- Email: [email protected]
New combination of xylanolytic bacteria isolated from the lignocellulose degradation microbial consortium XDC-2 with enhanced xylanase activity
Bioresource Technology 221 (2016) 686–690
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
New combination of xylanolytic bacteria isolated from the lignocellulose degradation microbial consortium XDC-2 with enhanced xylanase activity Dongdong Zhang a, Yi Wang b, Dan Zheng b, Peng Guo b,⇑, Wei Cheng b, Zongjun Cui c a b c
Institute of Marine Biology, Ocean College, Zhejiang University, Zhoushan 316021, China Institute of Agricultural Products Processing and Nuclear Agriculture Technology Research, Hubei Academy of Agricultural Sciences, Wuhan 430064, China College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193, China
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
An aerobic xylanolytic strain was
combined with anaerobic xylanolytic strains. Xylanase activity was enhanced by combining Bacillus sp. and Clostridium sp. Not all xylanolytic bacterium can coexist with xylanase production enhancement. Bacillus sp. enabled the growth of anaerobic Clostridium sp., not Bacteroides sp.
a r t i c l e
i n f o
Article history: Received 12 August 2016 Received in revised form 18 September 2016 Accepted 19 September 2016 Available online 21 September 2016 Keywords: Lignocellulose degradation Extracellular xylanase activity Synthetic microbial community Bacillus subtilis Clostridium sartagoforme
a b s t r a c t Three bacterial strains with extracellular xylanase activity were isolated from the microbial consortium XDC-2. The aerobic strain A7, belonging to Bacillus sp., was combined with the anaerobe Clostridium sp. strain AA3 and/or Bacteroides sp. strain AA4 to obtain an efficient natural xylanolytic complex enzyme. The synthetic microbial community M1 consisting of strains Bacillus and Clostridium showed enhanced extracellular xylanase activity and production, and higher lignocelluloses degradation capability than any of the pure cultures and other synthetic microbial communities. Neither corn straw degradation nor extracellular xylanase activity was enhanced in the other synthetic microbial communities, Bacillus, Bacteroides with or without Clostridium. Quantitative polymerase chain reaction showed that the aerobic strain Bacillus enabled the growth of the anaerobic strain Clostridium, but not that of the anaerobic strain Bacteroides. These findings suggest that strains Bacillus and Clostridium can coexist well and have a positive synergistic interaction for extracellular xylanase secretion and lignocellulose degradation. Ó 2016 Elsevier Ltd. All rights reserved.
1. Introduction
⇑ Corresponding author. E-mail address: [email protected] (P. Guo). http://dx.doi.org/10.1016/j.biortech.2016.09.087 0960-8524/Ó 2016 Elsevier Ltd. All rights reserved.
Lignocellulose is the most abundant renewable biomass resource and has significant potential for the production of bioethanol, methane, and forage (Kaparaju et al., 2009; Guo et al., 2011). Lignocellulosic biomass is hydrolyzed to sugars, which can
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
then be converted to bioenergy. However, only a small portion of the biomass is used to produce animal feeds, paper, and bioenergy, with the remainder directly burnt in the field. The most significant technological and economical limitation for lignocellulosic biomass utilization is lignocellulose hydrolysis, because cellulose is strongly bound to hemicellulose and lignin in nature (Himmel et al., 2007). Therefore, enzymatic hydrolysis has been proposed as an alternative strategy, because it is usually conducted under mild conditions and does not have a corrosion problem (Singh et al., 2009). The abilities of pure-culture microorganisms to degrade celluloses and hemicelluloses are generally limited. The majority of pure-culture isolates with high lignocellulolytic activities can only degrade substrates with relatively simple structures and compositions, such as artificial xylan and carboxymethyl starch, but are unable to use natural lignocelluloses (Levin et al., 2006; Kato et al., 2004). Several studies have evaluated the potential for using mixtures of different microorganisms to improve the capability of natural lignocelluloses degradation (Haruta et al., 2009; Guo et al., 2010; Wang et al., 2011). Of particular note, the microbial consortium XDC-2 has been shown to degrade natural lignocelluloses, and also secreted extracellular xylanase efficiently in liquid culture under static conditions at room temperature (Guo et al., 2010). The extracellular enzyme showed high hydrolysis for natural lignocelluloses, and degraded most of the hemicelluloses (89.5% weight loss for the core of decorticated corn stalk and 77.1% for corn stalk) (Guo et al., 2010). Hemicellulose degradation and breakdown is very important to improve lignocellulose utilization. Compared with cell-associated enzymes, extracellular enzymes are easier to extract and are more available. However, little is known about the functional bacteria with xylanase activity in the consortium XDC-2, or the mechanisms of synergistic interaction, mutual coordination, and restraint between these xylanolytic bacteria. Therefore, resolving these uncertainties could help to achieve better control for the practical application of a microbial consortium for enzyme production. XDC-2 can maintain high xylanase activity during incubation from an initial aerobic condition to the subsequent anoxic condition (Guo et al., 2010). Studies have shown that the coexistence of anaerobic and aerobic bacteria is important for effective cellulose degradation (Kato et al., 2004). Accordingly, three bacterial strains with xylanase activity were isolated from the microbial consortium XDC-2 under aerobic and anaerobic conditions and combined with an anaerobe/anaerobes complex to obtain an efficient natural xylanolytic complex enzyme. However, not all members of XDC-2 can be completely identified. Therefore, establishing a microbial combination from isolated bacteria is the first step in clarifying the role of each bacterium and their interactions in secreting extracellular xylanase. In the present study, the extracellular xylanase and corn stalk degradation abilities of the three pure cultures and synthetic microbial communities were assayed and compared. The results of this study should contribute to the understanding of the mechanisms of the high extracellular xylanase activity in XDC-2, and be helpful for promoting the industrialized production of extracellular xylanase.
