/ml superoxide dismutase, 2.5 ␮g/ml catalase, 0.1 ␮g/ml biotin, 1 ␮g/ml ␣-tocopherol acetate, and 1 ␮g/ml ␣-tocopherol (Brewer and Cotman, 1989). At plating, growth factors were included in the medium at a concentration of 30 –50 ng/ml for NRTN, GDNF, and PSPN and 50 ng/ml for NGF. NGF (Harlan Bioproducts, Indianapolis, IN, USA) was purified from mouse salivary glands, NRTN, GDNF, and PSPN were obtained from Genentech. Cells plated in the same medium without added trophic factors served as controls. These cultures contained predominantly neurons but also included glial cells. Cells were maintained in culture for 17 days. Every 2 days the cultures were supplemented with a volume of fresh N2 medium (containing the relevant growth factor) equal to 1/6 of the culture volume. Cells were fixed with 4% paraformaldehyde and stained with antibodies to microtubuleassociated protein-2 (MAP-2), VAChT, or GFL receptors. In one experiment, maintained for 31 days, cell survival was similar to that seen at 17 days; therefore, the 31-day experiment was included in the data analysis.

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

449

Immunohistochemistry Cell cultures were fixed in a solution of cold 4% paraformaldehyde in phosphate buffered saline (PBS, pH 7.4) for 30 min at room temperature. Slides were rinsed several times in PBS prior to incubation with antibodies. MAP-2 and VAChT labeling for quantitative experiments For quantitative experiments, slides were treated with primary antibody diluted in phosphate buffer containing 0.3% triton-X100 (PBX) overnight at room temperature. For total neuronal counts, neurons were labeled with antiMap-2 monoclonal antibody (Chemicon, Temecula, CA, USA) at a dilution of 1:200. Cholinergic neurons were labeled with VAChT antibody (Phoenix Pharmaceuticals, Belmont, CA, USA) at a dilution of 1:10,000. The total number of labeled cells was counted in each well. For total cell counts, MAP-2-labeled neurons were counted in 9 –10 independent experiments, with 2– 8 separate observations per experiment. Each observation was a single well of an 8-well chamber slide. For cholinergic cell counts, VAChT-positive neurons were counted in 5 independent experiments with 2–7 separate observations per experiment. The observations for each experiment were averaged to obtain a single data point, so that each N represents an independent experiment, not an observation within an independent experiment. Statistical significance was determined by using ANOVA; post-hoc analysis was performed with a paired student t-test.

Fig. 1. The affects of GFLs and NGF on total neuronal survival in cultures of embryonic BF, as determined by counting anti-MAP-2-labeled neurons. N ⫽ 10 for each condition, except NGF (N ⫽ 9) (see Materials and methods); error bars are S.E.M. *significantly different from control (p ⬍ 0.01).

RT-PCR cDNA produced by reverse transcription of mRNA isolated from BF cultures was used as template for PCR with the following primers—forward: 5⬘AAGCTGTCAAAGGCTTGTATGGC3⬘ and reverse: 5⬘GTGGTCACCCCCAACTACCTGGA3⬘ for rat GFR␣4. A product of the expected size of 157 nucleotides was produced. PCR with a sample of the mRNA that served as template in the reverse transcription reaction produced no product.

Results VAChT- and GFL receptor-double labeling Paraformaldehyde-fixed BF cultures were double-labeled with anti-VAChT (1:3000) in combination with antiRet, anti-GFR␣1, or anti-GFR␣2 (1:20; R and D Systems, Minneapolis, MN, USA). Adult female rats were anesthetized with an overdose of xylazine (20 mg/ml): ketamine (100 mg/ml): acepromazine (10 mg/ml) (3:3:1), then perfused with 0.5% procaine hydrochloride followed by ice-cold 4% paraformaldehyde in PBS. Brains were removed, post-fixed overnight in 4% paraformaldehyde, cryo-protected in 30% sucrose, and cut in 40-␮m coronal sections. Free-floating brain sections were double labeled for VAChT and Ret. Staining for each antibody was determined to be specific by comparison of labeling obtained with primary antibody to sections that excluded primary antibody. In addition, the cultures, labeled for VAChT and GFL receptors, were also stained with bis benzimide. Bis benzimide staining revealed numerous unlabeled cells adjacent to VAChT- and GFLreceptor-labeled cells. The specificity of the Ret and GFR␣1 antibodies was also confirmed by immunohistochemistry in the appropriate knockout mice (data not shown).

GDNF, NRTN, PSPN, and NGF support the survival of embryonic basal forebrain neurons in vitro The observation that GFL-receptor components are expressed in the developing BF (Golden et al., 1999; Nosrat et al., 1997; Widenfalk et al., 1997; Yu et al., 1998) suggested that the GFLs may influence the survival of developing BF neurons. The ability of NRTN and PSPN to promote the survival of developing BF neurons was evaluated by counting the number of surviving anti-MAP-2-labeled neurons in cultures of E16-rat BF. Some cultures were treated with NGF to compare the survival-promoting effects of the GFLs and NGF. The effects of the GFLs or NGF on cholinergic neuronal survival were determined by counting the number of anti-VAChT-labeled neurons. Cultures labeled with anti-MAP-2 contained many neurons with clearly stained cell bodies and neurites. The total number (Mean ⫾ S.E.M.) of neurons, as measured by counting MAP-2-positive cells, was 79 ⫾ 24 in control cultures, 551 ⫾ 98 in NRTN-treated cultures, 599 ⫾ 139 in PSPN-treated cultures, and 533 ⫾ 86 in NGF-treated cultures (Fig. 1). The total number of neurons in cultures treated with NRTN, PSPN, or NGF was significantly greater

