New deep-sea species of Anobothrus (Annelida: Ampharetidae) from the Kuril-Kamchatka Trench and adjacent abyssal regions

Journal Pre-proofs New deep-sea species of Anobothrus (Annelida: Ampharetidae) from the Kuril-Kamchatka Trench and adjacent abyssal regions Inna L. Alalykina, Neonila E. Polyakova PII: DOI: Reference:

S0079-6611(19)30417-3 https://doi.org/10.1016/j.pocean.2019.102237 PROOCE 102237

To appear in:

Progress in Oceanography

Received Date: Revised Date: Accepted Date:

30 April 2019 24 September 2019 30 November 2019

Please cite this article as: Alalykina, I.L., Polyakova, N.E., New deep-sea species of Anobothrus (Annelida: Ampharetidae) from the Kuril-Kamchatka Trench and adjacent abyssal regions, Progress in Oceanography (2019), doi: https://doi.org/10.1016/j.pocean.2019.102237

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Elsevier Ltd. All rights reserved.

New deep-sea species of Anobothrus (Annelida: Ampharetidae) from the Kuril-Kamchatka Trench and adjacent abyssal regions Inna L. Alalykina & Neonila E. Polyakova A.V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch of Russian Academy of Sciences, Vladivostok 690041, Russia e-mail: [email protected], [email protected]

Abstract Three new species of ampharetid polychaetes, Anobothrus auriculatus sp. nov., Anobothrus jirkovi sp. nov., and Anobothrus sonne sp. nov., collected from the abyss of the Kuril Basin of the Sea of Okhotsk, and from the abyssal and hadal Kuril-Kamchatka Trench area, NW Pacific, are described herein. The detailed descriptions with electron microscopy illustrations for the new species are presented and their differences from similar species are discussed. All the new species are characterized by the presence of 3 pairs of branchiae, and unique features: the presence of high paleal epidermal folds resembling ears, and only one abdominal neuropodia of thoracic type in A. auriculatus sp. nov.; the presence of rather prominent lower lip, and fleshy cup-shaped paleal base, dark colored in methylene blue staining in A. jirkovi sp. nov.; the presence of papillate ventral fold originating from fused SII–III segments in A. sonne sp. nov. Anobothrus auriculatus sp. nov. appears the deepest (9584 m) hadal representative of the genus Anobothrus described so far. Both morphological data and phylogenetic analysis provided the evidence for the presence of the three new species in the studied area. For the genus Anobothrus Levinsen, 1884 an identification key is given, including all valid species recognized world-wide. Keywords: Northwest Pacific; the Kuril Basin of the Sea of Okhotsk; Abyss; hadal; polychaetes; taxonomy; distribution; species description; phylogenetic analysis.

1. Introduction Ampharetidae is one of the largest polychaete families comprising more than 300 species and 100 genera described (Jirkov, 2009, 2011). The family occurs world-wide from the intertidal to hadal zone deeper than 8200 m (Jirkov, 2011), often as one of the more dominant families of