2. Materials and methods 2.1. Preparation of lignocellulosic materials Corn stalks obtained locally from Wuhan, China were air-dried and then submerged in 1% (w/v) sodium hydroxide at room temperature for 24 h, washed with tap water to neutral pH, and
687
oven-dried at 80 °C. The dried straws were milled to pass through a 1-mm sieve for further use.
2.2. Isolation of bacterial strains from original microbial consortium XDC-2 The bacteria were aerobically and anaerobically isolated with peptone cellulose solution (PCS) medium (Guo et al., 2011) and DSM 122 medium at 35 °C, respectively. After appropriate incubation periods, active cultures were transferred (5%, v/v) to fresh medium with 1% (w/v) rice straw as a carbon source. Phylogenetic analysis was detailed in the Supplementary Material.
2.3. Synthetic microbial communities DSM 122 medium was used for the synthetic microbial community experiments. Each isolate was precultivated to the stationary phase under the conditions described above. When the OD (optical density) value of aerobe (strain A7) and anaerobes (strain AA3 and AA4) reached to 1.2 and 0.8, respectively, 250 lL of each preculture solution was inoculated into 5 mL of DSM 122 medium in various microbial combinations (1st generation). The OD of sample was determined by using UV spectrophotometer (Bio-Spes Mini, Shimadzu, Japan) at 600 nm. When the corn stalk in the medium started to degrade, 250 lL of culture solutions were transferred to 5 mL of the same medium (2nd generation). The lignocellulose degradation and extracellular xylanase activity in the synthetic microbial communities were assessed after at least four transfers of the culture into new medium. Synthetic microbial communities were established by combining an aerobe (strain A7) with the following anaerobes: strain AA3 (designated as M1), strain AA4 (M2), and both strains AA3 and AA4 (M3). Unless stated otherwise, all of these cultures were incubated under static conditions with a loose cap at 35 °C in a 10-mL serum bottle. All of the experiments were performed in triplicate.
2.4. Determination of enzyme activities and weight loss In the cultures, xylanase activities were assayed according to Bailey et al. (1992). Samples were centrifuged at 12,000g for 10 min at 4 °C and the supernatants were used as extracellular enzyme samples. The weight losses of corn straw and lignocellulosic components were determined using a gravimetrical analysis method (Guo et al., 2010).
2.5. Real-time quantitative polymerase chain reaction (qPCR) The abundance of Bacillus subtilis, Clostridium sartagoforme, and Bacteroides graminisolvens in the synthetic microbial communities were estimated by qPCR. The specific primer sets used were Baci1233F (5–cagcgaaaccgcgaggttaag–3) and Baci1404R (5–ttacct caccgacttcgggtg–3) for B. subtilis, Clos157F (5–acattacattttcgcat gaag–3) and Clos404R (5– ctgaagacagagctttacgat–3) for C. sartagoforme, and Bact992F (5–gtgaaggtgctgcatggttgtc–3) and Bact1108R (5–cctcacatcttacgacggcagt–3) for B. graminisolvens. The primer sets were designed specifically for this study. qPCRs were performed using a LightCycler system (Roche Diagnostics, Mannheim, Germany) and the LightCycler Fast-start DNA Master SYBR green I Kit (Roche Molecular Biochemicals, Indianapolis, IN, USA) as previously described (Zhang et al., 2014).