450

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

Fig. 2. The affects of GFLs and NGF on cholinergic neuronal survival in cultures of embryonic BF, as determined by counting anti-VAChT-labeled neurons. N ⫽ 5 for each condition (see Materials and methods); error bars are S.E.M. *significantly different from control (p ⬍ 0.05).

than that of control cultures. Cultures treated with NGF, NRTN, or PSPN had comparable numbers of neurons. These results indicate that NRTN and PSPN promote the survival of a population of developing basal forebrain neurons with an efficacy similar to NGF. To determine whether the population of NRTN- and PSPN-dependent BF neurons included cholinergic neurons, the number of neurons labeled with the cholinergic neuronspecific marker, VAChT, were counted in cultures treated with NRTN or PSPN. The number of VAChT-positive neurons (Mean ⫾ S.E.M) was 107 ⫾ 25 in NRTN-treated cultures, 127 ⫾ 39 in PSPN-treated cultures, and 161 ⫾ 39 in NGF-treated cultures (Fig. 2). In control cultures, very few VAChT-positive neurons were observed (5 ⫾ 2). The total number of VAChT-positive neurons in cultures treated with NRTN, PSPN, or NGF was significantly greater than the number of VAChT-positive neurons in control cultures. The numbers of VAChT-positive neurons in cultures treated with NRTN, PSPN, or NGF were not significantly different. These results indicate that NRTN and PSPN promoted the survival of BFCNs with an efficacy similar to NGF and suggest that NRTN and PSPN might influence the development or survival of BFCNs in vivo. Since the mean number of surviving cholinergic neurons (as determined by counts of VAChT-positive neurons) is about 20% of the total number of surviving neurons (as determined by counts of MAP-2-positive neurons), the affects of NRTN, PSPN, and NGF are not specific to cholinergic neurons. Thus, these factors also appear to promote the survival of a population of non-cholinergic BF neurons under these conditions. In addition to influencing the survival of developing cholinergic neurons in vitro, NRTN and PSPN maintained the cholinergic phenotype of BFCNs in culture. The VAChT-labeled neurons in cultures treated with NGF, NRTN, or PSPN were typically large and densely labeled (Figs. 3B–D). The neurons in the treated cultures usually had many neurites, including branching networks of VAChT-positive, fine-caliber neurites, although some smaller neurons with few processes were observed. In contrast, the few VAChT-positive cells in the control cultures

were typically smaller and faintly labeled with only a few short neurites (Fig. 3A). This result suggests that in addition to promoting BFCN survival, NRTN and PSPN might also have a role in the maintenance of the cholinergic phenotype as BF neurons mature. This may be an important characteristic of the potential function of these factors in vivo since atrophy of BFCNs and loss of cholinergic markers are correlated with age and disease-related decline in cognitive function (Fischer et al., 1992; Fischer et al., 1989; Perry et al., 1978). A single experiment was performed to verify the reported effects of GDNF on BFCNs in vitro (Ha et al., 1996) and to allow a comparison of the action of GDNF with NRTN, PSPN, and NGF. In this experiment, four independent observations revealed 7 ⫾ 2 (Mean ⫾ S.E.M.) VAChT-positive neurons in control cultures and 64 ⫾ 23 VAChT-positive neurons in GDNF-treated cultures. Counts of MAP-2-positive neurons in GDNF-treated cultures determined that cholinergic neurons were a subpopulation of BF neurons whose survival was influenced by GDNF. Three independent observations in a single experiment showed a 5-fold increase in the number of MAP-2-positive cells in GDNF-treated cultures (321 ⫾ 77) compared to control cultures (63 ⫾ 50). These results are similar to those obtained in multiple experiments with NRTN and PSPN. GFL receptors are expressed in neurons of dissociated embryonic BF In vivo, all GFL-responsive neuronal populations express Ret and at least one of the GFR␣ co-receptors. Therefore, the expression of Ret and GFR␣ co-receptor was examined in BF cultures to determine whether the BF neu-

Fig. 3. VAChT-labeled neurons in embryonic BF cultures treated with NGF (B), PSPN (C), NRTN (D), or medium with no added trophic factor (A). In cultures treated with NGF, PSPN, or NRTN (B–D), VAChTlabeled neurons are typically larger, more intensely stained, and have more extensive neurites (arrows) than VAChT-positive neurons in control cultures (A).