polychaetes in deep-sea environments, including hydrothermal vents and cold seeps (Rouse and Pleijel, 2001; Reuscher et al., 2009; Kongsrud, et al., 2017). Our recent investigations (Alalykina, 2015) indicate that the Ampharetidae is one of the most abundant and diverse polychaete families of benthic fauna in the Kuril-Kamchatka Trench (KKT) area. Within this family the genus Anobothrus Levinsen, 1884 is one of the most speciose ampharetid genera world-wide (Schüller and Jirkov, 2013; Bonifácio et al., 2015), often reported from the Pacific waters (Hilbig, 2000; Reuscher et al., 2009; Imajima et al., 2013; Sui and Li, 2013). Of the 19 species of the genus Anobothrus currently considered valid (Jirkov, 2009; Schüller and Jirkov, 2013; Bonifácio et al., 2015), more than half are registered in the North Pacific. Among them, six Anobothrus species (A. apaleatus Reuscher, Fiege & Wehe, 2009, A. bimaculatus Fauchald, 1972, A. fimbriatus Imajima, Reuscher & Fiege, 2013, A. mancus Fauchald, 1972, A. mironovi Jirkov, 2009, and A. patersoni Jirkov, 2009) are reported from deep waters below 1000 m, apparently well adapted to live in the deep sea environments. The abyssal KKT area, inhabited by a diverse and abundant deep-sea benthic fauna, is considered one of the most productive regions in the World Ocean (Sokolova, 1976, 1981). The earliest investigations of benthic fauna of the KKT performed during six biological Vityaz expeditions in 1949, 1953–1955, and 1966 revealed high diversity and species richness of the deep-sea macrobenthos in the North Pacific (Belyaev, 1983; 1989; Levenstein, 1962, 1969; Zenkevich, 1963). Resulting overviews concerning the deep-water polychaetes from different families have been published (e.g., Uschakov, 1955, 1958; Levenstein, 1962, 1970, 1971). Levenstein (1969) reviewed data on the Pacific deep-water polychaete fauna, and listed 13 polychaete species from the KKT at depths of 5070–9950 m (RV Vityaz collections), including only one undescribed ampharetid species. More recently two new ampharetid species of the genus Anobothrus (A. patersoni Jirkov, 2009, and A. mironovi Jirkov, 2009) were described based on material collected from the KKT area by early Soviet Oceanographic expeditions onboard R/V Vityaz from depths of 3260–8292 m (Jirkov, 2009). Nevertheless, the information on the deep-sea polychaete fauna of the Pacific Ocean is still scarce, not only because of difficulties in collecting abyssal samples, but also in part due to the lack of taxonomic effort directed towards studying existing material collected by RV Vityaz and other Russian research vessels (Kupriyanova et al., 2011). In the present study, we formally describe three new ampharetid species of the genus Anobothrus from the abyssal zone of the Sea of Okhotsk, and the abyssal and hadal KKT area. An emended diagnosis of the genus Anobothrus is provided. The phylogenetic relationships between the new Anobothrus species and other deep-sea ampharetids from the KKT area have been explored using molecular data. Mitochondrial (16S

RNA and cytochrome c oxidase subunit 1, COI) and nuclear (18S RNA, 28S RNA and H3) sequences were produced for the three new species described herein, as well as for the other species identified as Anobothrus patersoni Jirkov, 2009, and A. fimbriatus Imajima, Reuscher & Fiege, 2013. The phylogenetic analysis indicates the presence of the three new species in the studied area, which was consistent with morphological data. 2. Material and methods 2.1. Sample collection and morphological analysis The abyssal plain adjacent to the Kuril-Kamchatka Trench (KKT area, 5216–5423 m), the Kuril-Kamchatka Trench (KKT, 5120–9584 m), and the Kuril Basin of the Sea of Okhotsk (3206–3366 m) were sampled during the joint German–Russian expeditions KuramBio-I, KuramBio-II (Kuril-Kamchatka Biodiversity Studies) on board R/V Sonne (cruises SO223, SO250), and SokhoBio (Sea of Okhotsk Biodiversity Studies) on board R/V Akademik M.A. Lavrentyev (cruise 71) in 2012–2016 (Fig. 1A). Samples were taken with an epibenthic sledge (EBS), an Agassiz trawl (AGT), and a Box-Corer (BC, sampling area of 0.25m2). Sledge operation procedure is described in Brandt et al. (2019, in this issue). On deck, the samples were washed with ice-cold water and sieved through 300-µm mesh screens. Samples from the first deployment of each station were fixed with pre-cooled 96% ethanol. Samples from the second deployment were fixed with 4% formaldehyde and later transferred to 75% ethanol. Collected samples were sorted either on board or later in the laboratory. Drawings of new species were made using an Olympus CX 31 light microscope equipped with a camera lucida. Adult specimens selected for scanning electron microscopy (SEM) were washed using distilled water with a detergent to clean the body surface. The cleaned specimens were dehydrated through a graded series of ethanol, transferred to acetone, and critical-point dried. The specimens were mounted on aluminum stubs, coated with gold, and observed under Zeiss LEO-430 at the National Scientific Center of Marine Biology (Vladivostok, Russia). Photographs and hand-drawings served as master for line-drawings carried out with help of Corel Draw, and Adobe Photoshop CS3. For better visualization of characters, specimens were stained with methylene blue dissolved in distilled water. Sampling locations of herein described species are summarized in Table 1. Type specimens have been deposited at the Museum of National Scientific Center of Marine Biology of the Far Eastern Branch of Russian Academy of Sciences, Vladivostok, Russia (MIMB), the Zoological Institute of the Russian Academy of Sciences, St. Petersburg, Russia (ZIN), the