688
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
3. Results and discussion
3.2. Extracellular xylanase activities and corn stalk degradation
3.1. Identification of bacterial strains isolated from microbial consortium XDC-2
The extracellular xylanase activities were determined after incubation for 6 days (Fig. 1A). At day 6, the xylanase activities were highest in the pure strain A7 and lowest in the pure strain AA3, and were markedly higher in the consortiums with M1 (A7 and AA3) showing only slightly lower activity (>90%) than that of XDC-2. Corn straw degradation occurred in all of the pure cultures and synthetic microbial communities under aerobic static conditions (Fig. 1B). The weight losses of corn straw, cellulose, and hemicellulose after 6 days were highest in A7 among the pure cultures and were highest in M1 (strains A7 and AA3) among the newly synthesized microbial communities, with 84%, 78%, and 85% of those of the original microbial consortium XDC-2. The degradation of hemicellulose in all samples was much higher than that of cellulose, demonstrating that these three strains mainly degraded hemicellulose rather than cellulose. These results suggested that these two bacteria can coexist well, and have a positive synergistic interaction for extracellular xylanase secretion and lignocelluloses degradation. However, these synergistic interactions did not occur under the anaerobic condition for M1, and the xylanase activity (0.235 U/ mL on day 6) was the same as that of the pure culture AA3. The weight loss of corn straw, cellulose, and hemicellulose was also the same as that of AA3 and remarkably lower than that of any microbial communities under aerobic condition. The other synthetic microbial communities M2 (strains A7 and AA4) and M3 (strains A7, AA3, and AA4) showed the same xylanase activities and weight losses of lignocellulosic components as those of strain A7, and were not enhanced by the combination. This suggests a potential negative relationship between strains A7 and AA4 for xylanase production. The aerobic strain A7 is very important for extracellular xylanase secretion and lignocellulose degradation in XDC-2; most of the enzyme was produced by this strain, and its metabolism under the aerobic condition might affect other xylanase-producing bacteria through synergistic interactions. Further studies are required to elucidate the mechanism of these potential synergistic interactions. The results of weight losses were in good agreement with those of the extracellular xylanase activities. Nevertheless, all of the synthetic microbial communities, including M1, showed clearly lower extracellular xylanase activity and corn straw degradation capability than the original microbial consortium XDC-2. This might reflect the presence of some other xylanase-producing bacteria or non-lignocellulolytic bacteria in XDC-2, which have a positive effect on the extracellular xylanase secretion of A7 and AA3. Further study is warranted to achieve more effective extracellular xylanase production by the synthetic combination of bacteria.
A phylogenetic tree was constructed using the neighbor-joining method (Supplementary Fig. S1). The results indicated that three bacteria, belonging to Bacillus sp., Clostridium sp., and Bacteroides sp., with extracellular xylanase activity were obtained from the microbial consortium XDC-2. Bacillus sp. strain A7 was aerobically isolated with PCS medium (Guo et al., 2011) at 35 °C, showing 99% identity to Bacillus subtilis strain CICC10025 (AY881635). Clostridium sp. strain AA3 and Bacteroides sp. strain AA4 were isolated from XDC-2 using DSM 122 medium at 35 °C under anaerobic conditions, and showed 99% identity to Clostridium sartagoforme strain DSM 1292 (NR026490) and Bacteroides graminisolvens strain XDT-1 (NR041642), respectively.
3.3. Quantitative analysis of the synthetic microbial communities
Fig. 1. Extracellular xylanase activities (A) and weight losses of the corn straw, cellulose, and hemicellulose (B) in different pure cultures and synthetic microbial communities after 6 days. M1 (AN) indicates the microbial community M1 (Bacillus sp. and Clostridium sp.) cultivated under anaerobic conditions instead of aerobic conditions. Vertical bars represent the standard deviations of means.
To determine the effect of the synthetic microbial combination on bacterial growth, the bacterial cell numbers in the pure cultures and synthetic microbial communities were determined at day 0 and 6 by qPCR (Fig. 2), targeting B. subtilis, C. sartagoforme, and B. graminisolvens. B. subtilis strain A7, which is a facultative anaerobe, was present in high abundance in all of the synthetic microbial communities. At day 6, the 16S rRNA gene copy number of C. sartagoforme in M1 was two orders of magnitude higher than that in the other cultures containing C. sartagoforme, i.e., M3 and M1 under the anaerobic condition, and accounted for 6.3% of the total cultures. When strain AA4, B. graminisolvens, was co-cultured with M1, i.e., M3, the growth of C. sartagoforme was inhibited and almost same as that of pure strain C. sartagoforme under anaerobic condition, and accounted for only 0.2% of the total bacteria in M3.
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
689
Fig. 2. Quantitative changes in the concentrations of the 16S rRNA genes of Bacillus subtilis, Clostridium sartagoforme, and Bacteroides graminisolvens in the different synthetic microbial communities at day 0 and 6. The pure strain AA3 (Clostridium sp.) and AA4 (Bacteroides sp.) were incubated under anaerobic condition. M1 (AN) indicates the microbial community M1 (Bacillus sp. and Clostridium sp.) cultivated under anaerobic conditions. All of the others were cultured under aerobic condition. Vertical bars represent the standard deviations of means.