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

rons responsive to NRTN and PSPN in vitro expressed Ret and GFR␣ co-receptors. By immunohistochemistry, neurons in BF cultures expressed Ret at a low level (Fig. 4). The Ret expression observed in neurons in BF cultures was significantly weaker than Ret expression observed in peripheral neurons in vitro (data not shown). In addition to Ret, the preferred co-receptors for GDNF (GFR␣1) and NRTN (GFR␣2) were expressed in BF neurons in culture (Fig. 4). Because GFR␣4 antibody is not available, GFR␣4 expression in BF cultures was determined by RT-PCR (data not shown). Since a subpopulation of the neurons surviving in NRTN- or PSPN-treated cultures were cholinergic neurons, Ret and GFR␣ co-receptor expression in VAChT-positive neurons was examined (Fig. 4). Expression of GFR␣1 and GFR␣2 and low levels of Ret were detected in most VAChT-positive neurons; this is consistent with the survival data that shows that GFLs promoted the survival of cholinergic neurons in vitro. However, in the non-cholinergic population, Ret or GFR␣2 expression was detected in only a small subpopulation of NRTN- and PSPN-responsive neurons. GFR␣1 expression was detected in most noncholinergic neurons. Ret is expressed in cholinergic neurons of the adult rat BF The survival-promoting activities of NRTN and PSPN on BFCNs in vitro suggest that these factors might influence cholinergic neurons in vivo. Since BFCNs in the adult brain are vulnerable to both normal aging and disease, the action of NRTN and PSPN in the mature brain is of particular interest. The three principal groups of cholinergic neurons in the BF are located in the MS, the nuclei of the diagonal band (DB), and the nucleus basalis of Meynert (NBM). GDNF protects cholinergic neurons in the MS and in the nucleus of the VDB from degeneration after axotomy (Williams et al., 1996). The effects of the GFLs on cholinergic neurons in the NBM and horizontal limb of the diagonal band (HDB) have not been determined. The expression of Ret, the signaling component of the GFL receptor, was examined in the mature brain to assess the potential activity of the GFLs upon BFCNs in all three cholinergic nuclei. Although Ret expression is documented in areas of the BF where cholinergic neurons are located, Ret has not been specifically co-localized with cholinergic markers in basal forebrain neurons (Golden et al., 1998; Trupp et al., 1997). Ret expression was specifically characterized in cholinergic neurons of the adult rat. Ret was co-localized with VAChT in neurons in the MS, the HDB and VDB, and the NBM (Fig. 5). These results suggest that the GFLs may influence the survival and/or maintenance of mature BFCNs in all three cholinergic basal forebrain nuclei in vivo. All three nuclei also contained Ret-positive neurons, which were VAChT negative, suggesting that the GFLs may affect a population of non-cholinergic neurons. In all

451

three nuclei, many large and small caliber neurites were also Ret positive. In general, Ret expression was most intense in neurons of the NBM and the DB nuclei and weakest in the neurons of the MS (Fig. 5).

Discussion We have shown that the GFL neurotrophic factors, NRTN and PSPN, promoted the survival of BF neurons including both cholinergic and non-cholinergic populations in embryonic BF cultures with an efficacy similar to NGF. In addition, we demonstrate that Ret, the signaling component of the GFL receptor, was expressed in cholinergic neurons of the BF in adult rats and that Ret and the GFL co-receptors, GFR␣1 and GFR␣2, were expressed in developing BFCN in vitro. Both NRTN and PSPN promoted the survival of embryonic BFCNs in vitro. Since cholinergic neurons in BF cultures expressed Ret, in addition to GFR␣1 and GFR␣2, the action of NRTN could be mediated by either the Ret/ GFR␣1 or Ret/GFR␣2 receptor complexes. GFR␣4, the preferred co-receptor for PSPN, was also expressed in BF cultures. The action of PSPN on BFCNs in vitro was likely mediated via the GFR␣4/Ret receptor complex, since PSPN binds with high affinity exclusively to GFR␣4 (Enokido et al., 1998). Although the expression of GFR␣2 in cholinergic forebrain neurons has not been reported previously, GFR␣1 expression has recently been studied in BFCNs of the adult rat brain (Sarabi et al., 2003). In that study, GFR␣1 expression is detected only in a small subpopulation of cholinergic neurons of the BF. In the present study, lowlevel expression of GFR␣1 was observed in the majority of developing BFCNs in culture. The results of the present study of developing BFCNs in vitro and the recent study in adult brain suggest that GFR␣1 expression in cholinergic neurons is developmentally regulated. It is also possible that GFR␣1 expression is induced in cholinergic neurons in vitro. The results of the present study indicate that in addition to cholinergic neurons, GDNF, NRTN, and PSPN promoted the survival of a population of non-cholinergic neurons in vitro. A previous report examining the effect of GDNF on septal transplants in oculo demonstrates that non-cholinergic BF neurons are sensitive to GDNF (Price et al., 1996). When grafts of embryonic septum are implanted into the anterior eye chamber, GDNF treatment results in an increase in the size of the graft and in the number of GABAergic neurons in the graft. This result suggests that the population of non-cholinergic GFL-sensitive neurons in BF cultures may include GABAergic neurons. GFL receptor components were expressed at low levels in cholinergic neurons in BF cultures. Ret, the signaling component of the GFL receptor, was not expressed at a detectable level in all the surviving non-cholinergic neurons in cultures treated with GFLs. It is likely that Ret is ex-

452

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

Fig. 4. Expression of GFL receptors GFR␣1 (E, H), GFR␣2 (F, I), and Ret (D, G) and VAChT (A–C, G–I) in dissociated BF neurons. A, D, and G—Ret is expressed in the cell body of a VAChT-positive neuron. B, E, and H—GFR␣1 is expressed in most neurons including many VAChT-negative neurons. VAChT-positive neurites (arrows) are frequently observed surrounding GFR␣1-positive cell bodies. C, F, I—GFR␣2 expression in the cell body and proximal neurites of a VAChT-positive neuron.