Department of Hydrobiology, Faculty of Biology, Moscow State University (KGB MGU), the Zoological Museum of the Moscow State University (ZM MGU), Moscow, Russia, and the Zoological Museum of Hamburg (ZMH), Germany. Information about samples is given along with the description of species. The numbers of specimens in a sample is given in parentheses after the museum abbreviation and registration number. Preservation details, locations, collection codes and catalogue numbers of types are given in Table 2. Information for the key was taken from original descriptions and observations of species during former studies (Jirkov 2001; 2009; Schüller and Jirkov, 2013). Abbreviations used in the text: S — segment, TS — thoracic segment, TCh — thoracic chaetiger; TU — thoracic unciniger; AU — abdominal unciniger. 2.2. Specimen collection for molecular analysis New DNA-sequences were produced for five specimens of Anobothrus sonne sp. nov., four specimens of A. auriculatus sp. nov., and for one specimen of each of the following species: A. jirkovi sp. nov., A. patersoni Jirkov, 2009, and A. fimbriatus Imajima, Reuscher & Fiege, 2013. In total 12 specimens of deep-sea ampharetids collected from the investigated area were included in the analysis (Table 3). Available sequences of Anobothrus gracilis (Malmgren, 1866) and A. laubieri (Desbruyères, 1978) were downloaded from GenBank, as well as the other ampharetids species Sosane wireni (Hessle, 1917), and Ampharete falcata Eliason, 1955 as outgroups. 2.3. DNA extraction, PCR amplification and sequencing Total genomic DNA was extracted from the ethanol-preserved specimens using the DNA-sorb-B-100 Blood Kit according to the manufacturer’s protocol. Five markers of partial nuclear 18S RNA, 28S RNA, H3, and mitochondrial 16S RNA and cytochrome c oxidase subunit I (COI) sequences were amplified from the genomic DNA. Amplification of polymerase chain reaction (PCR) was carried out using the primers listed in Table 4. PCR cycling profiles were as follows: COI — 5 min at 95°C, 5 cycles with 45 s at 95°C, 45 s at 45°C, and 1 min at 72°C, followed by 35 cycles of 45 s at 95°C, 45 s at 51°C, and 1 min at 72°C, and finally 7 min at 72°C (Kongsrud et al., 2017). 16S — 2 min at 94°C, 39 cycles with 40 s at 94°C, 40 s at 60°C, and 1min at 72°C, and finally 7 min at 72°C. 18S — 2 min at 94°C, 39 cycles with 1 min at 94°C, 1 min at 49–52°C, and 1 min at 72°C, and finally 7 min at 72°C. 28S — 3 min at 94°C, 7 cycles with 30 s at 94°C, 30 s at 55°C and 1 min at 72°C, 35 cycles with 40 s at 94°C, 40 s at 52°C, and 1 min at 72°C, and finally 7 min at 72°C (Struck et.al., 2006). H3