B. graminisolvens in microbial communities M2 and M3 showed the same growth rate regardless of the presence of strain AA3. C. sartagoforme was detected at much higher abundance in M1 under the aerobic condition than under the anaerobic condition after 6 days. These results indicate that the aerobic strain A7 enabled the anaerobic strain AA3 to grow and produce the extracellular xylanase, but did not affect the activity of the anaerobic strain AA4. Several B. subtilis strains have been characterized as lignocellulose-degrading bacteria with synergic cellulolytic systems that could produce CMCase, avicelase, and xylanase enzymes (Kim et al., 2012). C. sartagoforme FZ11 could effectively utilize carboxymethyl cellulose, xylan, and hemicellulose as carbon sources, especially xylan, resulting in a 98.4% degradation rate (Zhang et al., 2015). B. graminisolvens XDT-1 has been reported as a xylanolytic anaerobe, which is able to grow by coupling the degradation of xylan, but not cellulose (Nishiyama et al., 2009). Nevertheless, not all xylanolytic bacteria can combine with each other to exert a positive effect on lignocelluloses degradation and extracellular xylanase production. The qPCR results clarified that the metabolism of strain A7 under the aerobic condition has a positive synergistic interaction with the growth of the anaerobic strain AA3, which might reflect the high extracellular xylanase activities and corn straw degradation. The coexistence of an aerobic xylanase-producing bacterium and anaerobic xylanase-producing bacteria is crucial for high extracellular xylanase activity and lignocellulose degradation. 4. Conclusions Achieving high extracellular xylanase activity by the synthetic combination of bacteria, and understanding the mechanisms of the synergistic interaction remains a challenge for the future of bioresource production at the industrial scale. Aerobic and anaerobic strains were combined in this study and a synergistic effect of strains A7 and AA3 was identified. Nevertheless, more combinations of strains should be tested to better enhance xylanase activities and lignocellulose degradation.
Acknowledgements Funding: This work was supported by the National Natural Science Foundation of China [grant no. 31200089] and the Chenguang Planning Project for Fostering Scientific and Technological Talents of Wuhan [grant no. 2015070404010189]. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2016.09. 087. References Bailey, M.J., Biely, P., Poutanen, K., 1992. Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23, 257–270. Guo, P., Mochidzuki, K., Cheng, W., Zhou, M., Gao, H., Zheng, D., Wang, X., Cui, Z., 2011. Effects of different pretreatment strategies on corn stalk acidogenic fermentation using a microbial consortium. Bioresour. Technol. 102, 7526– 7531. Guo, P., Zhu, W., Wang, H., Lv, Y., Wang, X., Zheng, D., Cui, Z., 2010. Functional characteristics and diversity of a novel lignocelluloses degrading composite microbial system with high xylanase activity. J. Microbiol. Biotechnol. 20, 254– 264. Haruta, S., Kato, S., Yamamoto, K., Igarashi, Y., 2009. Intertwined interspecies relationships: approaches to untangle the microbial network. Environ. Microbiol. 11, 2963–2969. Himmel, M.E., Ding, S., Johnson, D.K., Adney, W.S., Nimlos, M.R., Brady, J.W., Foust, T. D., 2007. Biomass recalcitrance: engineering plants and enzymes for biofuels production. Science 315, 804–807. Kaparaju, P., Serrano, M., Thomsen, A.B., Kongjan, P., Angelidaki, I., 2009. Bioethanol, biohydrogen and biogas production from wheat straw in a biorefinery concept. Bioresour. Technol. 100, 2562–2568. Kato, S., Haruta, S., Cui, Z., Ishii, M., Yokota, A., Igarashi, Y., 2004. Clostridium straminisolvens sp. nov., a moderately thermophilic, aerotolerant and cellulolytic bacterium isolated from a cellulose-degrading bacterial community. Int. J. Syst. Evol. Microbiol. 54, 2043–2047. Kim, Y.K., Lee, S.C., Cho, Y.Y., Oh, H.J., Ko, Y.H., 2012. Isolation of cellulolytic Bacillus subtilis strains from agricultural environments. ISRN Microbiol. 2012, 1–9. Levin, D.B., Islam, R., Cicek, N., Sparling, R., 2006. Hydrogen production by Clostridium thermocellum 27405 from cellulosic biomass substrates. Int. J. Hydrogen Energy 31, 1496–1503.
690
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
Nishiyama, T., Ueki, A., Kaku, N., Watanabe, K., Ueki, K., 2009. Bacteroides graminisolvens sp. Nov., a xylanolytic anaerobe isolated from a methanogenic reactor treating cattle waste. Int. J. Syst. Evol. Microbiol. 59, 1901–1907. Singh, R., Kumar, R., Bishnoi, K., Bishnoi, N.R., 2009. Optimization of synergistic parameters for thermostable cellulose activity of Aspergillus heteromorphus using response surface methodology. Biochem. Eng. J. 48, 28–35. Wang, W., Yan, L., Cui, Z., Gao, Y., Wang, Y., Jing, R., 2011. Characterization of a microbial consortium capable of degrading lignocellulose. Bioresour. Technol. 102, 9321–9324.