pressed at a low level that is not detectable in these neurons. However, the possibility that survival of neurons with undetectable Ret expression was mediated by GFLs indirectly via Ret-expressing neurons or glial cells cannot be excluded. The possibility that NRTN and PSPN signaled through GFR␣1 independently of Ret, as reported with GDNF under certain conditions (Poteryaev et al., 1999; Trupp et al., 1999), also cannot be excluded. Since most of the neurons in BF cultures expressed GFR␣1, a similar mechanism conceivably occurred under the conditions used here. The actions of the GFLs in vitro suggest that these proteins may influence the survival or maintenance of BFCNs in vivo. A number of previous studies demonstrate that Ret mRNA is expressed in regions of the developing and mature BF where cholinergic neurons are located (Araujo et al., 1997; Golden et al., 1998; Golden et al., 1999; Nosrat et al., 1997; Trupp et al., 1997; Widenfalk et al., 1997; Yu et al., 1998). These studies do not address co-localization of Ret with cholinergic markers. In the present study, Ret was

co-localized with the cholinergic marker, VAChT, in neurons in all three BF cholinergic nuclei. Although GDNF prevents the degeneration of axotomized cholinergic neurons in the MS and in the VDB, the actions of the GFLs upon cholinergic neurons in NBM and the more caudal regions of the DB have not been tested. The results showing Ret co-localization with VAChT in all three BF cholinergic nuclei suggest that the GFLs might influence the maintenance and/or survival of cholinergic neurons in NBM and the HDB also. Previous reports indicate that NGF-mediated effects on embryonic BFCNs in vitro are dependent upon multiple factors including cell density, medium formulation, presence or absence of serum in the culture medium, co-culture with glia, and the number of days in vitro (Hartikka and Hefti, 1988; Hefti et al., 1985; Pongrac and Rylett, 1998). The results of the present study are in agreement with previous studies, which report an increase in cholinergic neuronal survival in response to NGF in low-density BF cultures (Hartikka and Hefti, 1988). The magnitude of sur-

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

Fig. 5. Coronal sections showing co-expression of Ret (A–C) and the cholinergic marker VAChT (D–F) in the adult rat BF. Ret is expressed in VAChT-positive neurons in the diagonal band (A, D, G), the medial septal nucleus (B, E, H) and the basal nucleus of Meynert (C, F, I). Ret labeling is most intense in the diagonal band (A) and in the basal nucleus of Meynert (C) and weaker in the medial septal nucleus (B). Arrows—Retpositive, VAChT-negative neurons and neurites.

vival observed with NGF here appeared to be significantly greater than that observed previously (Ha et al., 1996; Hartikka and Hefti, 1988). The principal difference between the experimental conditions used in the present study and the conditions used in previous studies was that the current study used serum-free medium and lower cell densities. These conditions were more stringent than those previously employed and required the addition of anti-oxidants to the medium (Brewer and Cotman, 1989) to obtain reliable neuronal survival. The greater magnitude of survival observed here was partly a reflection of the very low numbers of cholinergic neurons in the control serum-free cultures in these experiments. The increased survival observed in the present study may also result from a synergistic action of anti-oxidants and trophic factors. Previous work showing that the anti-oxidant, N-Acetyl-L-cysteine, enhances survival of neurons in the presence of sub-optimal concentrations of trophic factors (Mayer and Noble, 1994) suggests this possibility. In addition to cholinergic neurons, NGF also promoted the survival of a population of non-cholinergic neurons in the present study. The effects of NGF on basal forebrain neurons in vitro are somewhat controversial. Some reports indicate that NGF does not affect the survival of noncholinergic basal forebrain neurons in vitro (Downen et al., 1993; Knusel et al., 1990; Takei et al., 1997; Takei et al., 2000). However, all of these studies use culture conditions that are significantly different from those used in this study. These studies use serum, high densities of neurons and/or brief survival periods. We also did not see factor-dependent (even NGF) differences in survival in high-density or shortterm cultures (data not shown). Grothe et al. (1989) report that NGF does promote the survival of non-cholinergic basal forebrain neurons in vitro. In addition, Dreyfus et al.

453

(1989) report that both cholinergic and GABAergic BF neurons express high-affinity NGF binding sites in vitro, suggesting that both cholinergic and non-cholinergic BF neurons are sensitive to NGF. Therefore, our results are consistent with some of the previously published studies but not with all. As stated above, we believe the conflicting results are a reflection of the many variables in culture conditions. The effects of NGF and the GFLs on many of the MAP-2positive cells, under the conditions used in this study, may well be indirect. We suggest this partly because many more MAP-2-positive cells survived than Ret-positive cells. Also, we are struck by the ability of the GFLs and NGF to maintain survival of virtually identical numbers of VAChTpositive and MAP-2-positive cells. This suggests that under these long-term, serum-free culture conditions, the direct action of NGF and the GFLs on cholinergic neurons indirectly allows for the maintenance of a population of noncholinergic neurons. Prior studies have shown that GDNF is a survival-promoting and neuroprotective factor for BFCNs (Ha et al., 1996; Williams et al., 1996). These studies suggest that GDNF could prevent the degeneration of BFCNs seen in normal aging and in disease. Our initial examination of the actions of NRTN and PSPN on developing BFCNs suggests that other GFLs share this function. The observation that multiple GFLs promote cholinergic neuronal survival in vitro warrants further study of these proteins for potential neuroprotective or phenotype-enhancing actions on BFCNs.