— 2 min at 94°C, 39 cycles with 40 s at 94°C, 40 s at 55°C, and 1min at 72°C, and finally 7 min at 72°C. Quality and quantity of PCR products was assessed by gel electrophoresis. The amplified products were purified using ExoSAP (Fermentas, Lithuania). Sequencing in forward and reverse directions was carried out on an ABI Prism 3500 Genetic Analyzers (Applied Biosystems) under conditions recommended by the manufacturer, using a BigDye Terminator ver. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and the same primers as for PCR. 2.4. Data analysis The sequences for all five markers were aligned in MEGA ver. 6.0 using MUSCLE algorithm as implemented in MEGA ver. 6.0 with default settings (Tamura et al., 2013) and MAFFT 7.0 (Katoh and Standley, 2013). Ambiguous positions and gaps were excluded from subsequent analysis using Gblocks Server ver. 0.91b (Castresana, 2000), allowing for smaller final blocks, gap positions within the final blocks, and less strict flanking positions, but not allowing for many contiguous non-conserved positions. BLAST searches (Altschul et al., 1997), as implemented in the NCBI website (http://www.ncbi.nlm.nih.gov/), were conducted to check for putative contamination. All the new sequences were submitted to GenBank (the accession numbers are listed in the Table 3). A supermatrix with a total length of 4125 bp was formed by concatenating the five markers using Sequence Matrix (Vaidya et al., 2011) wherein the external gaps as well as the lack of the 18S, 28S sequence data for some species from GenBank (Table 3) and full lack of the H3 sequences were coded as ’missing data’. Simultaneous selection of the partition schemes as well as the search for the optimal nucleotide substitution models for the supermatrix obtained was carried out in Partition Finder (Lanfear et al., 2012, 2014) with implementation of the ‘greedy’ search scheme and AIC as a model of criteria selection. According to the best-suggested scheme, the final supermatrix was divided into seven charsets (Table S1, see Appendix). The GTR+I was selected as the best-fit substitution model for 16S by MEGA ver. 6 (Tamura et al., 2013) (Table S1). The uncorrected values of sequence divergence (pairwise distances, p) both within and between groups were calculated in MEGA ver. 6.0. Bayesian inference (BI) was carried out in MrBayes 3.2 (Ronquist et al., 2012) launching two parallel runs with four Markov chains in each run (three cold and one hot) during 2500000 generations. The values of run convergence indicated that the sufficient number of trees and parameters were sampled (Table S1). Based on the convergence of likelihood scores using the software Tracer 1.7 (Rambaut et al., 2018), 25% sampled trees were discarded as burn-in and all the rest were used to form

consensus topology condensing the nodes with posterior probabilities lower than 50%. MrBayes analyses were run on the CIPRES server (Miller et al., 2010). In addition to tree-based species delimitation methods we used an on-line version of ABGD (Castresana, 2000) (http://wwwabi.snv.jussieu.fr/public/abgd/) which relies on a range of prior intraspecific divergence to infer from the data a model-based one-side confidence limit for intraspecific divergence (Puillandre et al., 2012). Based on the 16S matrix, which is the most representative within our single-locus original datasets, the barcoding gap was found as a first significant point beyond this limit. The default range of prior intraspecific variation (0.001–0.1) within 10 steps of search iterations using Simple Distance were set to identify the number of species-range groups. 3. Results 3.1. Molecular phylogenetic analysis We were able to amplify 16S for all species studied. All the 16S received were successfully sequenced, while 18S, 28S, COI, and H3 were not amplified and sequenced for Anobothrus fimbriatus and A. jirkovi sp. nov. specimens (see Table 3). So, these species were not included into phylogenetic analyses based on all markers. The aligned sequences of examined species comprised 395 bp for 16S RNA, 1741 bp for 18S RNA, 988 bp for 28S RNA, 658 for COI and 331 for H3. The Gblocks analysis excluded 27 positions from the 16S alignment, 0 positions from the 18S alignment and 24 positions from the 28S alignment. Species differences within the genus Anobothrus, expressed as p-distances, is presented in Tables S2–S6 (see Appendix). The ABGD analysis of the 16S dataset revealed the discrimination of all the species of Anobothrus analyzed. Seven 16S haplotypes were found among 12 specimens studied. Two haplotypes were found among five A. sonne sp. nov. specimens and two haplotypes among four A. auriculatus sp. nov. specimens. The uncorrected 16S pairwise distances, p revealed low intraspecific divergences varying from 0% to 0.3% within A. sonne sp. nov. and A. auriculatus sp. nov. All the rest haplotypes were unique for each species. Interspecific 16S p-distances were high with 6.8–20.6% sequence divergence. All ten 18S sequences of Anobothrus sonne sp. nov., A. auriculatus sp. nov., and A. patersoni were differed by one nucleotide substitutions, while COI and 28S datasets of these species were strictly specific for each species analyzed. The intraspecific genetic distances within Anobothrus species varied from 0 to 0.6% and from 0 to 0.1%, while the interspecific divergence was in the range 11.1–17.5% and 3.1–3.9%, as inferred from COI and 28S markers,