Zhang, J., Li, Y., Zheng, H., Fan, Y., Hou, H., 2015. Direct degradation of cellulosic biomass to bio-hydrogen from a newly isolated strain Clostridium Sartagoforme FZ11. Bioresour. Technol. 192, 60–67. Zhang, D., Zhang, C., Li, Z., Suzuki, D., Komatsu, D.D., Tsunogai, U., Katayama, A., 2014. Electrochemical stimulation of microbial reductive dechlorination of pentachlorophenol using solid-state redox mediator immobilization. Bioresour. Technol. 164, 232–240.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
New combination of xylanolytic bacteria isolated from the lignocellulose degradation microbial consortium XDC-2 with enhanced xylanase activity Dongdong Zhang a, Yi Wang b, Dan Zheng b, Peng Guo b,⇑, Wei Cheng b, Zongjun Cui c a b c
Institute of Marine Biology, Ocean College, Zhejiang University, Zhoushan 316021, China Institute of Agricultural Products Processing and Nuclear Agriculture Technology Research, Hubei Academy of Agricultural Sciences, Wuhan 430064, China College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193, China
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
An aerobic xylanolytic strain was
combined with anaerobic xylanolytic strains. Xylanase activity was enhanced by combining Bacillus sp. and Clostridium sp. Not all xylanolytic bacterium can coexist with xylanase production enhancement. Bacillus sp. enabled the growth of anaerobic Clostridium sp., not Bacteroides sp.
a r t i c l e
i n f o
Article history: Received 12 August 2016 Received in revised form 18 September 2016 Accepted 19 September 2016 Available online 21 September 2016 Keywords: Lignocellulose degradation Extracellular xylanase activity Synthetic microbial community Bacillus subtilis Clostridium sartagoforme
a b s t r a c t Three bacterial strains with extracellular xylanase activity were isolated from the microbial consortium XDC-2. The aerobic strain A7, belonging to Bacillus sp., was combined with the anaerobe Clostridium sp. strain AA3 and/or Bacteroides sp. strain AA4 to obtain an efficient natural xylanolytic complex enzyme. The synthetic microbial community M1 consisting of strains Bacillus and Clostridium showed enhanced extracellular xylanase activity and production, and higher lignocelluloses degradation capability than any of the pure cultures and other synthetic microbial communities. Neither corn straw degradation nor extracellular xylanase activity was enhanced in the other synthetic microbial communities, Bacillus, Bacteroides with or without Clostridium. Quantitative polymerase chain reaction showed that the aerobic strain Bacillus enabled the growth of the anaerobic strain Clostridium, but not that of the anaerobic strain Bacteroides. These findings suggest that strains Bacillus and Clostridium can coexist well and have a positive synergistic interaction for extracellular xylanase secretion and lignocellulose degradation. Ó 2016 Elsevier Ltd. All rights reserved.
1. Introduction
⇑ Corresponding author. E-mail address: [email protected] (P. Guo). http://dx.doi.org/10.1016/j.biortech.2016.09.087 0960-8524/Ó 2016 Elsevier Ltd. All rights reserved.
Lignocellulose is the most abundant renewable biomass resource and has significant potential for the production of bioethanol, methane, and forage (Kaparaju et al., 2009; Guo et al., 2011). Lignocellulosic biomass is hydrolyzed to sugars, which can
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
then be converted to bioenergy. However, only a small portion of the biomass is used to produce animal feeds, paper, and bioenergy, with the remainder directly burnt in the field. The most significant technological and economical limitation for lignocellulosic biomass utilization is lignocellulose hydrolysis, because cellulose is strongly bound to hemicellulose and lignin in nature (Himmel et al., 2007). Therefore, enzymatic hydrolysis has been proposed as an alternative strategy, because it is usually conducted under mild conditions and does not have a corrosion problem (Singh et al., 2009). The abilities of pure-culture microorganisms to degrade celluloses and hemicelluloses are generally limited. The majority of pure-culture isolates with high lignocellulolytic activities can only degrade substrates with relatively simple structures and compositions, such as artificial xylan and carboxymethyl starch, but are unable to use natural lignocelluloses (Levin et al., 2006; Kato et al., 2004). Several studies have evaluated the potential for using mixtures of different microorganisms to improve the capability of natural lignocelluloses degradation (Haruta et al., 2009; Guo et al., 2010; Wang et al., 2011). Of particular note, the microbial consortium XDC-2 has been shown to degrade natural lignocelluloses, and also secreted extracellular xylanase efficiently in liquid culture under static conditions at room temperature (Guo et al., 2010). The extracellular enzyme showed high hydrolysis for natural lignocelluloses, and degraded most of the hemicelluloses (89.5% weight loss for the core of decorticated corn stalk and 77.1% for corn stalk) (Guo et al., 2010). Hemicellulose degradation and breakdown is very important to improve lignocellulose utilization. Compared with cell-associated enzymes, extracellular enzymes are easier to extract and are more available. However, little is known about the functional bacteria with xylanase activity in the consortium XDC-2, or the mechanisms of synergistic interaction, mutual coordination, and restraint between these xylanolytic bacteria. Therefore, resolving these uncertainties could help to achieve better control for the practical application of a microbial consortium for enzyme production. XDC-2 can maintain high xylanase activity during incubation from an initial aerobic condition to the subsequent anoxic condition (Guo et al., 2010). Studies have shown that the coexistence of anaerobic and aerobic bacteria is important for effective cellulose degradation (Kato et al., 2004). Accordingly, three bacterial strains with xylanase activity were isolated from the microbial consortium XDC-2 under aerobic and anaerobic conditions and combined with an anaerobe/anaerobes complex to obtain an efficient natural xylanolytic complex enzyme. However, not all members of XDC-2 can be completely identified. Therefore, establishing a microbial combination from isolated bacteria is the first step in clarifying the role of each bacterium and their interactions in secreting extracellular xylanase. In the present study, the extracellular xylanase and corn stalk degradation abilities of the three pure cultures and synthetic microbial communities were assayed and compared. The results of this study should contribute to the understanding of the mechanisms of the high extracellular xylanase activity in XDC-2, and be helpful for promoting the industrialized production of extracellular xylanase.