Acknowledgments This work was supported by National Institute of Health Grants RO1 AG13729 and AG13730. We thank Patricia Osborne for expert technical assistance and for assistance in the preparation of the manuscript and Joseph DeMaro for assistance with statistical analysis and preparation of figures. We thank Dr. Mario Encinas and Dr. Sanjay Jain for critical reading of the manuscript and the members of the Johnson and Milbrandt laboratories for helpful advice and discussion.

References Airaksinen, M.S., Saarma, M., 2002. The GDNF family: signalling, biological functions and therapeutic value. Nat. Rev. Neurosci. 3, 383– 394. Airaksinen, M.S., Titievsky, A., Saarma, M., 1999. GDNF family neurotrophic factor signaling: four masters, one servant? Mol. Cell. Neurosci. 13, 313–325. Alderson, R.F., Alterman, A.L., Barde, Y.A., Lindsay, R.M., 1990. Brainderived neurotrophic factor increases survival and differentiated functions of rat septal cholinergic neurons in culture. Neuron 5, 297–306. Anderson, K.J., Dam, D., Lee, S., Cotman, C.W., 1988. Basic fibroblast growth factor prevents death of lesioned cholinergic neurons in vivo. Nature 332, 360 –361.

454

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455

Araujo, D.M., Hilt, D.C., Miller, P.J., Wen, D., Jiao, S., Lapchak, P.A., 1997. Ret receptor tyrosine kinase immunoreactivity is altered in glial cell line-derived neurotrophic factor-responsive neurons following lesions of the nigrostriatal and septohippocampal pathways. Neuroscience 80, 9 –16. Baloh, R.H., Enomoto, H., Johnson Jr., E.M., Milbrandt, J., 2000. The GDNF family ligands and receptors—implications for neural development. Curr. Opin. Neurobiol. 10, 103–110. Baloh, R.H., Gorodinsky, A., Golden, J.P., Tansey, M.G., Keck, C.L., Popescu, N.C., Johnson Jr., E.M., Milbrandt, J., 1998a. GFR␣3 is an orphan member of the GDNF/neurturin/persephin receptor family. Proc. Natl. Acad. Sci. USA 95, 5801–5806. Baloh, R.H., Tansey, M.G., Golden, J.P., Creedon, D.J., Heuckeroth, R.O., Keck, C.L., Zimonjic, D.B., Popescu, N.C., Johnson Jr., E.M., Milbrandt, J., 1997. TrnR2, a novel receptor that mediates neurturin and GDNF signaling through Ret. Neuron 18, 793– 802. Baloh, R.H., Tansey, M.G., Lampe, P.A., Fahrner, T.J., Enomoto, H., Simburger, K.S., Leitner, M.L., Araki, T., Johnson Jr., E.M., Milbrandt, J., 1998b. Artemin, a novel member of the GDNF ligand family, supports peripheral and central neurons and signals through the GFR␣3-RET receptor complex. Neuron 21, 1291–1302. Bottenstein, J.E., Sato, G.H., 1979. Growth of a rat neuroblastoma cell line in serum-free supplemented medium. Proc. Natl. Acad. Sci. USA 76, 514 –517. Brewer, G.J., Cotman, C.W., 1989. Survival and growth of hippocampal neurons in defined medium at low density: advantages of a sandwich culture technique or low oxygen. Brain Res. 494, 65–74. Cacalano, G., Farinas, I., Wang, L.C., Hagler, K., Forgie, A., Moore, M., Armanini, M., Phillips, H., Ryan, A.M., Reichardt, L.F., Hynes, M., Davies, A., Rosenthal, A., 1998. GFR␣1 is an essential receptor component for GDNF in the developing nervous system and kidney. Neuron 21, 53– 62. Coyle, J.T., Price, D.L., Delong, M.R., 1983. Alzheimer’s disease: a disorder of cortical cholinergic innervation. Science 219, 1184 –1190. Creedon, D.J., Tansey, M.G., Baloh, R.H., Osborne, P.A., Lampe, P.A., Fahrner, T.J., Heuckeroth, R.O., Milbrandt, J., Johnson Jr., E.M., 1997. Neurturin shares receptors and signal transduction pathways with glial cell line-derived neurotrophic factor in sympathetic neurons. Proc. Natl. Acad. Sci. USA 94, 7018 –7023. Crowley, C., Spencer, S.D., Nishimura, M.C., Chen, K.S., Pitts-Meek, S., Armanini, M.P., Ling, L.H., Macmahon, S.B., Shelton, D.L., Levinson, A.D., 1994. Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons. Cell 76, 1001–1011. Downen, M., Mudd, L., Roback, J.D., Palfrey, H.C., Wainer, B.H., 1993. Early nerve growth factor-induced events in developing rat septal neurons. Brain Res. Dev. Brain Res. 74, 1–13. Dreyfus, C.F., Bernd, P., Martinez, H.J., Rubin, S.J., Black, I.B., 1989. GABAergic and cholinergic neurons exhibit high-affinity nerve growth factor binding in rat basal forebrain. Exp. Neurol. 104, 181–185. Durbec, P., Marcos-Gutierrez, C.V., Kilkenny, C., Grigoriou, M., Wartiowaara, K., Suvanto, P., Smith, D., Ponder, B., Costantini, F., Saarma, M., 1996. GDNF signalling through the Ret receptor tyrosine kinase [comment]. Nature 381, 789 –793. Enokido, Y., De Sauvage, F., Hongo, J.A., Ninkina, N., Rosenthal, A., Buchman, V.L., Davies, A.M., 1998. GFR ␣-4 and the tyrosine kinase Ret form a functional receptor complex for persephin. Curr. Biol. 8, 1019 –1022. Enomoto, H., Araki, T., Jackman, A., Heuckeroth, R.O., Snider, W.D., Johnson Jr., E.M., Milbrandt, J., 1998. GFR ␣1-deficient mice have deficits in the enteric nervous system and kidneys. Neuron 21, 317– 324. Enomoto, H., Heuckeroth, R.O., Golden, J.P., Johnson, E.M., Milbrandt, J., 2000. Development of cranial parasympathetic ganglia requires sequential actions of GDNF and neurturin. Development 127, 4877– 4889.