respectively (Table S2, 5). The separate H3 nuclear marker (Table S4) was not informative enough to demonstrate clear relationships among the species lineages we investigated. The H3 intraspecific genetic distance within Anobothrus species was from 0.3 to 1.5%, while the interspecific distance was in the range 1.5–3.9%. The phylogenetic trees were reconstructed both based on the concatenated matrix consisting of all regions analyzed — 16S RNA, COI, 18S RNA, 28S RNA, and H3 together and for 16S matrix separately, as the most representative in the species studied. The phylogenetic tree based on the concatenated matrix included three species from four ones studied, because the full dataset of markers used were received for Anobothrus sonne sp. nov., A. auriculatus sp. nov., and A. patersoni (Table 3). Figure 2 shows the BI tree based on the concatenated matrix with Sosane wireni and Ampharete falcata as outgroups. All the species of Anobothrus were divided into two clades with full support. One of the clades corresponds to Anobothrus sonne sp. nov., while the other clade includes A. auriculatus sp. nov., A. patersoni, and A. gracilis. This clade is separated into two subclades, one of them is formed by A. auriculatus sp. nov., the other one is divided into two species A. gracilis and A. patersoni with full support. Figure 3 shows the BI tree based on the 16S dataset. All species of the genus Anobothrus correspond to the separate phylogenetic lineages. The tree topology based on the 16S marker (Fig. 3) is generally congruent with the main scheme. 3.2. Systematics In the EBS and AGT samples from KuramBio-I 672 ampharetid specimens of 21 species belonging to 11 genera were found (Alalykina, 2015). The KuramBio-II EBS and AGT samples yielded a total of 1604 Ampharetidae, belonging to 14 genera and at least 35 species. From abyssal depths of the Sea of Okhotsk 4965 ampharetid specimens of 20 species and 13 genera were collected, whereas from only two SokhoBio stations located in the western abyssal slope of the KKT 165 specimens of 20 species and 15 genera of Ampharetidae were sampled (Alalykina, 2018). Most of these ampharetid species are new to science. Among the collected material, the genus Anobothrus is the most common and rich in species. In total, seven Anobothrus species, including the three newly described herein, were registered from the Kuril-Kamchatka Trench area. Two of them have been recently described from the same region (Jirkov, 2009): A. mironovi Jirkov, 2009 considered as bathyal-abyssal widely distributed Pacific species occurring from 880 to 3890 m; and A. patersoni Jirkov, 2009 considered as exclusively abyssal-hadal species inhabiting abyssal to hadal depths (3260–8292 m) of North Pacific and North Atlantic waters. Another one species, A. fimbriatus Imajima, Reuscher & Fiege, 2013, described from the Pacific coast of Hokkaido at depths of ca. 2000 m,

was newly recorded in the western abyssal slope of the KKT at depths of 4681–5009 m. And the last found species, Anobothrus sp., is still being undescribed. In the following the descriptions of three new species from genus Anobothrus are presented from the Kuril-Kamchatka Trench and adjacent abyssal regions.