2. Materials and methods 2.1. Preparation of lignocellulosic materials Corn stalks obtained locally from Wuhan, China were air-dried and then submerged in 1% (w/v) sodium hydroxide at room temperature for 24 h, washed with tap water to neutral pH, and
687
oven-dried at 80 °C. The dried straws were milled to pass through a 1-mm sieve for further use.
2.2. Isolation of bacterial strains from original microbial consortium XDC-2 The bacteria were aerobically and anaerobically isolated with peptone cellulose solution (PCS) medium (Guo et al., 2011) and DSM 122 medium at 35 °C, respectively. After appropriate incubation periods, active cultures were transferred (5%, v/v) to fresh medium with 1% (w/v) rice straw as a carbon source. Phylogenetic analysis was detailed in the Supplementary Material.
2.3. Synthetic microbial communities DSM 122 medium was used for the synthetic microbial community experiments. Each isolate was precultivated to the stationary phase under the conditions described above. When the OD (optical density) value of aerobe (strain A7) and anaerobes (strain AA3 and AA4) reached to 1.2 and 0.8, respectively, 250 lL of each preculture solution was inoculated into 5 mL of DSM 122 medium in various microbial combinations (1st generation). The OD of sample was determined by using UV spectrophotometer (Bio-Spes Mini, Shimadzu, Japan) at 600 nm. When the corn stalk in the medium started to degrade, 250 lL of culture solutions were transferred to 5 mL of the same medium (2nd generation). The lignocellulose degradation and extracellular xylanase activity in the synthetic microbial communities were assessed after at least four transfers of the culture into new medium. Synthetic microbial communities were established by combining an aerobe (strain A7) with the following anaerobes: strain AA3 (designated as M1), strain AA4 (M2), and both strains AA3 and AA4 (M3). Unless stated otherwise, all of these cultures were incubated under static conditions with a loose cap at 35 °C in a 10-mL serum bottle. All of the experiments were performed in triplicate.
2.4. Determination of enzyme activities and weight loss In the cultures, xylanase activities were assayed according to Bailey et al. (1992). Samples were centrifuged at 12,000g for 10 min at 4 °C and the supernatants were used as extracellular enzyme samples. The weight losses of corn straw and lignocellulosic components were determined using a gravimetrical analysis method (Guo et al., 2010).
2.5. Real-time quantitative polymerase chain reaction (qPCR) The abundance of Bacillus subtilis, Clostridium sartagoforme, and Bacteroides graminisolvens in the synthetic microbial communities were estimated by qPCR. The specific primer sets used were Baci1233F (5–cagcgaaaccgcgaggttaag–3) and Baci1404R (5–ttacct caccgacttcgggtg–3) for B. subtilis, Clos157F (5–acattacattttcgcat gaag–3) and Clos404R (5– ctgaagacagagctttacgat–3) for C. sartagoforme, and Bact992F (5–gtgaaggtgctgcatggttgtc–3) and Bact1108R (5–cctcacatcttacgacggcagt–3) for B. graminisolvens. The primer sets were designed specifically for this study. qPCRs were performed using a LightCycler system (Roche Diagnostics, Mannheim, Germany) and the LightCycler Fast-start DNA Master SYBR green I Kit (Roche Molecular Biochemicals, Indianapolis, IN, USA) as previously described (Zhang et al., 2014).