Fischer, W., Chen, K.S., Gage, F.H., Bjorklund, A., 1992. Progressive decline in spatial learning and integrity of forebrain cholinergic neurons in rats during aging. Neurobiol. Aging 13, 9 –23. Fischer, W., Gage, F.H., Bjorklund, A., 1989. Degenerative changes in forebrain cholinergic nuclei correlate with cognitive impairments in aged rats. Eur. J. Neurosci. 1, 34 – 45. Gerlai, R., Mcnamara, A., Choi-Lundberg, D.L., Armanini, M., Ross, J., Powell-Braxton, L., Phillips, H.S., 2001. Impaired water maze learning performance without altered dopaminergic function in mice heterozygous for the GDNF mutation. Eur. J. Neurosci. 14, 1153–1163. Golden, J.P., Baloh, R.H., Kotzbauer, P.T., Lampe, P.A., Osborne, P.A., Milbrandt, J., Johnson Jr., E.M., 1998. Expression of neurturin, GDNF, and their receptors in the adult mouse CNS. J. Comp. Neurol. 398, 139 –150. Golden, J.P., DeMaro, J.A., Osborne, P.A., Milbrandt, J., Johnson Jr., E.M., 1999. Expression of neurturin, GDNF, and GDNF family-receptor mRNA in the developing and mature mouse. Exp. Neurol. 158, 504 –528. Grothe, C., Otto, D., Unsicker, K., 1989. Basic fibroblast growth factor promotes in vitro survival and cholinergic development of rat septal neurons: comparison with the effects of nerve growth factor. Neuroscience 31, 649 – 661. Ha, D.H., Robertson, R.T., Ribak, C.E., Weiss, J.H., 1996. Cultured basal forebrain cholinergic neurons in contact with cortical cells display synapses, enhanced morphological features, and decreased dependence on nerve growth factor. J. Comp. Neurol. 373, 451– 465. Hartikka, J., Hefti, F., 1988. Development of septal cholinergic neurons in culture: plating density and glial cells modulate effects of NGF on survival, fiber growth, and expression of transmitter-specific enzymes. J. Neurosci. 8, 2967–2985. Hefti, F., 1986. Nerve growth factor promotes survival of septal cholinergic neurons after fimbrial transections. J. Neurosci. 6, 2155–2162. Hefti, F., 1994. Development of effective therapy for Alzheimer’s disease based on neurotrophic factors. Neurobiol. Aging 15 (Suppl 2), S193– 194. Hefti, F., Hartikka, J., Eckenstein, F., Gnahn, H., Heumann, R., Schwab, M., 1985. Nerve growth factor increases choline acetyltransferase but not survival or fiber outgrowth of cultured fetal septal cholinergic neurons. Neuroscience 14, 55– 68. Heuckeroth, R.O., Enomoto, H., Grider, J.R., Golden, J.P., Hanke, J.A., Jackman, A., Molliver, D.C., Bardgett, M.E., Snider, W.D., Johnson Jr., E.M., Milbrandt, J., 1999. Gene targeting reveals a critical role for neurturin in the development and maintenance of enteric, sensory, and parasympathetic neurons [comment]. Neuron 22, 253–263. Honma, Y., Araki, T., Gianino, S., Bruce, A., Heuckeroth, R., Johnson, E., Milbrandt, J., 2002. Artemin is a vascular-derived neurotropic factor for developing sympathetic neurons. Neuron 35, 267–282. Jing, S., Wen, D., Yu, Y., Holst, P.L., Luo, Y., Fang, M., Tamir, R., Antonio, L., Hu, Z., Cupples, R., Louis, J.C., Hu, S., Altrock, B.W., Fox, G.M., 1996. GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-␣, a novel receptor for GDNF. Cell 85, 1113–1124. Jing, S., Yu, Y., Fang, M., Hu, Z., Holst, P.L., Boone, T., Delaney, J., Schultz, H., Zhou, R., Fox, G.M., 1997. GFR␣-2 and GFR␣-3 are two new receptors for ligands of the GDNF family. J. Biol. Chem. 272, 33111–33117. Kanda, T., Iwasaki, T., Nakamura, S., Kurokawa, T., Ikeda, K., Mizusawa, H., 2000. Self-secretion of fibroblast growth factor-9 supports basal forebrain cholinergic neurons in an autocrine/paracrine manner. Brain Res. 876, 22–30. Klein, R.D., Sherman, D., Ho, W.H., Stone, D., Bennett, G.L., Moffat, B., Vandlen, R., Simmons, L., Gu, Q., Hongo, J.A., Devaux, B., Poulsen, K., Armanini, M., Nozaki, C., Asai, N., Goddard, A., Phillips, H., Henderson, C.E., Takahashi, M., Rosenthal, A., 1997. A GPI-linked protein that interacts with Ret to form a candidate neurturin receptor [erratum appears in Nature 1998 Mar 12;392(6672):210]. Nature 387, 717–721.