Family Ampharetidae Malmgren, 1866 Subfamily Ampharetinae Chamberlin, 1919 Anobothrus Levinsen, 1884 Type species: Ampharete gracilis Malmgren, 1866 Synonyms: Anobothrella Hartman, 1967: 155–156, Melythasides Desbruyères, 1978: 232–235, Sosanides Hartmann-Schröder, 1965: 243–246. Generic diagnosis (emended) Prostomium trilobed, Ampharete-type, without glandular ridges. Buccal tentacles smooth or papillated. Three to four pairs of smooth or papillated branchiae; anterior 3 pairs arranged in transverse row with or without gap arising from fused SII–III to SIV segments; fourth pair, if present, situated behind them, arising from SV. Paleal chaetae in SII absent or present; if present, varying in size from regular size to strongly enlarged. Notochaetae in SIII absent or present; if present, varying from reduced to regular size. A pair of nephridial papillae, if present, located behind innermost branchiae or behind some anterior notopodia. Thirteen to fifteen TCh starting at SIII or SIV, 11–12 TU, starting from SVI. Fourth-, fifth- or sixth-to-last thoracic chaetiger with one or combined modifications: elevated notopodia and/or modified notochaeta and/or dorsal ridge. Circular whitish band present before TU1, TU2 or TU3. Thoracic notopodial cirri absent or present. First one or two AU of thoracic type. Abdominal rudimentary notopodia absent. Remarks This emended generic diagnosis combines diagnoses proposed by Jirkov (2009), Reuscher et al. (2009), Imajima et al. (2013), Schüller and Jirkov (2013), and Bonifácio et al. (2015). Here we followed the terminology used by authors mentioned above whereby segment II and III are fused, paleae originate from segment II, and branchiae originate from segments II, III, IV, and V, if all four pairs are present. The present emended diagnosis based on the discovery of mainly new species takes into account additional morphological characters revealed.

Anobothrus auriculatus sp. nov. (Figs. 4–5) Material examined All specimens were collected from the abyssal plain adjacent to the Kuril-Kamchatka Trench (KKT area, KuramBio-I, cruise 223, 5216–5423 m), and from the Kuril-Kamchatka Trench (KKT, KuramBio-II, cruise 250, 5120–9584 m), R/V Sonne. Holotype: MIMB 38795, KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E — 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016. Paratypes: MIMB 38796 (5 specimens), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E — 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; MIMB 38797 (10 specimens), KKT, St. SO250-52 EBS (45°29.77'N 153°12.16'E — 45°29.18'N 153°11.13'E), EtOH, 8737 m, 6 Sep 2016; MIMB 38798 (4 specimens), KKT, St. SO250-77 EBS (45°13.71'N 152°51.21'E — 45°14.21'N 152°49.95'E), EtOH, 9584 m, 13 Sep 2016; MIMB 38799 (7 specimens), KKT, St. SO250-10 EBS (43°49.43'N 151°46.96'E — 43°48.45'N 151°47.17'E), EtOH, 5120 m, 20 Aug 2016; MIMB 38800 (2 specimens), KKT, St. SO250-30 EBS (45°56.38'N 152°56.70'E — 45°56.83'N 152°50.93'E), EtOH, 6181 m, 27 Aug 2016; MIMB 38801 (2 specimens), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; KGB MGU-Pol-22 (6 specimens), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E – 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; KGB MGU-Pol-23 (4 specimens), KKT, St. SO250-55 EBS (45°29.24'N 153°13.46'E – 45°29.58'N 153°12.24'E), EtOH, 8745 m, 6 Sep 2016; KGB MGU-Pol-24 (5 specimens), KKT, St. SO250-77 EBS (45°13.71'N 152°51.21'E – 45°14.21'N 152°49.95'E), EtOH, 9584 m, 13 Sep 2016; KGB MGUPol-25 (8 specimens), KKT, St. SO250-52 EBS (45°29.77'N 153°12.16'E — 45°29.18'N 153°11.13'E), EtOH, 8737 m, 6 Sep 2016; ZM MGU-Pl-973 (6 specimens), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E – 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; ZIN1/50752 (6 specimens), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E – 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; ZIN-2/50753 (6 specimens), KKT, St. SO250-89 EBS (44°40.12'N 151°27.35'E – 44°39.05'N 151°27.34'E), EtOH, 8281 m, 16 Sep 2016; ZIN3/50754 (4 specimens), KKT, St. SO250-77 EBS (45°13.71'N 152°51.21'E – 45°14.21'N 152°49.95'E), EtOH, 9584 m, 13 Sep 2016; ZMH-X1 (6 specimens), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E – 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; ZMH-X2 (2 specimens), KKT, St. SO250-77 EBS (45°13.71'N 152°51.21'E – 45°14.21'N 152°49.95'E), EtOH, 9584 m, 13 Sep 2016; ZMH-X3 (8 specimens), KKT, St. SO250-52 EBS (45°29.77'N 153°12.16'E — 45°29.18'N 153°11.13'E), EtOH, 8737 m, 6 Sep 2016.