688
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
3. Results and discussion
3.2. Extracellular xylanase activities and corn stalk degradation
3.1. Identification of bacterial strains isolated from microbial consortium XDC-2
The extracellular xylanase activities were determined after incubation for 6 days (Fig. 1A). At day 6, the xylanase activities were highest in the pure strain A7 and lowest in the pure strain AA3, and were markedly higher in the consortiums with M1 (A7 and AA3) showing only slightly lower activity (>90%) than that of XDC-2. Corn straw degradation occurred in all of the pure cultures and synthetic microbial communities under aerobic static conditions (Fig. 1B). The weight losses of corn straw, cellulose, and hemicellulose after 6 days were highest in A7 among the pure cultures and were highest in M1 (strains A7 and AA3) among the newly synthesized microbial communities, with 84%, 78%, and 85% of those of the original microbial consortium XDC-2. The degradation of hemicellulose in all samples was much higher than that of cellulose, demonstrating that these three strains mainly degraded hemicellulose rather than cellulose. These results suggested that these two bacteria can coexist well, and have a positive synergistic interaction for extracellular xylanase secretion and lignocelluloses degradation. However, these synergistic interactions did not occur under the anaerobic condition for M1, and the xylanase activity (0.235 U/ mL on day 6) was the same as that of the pure culture AA3. The weight loss of corn straw, cellulose, and hemicellulose was also the same as that of AA3 and remarkably lower than that of any microbial communities under aerobic condition. The other synthetic microbial communities M2 (strains A7 and AA4) and M3 (strains A7, AA3, and AA4) showed the same xylanase activities and weight losses of lignocellulosic components as those of strain A7, and were not enhanced by the combination. This suggests a potential negative relationship between strains A7 and AA4 for xylanase production. The aerobic strain A7 is very important for extracellular xylanase secretion and lignocellulose degradation in XDC-2; most of the enzyme was produced by this strain, and its metabolism under the aerobic condition might affect other xylanase-producing bacteria through synergistic interactions. Further studies are required to elucidate the mechanism of these potential synergistic interactions. The results of weight losses were in good agreement with those of the extracellular xylanase activities. Nevertheless, all of the synthetic microbial communities, including M1, showed clearly lower extracellular xylanase activity and corn straw degradation capability than the original microbial consortium XDC-2. This might reflect the presence of some other xylanase-producing bacteria or non-lignocellulolytic bacteria in XDC-2, which have a positive effect on the extracellular xylanase secretion of A7 and AA3. Further study is warranted to achieve more effective extracellular xylanase production by the synthetic combination of bacteria.
A phylogenetic tree was constructed using the neighbor-joining method (Supplementary Fig. S1). The results indicated that three bacteria, belonging to Bacillus sp., Clostridium sp., and Bacteroides sp., with extracellular xylanase activity were obtained from the microbial consortium XDC-2. Bacillus sp. strain A7 was aerobically isolated with PCS medium (Guo et al., 2011) at 35 °C, showing 99% identity to Bacillus subtilis strain CICC10025 (AY881635). Clostridium sp. strain AA3 and Bacteroides sp. strain AA4 were isolated from XDC-2 using DSM 122 medium at 35 °C under anaerobic conditions, and showed 99% identity to Clostridium sartagoforme strain DSM 1292 (NR026490) and Bacteroides graminisolvens strain XDT-1 (NR041642), respectively.
3.3. Quantitative analysis of the synthetic microbial communities
Fig. 1. Extracellular xylanase activities (A) and weight losses of the corn straw, cellulose, and hemicellulose (B) in different pure cultures and synthetic microbial communities after 6 days. M1 (AN) indicates the microbial community M1 (Bacillus sp. and Clostridium sp.) cultivated under anaerobic conditions instead of aerobic conditions. Vertical bars represent the standard deviations of means.
To determine the effect of the synthetic microbial combination on bacterial growth, the bacterial cell numbers in the pure cultures and synthetic microbial communities were determined at day 0 and 6 by qPCR (Fig. 2), targeting B. subtilis, C. sartagoforme, and B. graminisolvens. B. subtilis strain A7, which is a facultative anaerobe, was present in high abundance in all of the synthetic microbial communities. At day 6, the 16S rRNA gene copy number of C. sartagoforme in M1 was two orders of magnitude higher than that in the other cultures containing C. sartagoforme, i.e., M3 and M1 under the anaerobic condition, and accounted for 6.3% of the total cultures. When strain AA4, B. graminisolvens, was co-cultured with M1, i.e., M3, the growth of C. sartagoforme was inhibited and almost same as that of pure strain C. sartagoforme under anaerobic condition, and accounted for only 0.2% of the total bacteria in M3.
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
689
Fig. 2. Quantitative changes in the concentrations of the 16S rRNA genes of Bacillus subtilis, Clostridium sartagoforme, and Bacteroides graminisolvens in the different synthetic microbial communities at day 0 and 6. The pure strain AA3 (Clostridium sp.) and AA4 (Bacteroides sp.) were incubated under anaerobic condition. M1 (AN) indicates the microbial community M1 (Bacillus sp. and Clostridium sp.) cultivated under anaerobic conditions. All of the others were cultured under aerobic condition. Vertical bars represent the standard deviations of means.