J.P. Golden et al. / Experimental Neurology 184 (2003) 447– 455 Knusel, B., Beck, K.D., Winslow, J.W., Rosenthal, A., Burton, L.E., Widmer, H.R., Nikolics, K., Hefti, F., 1992. Brain-derived neurotrophic factor administration protects basal forebrain cholinergic but not nigral dopaminergic neurons from degenerative changes after axotomy in the adult rat brain. J. Neurosci. 12, 4391– 4402. Knusel, B., Burton, L.E., Longo, F.M., Mobley, W.C., Koliatsos, V.E., Price, D.L., Hefti, F., 1990. Trophic actions of recombinant human nerve growth factor on cultured rat embryonic CNS cells. Exp. Neurol. 110, 274 –283. Kotzbauer, P.T., Lampe, P.A., Heuckeroth, R.O., Golden, J.P., Creedon, D.J., Johnson Jr., E.M., Milbrandt, J., 1996. Neurturin, a relative of glial-cell-line-derived neurotrophic factor. Nature 384, 467– 470. Lin, L.F., Doherty, D.H., Lile, J.D., Bektesh, S., Collins, F., 1993. GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons [comment]. Science 260, 1130 –1132. Lindahl, M., Poteryaev, D., Yu, L., Arumae, U., Timmusk, T., Bongarzone, I., Aiello, A., Pierotti, M.A., Airaksinen, M.S., Saarma, M., 2001. Human glial cell line-derived neurotrophic factor receptor ␣ 4 is the receptor for persephin and is predominantly expressed in normal and malignant thyroid medullary cells. J. Biol. Chem. 276, 9344 –9351. Lindahl, M., Timmusk, T., Rossi, J., Saarma, M., Airaksinen, M.S., 2000. Expression and alternative splicing of mouse Gfr␣4 suggest roles in endocrine cell development. Mol. Cell. Neurosci. 15, 522–533. Mayer, M., Noble, M., 1994. N-acetyl-L-cysteine is a pluripotent protector against cell death and enhancer of trophic factor-mediated cell survival in vitro. Proc. Natl. Acad. Sci. USA 91, 7496 –7500. Mesulam, M.M., Mufson, E.J., Levey, A.I., Wainer, B.H., 1983a. Cholinergic innervation of cortex by the basal forebrain: cytochemistry and cortical connections of the septal area, diagonal band nuclei, nucleus basalis (substantia innominata), and hypothalamus in the rhesus monkey. J. Comp. Neurol. 214, 170 –197. Mesulam, M.M., Mufson, E.J., Wainer, B.H., Levey, A.I., 1983b. Central cholinergic pathways in the rat: an overview based on an alternative nomenclature (Ch1-Ch6). Neuroscience 10, 1185–1201. Milbrandt, J., De Sauvage, F.J., Fahrner, T.J., Baloh, R.H., Leitner, M.L., Tansey, M.G., Lampe, P.A., Heuckeroth, R.O., Kotzbauer, P.T., Simburger, K.S., Golden, J.P., Davies, J.A., Vejsada, R., Kato, A.C., Hynes, M., Sherman, D., Nishimura, M., Wang, L.C., Vandlen, R., Moffat, B., Klein, R.D., Poulsen, K., Gray, C., Garces, A., Johnson Jr., E.M., 1998. Persephin, a novel neurotrophic factor related to GDNF and neurturin. Neuron 20, 245–253. Moore, M.W., Klein, R.D., Farinas, I., Sauer, H., Armanini, M., Phillips, H., Reichardt, L.F., Ryan, A.M., Carver-Moore, K., Rosenthal, A., 1996. Renal and neuronal abnormalities in mice lacking GDNF. Nature 382, 76 –79. Nosrat, C.A., Tomac, A., Hoffer, B.J., Olson, L., 1997. Cellular and developmental patterns of expression of Ret and glial cell line-derived neurotrophic factor receptor ␣ mRNAs. Exp. Brain Res. 115, 410 – 422. Perry, E.K., Tomlinson, B.E., Blessed, G., Bergmann, K., Gibson, P.H., Perry, R.H., 1978. Correlation of cholinergic abnormalities with senile plaques and mental test scores in senile dementia. Br. Med. J. 2, 1457–1459. Pichel, J.G., Shen, L., Sheng, H.Z., Granholm, A.C., Drago, J., Grinberg, A., Lee, E.J., Huang, S.P., Saarma, M., Hoffer, B.J., Sariola, H., Westphal, H., 1996. Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382, 73–76. Pongrac, J.L., Rylett, R.J., 1998. Optimization of serum-free culture conditions for growth of embryonic rat cholinergic basal forebrain neurons. J. Neurosci. Methods 84, 69 –76. Poteryaev, D., Titievsky, A., Sun, Y.F., Thomas-Crusells, J., Lindahl, M., Billaud, M., Arumae, U., Saarma, M., 1999. GDNF triggers a novel