B. graminisolvens in microbial communities M2 and M3 showed the same growth rate regardless of the presence of strain AA3. C. sartagoforme was detected at much higher abundance in M1 under the aerobic condition than under the anaerobic condition after 6 days. These results indicate that the aerobic strain A7 enabled the anaerobic strain AA3 to grow and produce the extracellular xylanase, but did not affect the activity of the anaerobic strain AA4. Several B. subtilis strains have been characterized as lignocellulose-degrading bacteria with synergic cellulolytic systems that could produce CMCase, avicelase, and xylanase enzymes (Kim et al., 2012). C. sartagoforme FZ11 could effectively utilize carboxymethyl cellulose, xylan, and hemicellulose as carbon sources, especially xylan, resulting in a 98.4% degradation rate (Zhang et al., 2015). B. graminisolvens XDT-1 has been reported as a xylanolytic anaerobe, which is able to grow by coupling the degradation of xylan, but not cellulose (Nishiyama et al., 2009). Nevertheless, not all xylanolytic bacteria can combine with each other to exert a positive effect on lignocelluloses degradation and extracellular xylanase production. The qPCR results clarified that the metabolism of strain A7 under the aerobic condition has a positive synergistic interaction with the growth of the anaerobic strain AA3, which might reflect the high extracellular xylanase activities and corn straw degradation. The coexistence of an aerobic xylanase-producing bacterium and anaerobic xylanase-producing bacteria is crucial for high extracellular xylanase activity and lignocellulose degradation. 4. Conclusions Achieving high extracellular xylanase activity by the synthetic combination of bacteria, and understanding the mechanisms of the synergistic interaction remains a challenge for the future of bioresource production at the industrial scale. Aerobic and anaerobic strains were combined in this study and a synergistic effect of strains A7 and AA3 was identified. Nevertheless, more combinations of strains should be tested to better enhance xylanase activities and lignocellulose degradation.
Acknowledgements Funding: This work was supported by the National Natural Science Foundation of China [grant no. 31200089] and the Chenguang Planning Project for Fostering Scientific and Technological Talents of Wuhan [grant no. 2015070404010189]. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2016.09. 087. References Bailey, M.J., Biely, P., Poutanen, K., 1992. Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23, 257–270. Guo, P., Mochidzuki, K., Cheng, W., Zhou, M., Gao, H., Zheng, D., Wang, X., Cui, Z., 2011. Effects of different pretreatment strategies on corn stalk acidogenic fermentation using a microbial consortium. Bioresour. Technol. 102, 7526– 7531. Guo, P., Zhu, W., Wang, H., Lv, Y., Wang, X., Zheng, D., Cui, Z., 2010. Functional characteristics and diversity of a novel lignocelluloses degrading composite microbial system with high xylanase activity. J. Microbiol. Biotechnol. 20, 254– 264. Haruta, S., Kato, S., Yamamoto, K., Igarashi, Y., 2009. Intertwined interspecies relationships: approaches to untangle the microbial network. Environ. Microbiol. 11, 2963–2969. Himmel, M.E., Ding, S., Johnson, D.K., Adney, W.S., Nimlos, M.R., Brady, J.W., Foust, T. D., 2007. Biomass recalcitrance: engineering plants and enzymes for biofuels production. Science 315, 804–807. Kaparaju, P., Serrano, M., Thomsen, A.B., Kongjan, P., Angelidaki, I., 2009. Bioethanol, biohydrogen and biogas production from wheat straw in a biorefinery concept. Bioresour. Technol. 100, 2562–2568. Kato, S., Haruta, S., Cui, Z., Ishii, M., Yokota, A., Igarashi, Y., 2004. Clostridium straminisolvens sp. nov., a moderately thermophilic, aerotolerant and cellulolytic bacterium isolated from a cellulose-degrading bacterial community. Int. J. Syst. Evol. Microbiol. 54, 2043–2047. Kim, Y.K., Lee, S.C., Cho, Y.Y., Oh, H.J., Ko, Y.H., 2012. Isolation of cellulolytic Bacillus subtilis strains from agricultural environments. ISRN Microbiol. 2012, 1–9. Levin, D.B., Islam, R., Cicek, N., Sparling, R., 2006. Hydrogen production by Clostridium thermocellum 27405 from cellulosic biomass substrates. Int. J. Hydrogen Energy 31, 1496–1503.
690
D. Zhang et al. / Bioresource Technology 221 (2016) 686–690
Nishiyama, T., Ueki, A., Kaku, N., Watanabe, K., Ueki, K., 2009. Bacteroides graminisolvens sp. Nov., a xylanolytic anaerobe isolated from a methanogenic reactor treating cattle waste. Int. J. Syst. Evol. Microbiol. 59, 1901–1907. Singh, R., Kumar, R., Bishnoi, K., Bishnoi, N.R., 2009. Optimization of synergistic parameters for thermostable cellulose activity of Aspergillus heteromorphus using response surface methodology. Biochem. Eng. J. 48, 28–35. Wang, W., Yan, L., Cui, Z., Gao, Y., Wang, Y., Jing, R., 2011. Characterization of a microbial consortium capable of degrading lignocellulose. Bioresour. Technol. 102, 9321–9324.
Zhang, J., Li, Y., Zheng, H., Fan, Y., Hou, H., 2015. Direct degradation of cellulosic biomass to bio-hydrogen from a newly isolated strain Clostridium Sartagoforme FZ11. Bioresour. Technol. 192, 60–67. Zhang, D., Zhang, C., Li, Z., Suzuki, D., Komatsu, D.D., Tsunogai, U., Katayama, A., 2014. Electrochemical stimulation of microbial reductive dechlorination of pentachlorophenol using solid-state redox mediator immobilization. Bioresour. Technol. 164, 232–240.