455

ret-independent Src kinase family-coupled signaling via a GPI-linked GDNF receptor ␣1. FEBS Lett. 463, 63– 66. Price, M.L., Hoffer, B.J., Granholm, A.C., 1996. Effects of GDNF on fetal septal forebrain transplants in oculo. Exp. Neurol. 141, 181–189. Rossi, J., Luukko, K., Poteryaev, D., Laurikainen, A., Sun, Y.F., Laakso, T., Eerikainen, S., Tuominen, R., Lakso, M., Rauvala, H., Arumae, U., Pasternack, M., Saarma, M., Airaksinen, M.S., 1999. Retarded growth and deficits in the enteric and parasympathetic nervous system in mice lacking GFR ␣2, a functional neurturin receptor. Neuron 22, 243–252. Saarma, M., Sariola, H., 1999. Other neurotrophic factors: glial cell linederived neurotrophic factor (GDNF). Micro. Res. Tech. 45, 292–302. Sarabi, A., Hoffer, B.J., Olson, L., Morales, M., 2003. Glial cell line neurotrophic factor-family receptor ␣-1 is present in central neurons with distinct phenotypes. Neuroscience 116, 261–273. Suvanto, P., Wartiovaara, K., Lindahl, M., Arumae, U., Moshnyakov, M., Horelli-Kuitunen, N., Airaksinen, M.S., Palotie, A., Sariola, H., Saarma, M., 1997. Cloning, mRNA distribution and chromosomal localisation of the gene for glial cell line-derived neurotrophic factor receptor ␤, a homologue to GDNFR-␣. Hum. Mol. Genet. 6, 1267– 1273. Takei, N., Kuramoto, H., Endo, Y., Hatanaka, H., 1997. NGF and BDNF increase the immunoreactivity of vesicular acetylcholine transporter in cultured neurons from the embryonic rat septum. Neurosci. Lett. 226, 207–209. Takei, N., Torres, E., Yuhara, A., Jongsma, H., Otto, C., Korhonen, L., Abiru, Y., Skoglosa, Y., Schutz, G., Hatanaka, H., Sofroniew, M.V., Lindholm, D., 2000. Pituitary adenylate cyclase-activating polypeptide promotes the survival of basal forebrain cholinergic neurons in vitro and in vivo: comparison with effects of nerve growth factor. Eur. J. Neurosci. 12, 2273–2280. Treanor, J.J., Goodman, L., De Sauvage, F., Stone, D.M., Poulsen, K.T., Beck, C.D., Gray, C., Armanini, M.P., Pollock, R.A., Hefti, F., Phillips, H.S., Goddard, A., Moore, M.W., Buj-Bello, A., Davies, A.M., Asai, N., Takahashi, M., Vandlen, R., Henderson, C.E., Rosenthal, A., 1996. Characterization of a multicomponent receptor for GDNF [comment]. Nature 382, 80 – 83. Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A.S., Sieber, B.A., Grigoriou, M., Kilkenny, C., Salazar-Grueso, E., Pachnis, V., Arumae, U., 1996. Functional receptor for GDNF encoded by the c-ret proto-oncogene [comment]. Nature 381, 785–789. Trupp, M., Belluardo, N., Funakoshi, H., Ibanez, C.F., 1997. Complementary and overlapping expression of glial cell line-derived neurotrophic factor (GDNF), c-ret proto-oncogene, and GDNF receptor-␣ indicates multiple mechanisms of trophic actions in the adult rat CNS. J. Neurosci. 17, 3554 –3567. Trupp, M., Scott, R., Whittemore, S.R., Ibanez, C.F., 1999. Ret-dependent and -independent mechanisms of glial cell line-derived neurotrophic factor signaling in neuronal cells. J. Biol. Chem. 274, 20885–20894. Widenfalk, J., Nosrat, C., Tomac, A., Westphal, H., Hoffer, B., Olson, L., 1997. Neurturin and glial cell line-derived neurotrophic factor receptor-␤ (GDNFR-␤), novel proteins related to GDNF and GDNFR-␣ with specific cellular patterns of expression suggesting roles in the developing and adult nervous system and in peripheral organs. J. Neurosci. 17, 8506 – 8519. Williams, L.R., Inouye, G., Cummins, V., Pelleymounter, M.A., 1996. Glial cell line-derived neurotrophic factor sustains axotomized basal forebrain cholinergic neurons in vivo: dose-response comparison to nerve growth factor and brain-derived neurotrophic factor. J. Pharmacol. Exp. Ther. 277, 1140 –1151. Yu, T., Scully, S., Yu, Y., Fox, G.M., Jing, S., Zhou, R., 1998. Expression of GDNF family receptor components during development: implications in the mechanisms of interaction. J. Neurosci. 18, 4684 – 4696.