Additional material: MIMB S-Pol-06/1-7 (7 specimens on SEM stub), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E — 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; MIMB 38802 (55 specimens), KKT, St. SO250-52 EBS (45°29.77'N 153°12.16'E — 45°29.18'N 153°11.13'E), EtOH, 8737 m, 6 Sep 2016; MIMB 38803 (>140 specimens), KKT, St. SO250-77 EBS (45°13.71'N 152°51.21'E — 45°14.21'N 152°49.95'E), EtOH, 9584 m, 13 Sep 2016; MIMB 38804 (>160 specimens), KKT, St. SO250-17 EBS (45°52.04'N 153°51.39'E — 45°51.40'N 153°50.41'E), EtOH, 8191 m, 22 Aug 2016; MIMB 38805 (1 specimen), KKT area, St. SO2239-9 EBS (40°34.51'N 150°59.92'E — 40°34.25'N 150°59.91'E), EtOH, 5399–5421 m, 23 Aug 2012; MIMB 38806 (8 specimens), KKT, St. SO250-8 EBS (43°49.55'N 151°46.25'E — 43°48.59'N 151°46.47'E), EtOH, 5136 m, 19 Aug 2016; MIMB 38807 (1 specimen), KKT, St. SO250-28 EBS (45°54.43'N 152°47.02'E — 45°54.52'N 152°47.20'E), EtOH, 6051 m, 28 Aug 2016; MIMB 38808 (29 specimens), KKT, St. SO250-40 EBS (45°38.00'N 152°55.95'E — 45°40.83'N 152°57.68'E), EtOH, 7081 m, 29 Aug 2016; MIMB 38809 (12 specimens), KKT, St. SO250-42 EBS (45°39.62'N 152°56.39'E — 45°40.26'N 152°57.63'E), EtOH, 7123 m, 30 Aug 2016; MIMB 38810 (6 specimens), KKT, St. SO250-42 EBS (45°39.62'N 152°56.39'E — 45°40.26'N 152°57.63'E), Form–EtOH, 7123 m, 30 Aug 2016; MIMB 38811 (27 specimens), KKT, St. SO250-55 EBS (45°29.24'N 153°13.46'E — 45°29.58'N 153°12.24'E), EtOH, 8745 m, 6 Sep 2016; MIMB 38812 (3 specimens), KKT, St. SO250-87 EBS (45°00.76'N 151°05.53'E — 45°01.65'N 151°05.52'E), EtOH, 5492 m, 16 Sep 2016; MIMB 38813 (37 specimens), KKT, St. SO250-89 EBS (44°40.12'N 151°27.35'E — 44°39.05'N 151°27.34'E), EtOH, 8221 m, 16 Sep 2016; MIMB 38814 (1 specimen), KKT, St. SO250-89 EBS (44°40.12'N 151°27.35'E — 44°39.05'N 151°27.34'E), Form–EtOH, 8221 m, 16 Sep 2016; MIMB 38815 (29 specimens), KKT, St. SO250-97 EBS (44°05.68'N 151°24.88'E — 44°06.94'N 151°24.88'E), EtOH, 6575 m, 18 Sep 2016; MIMB 38816 (1 specimen), KKT, St. SO250-6 BC (43°49.197'N 151°45.609'E), Form–EtOH, 5497 m, 18 Aug 2016; MIMB 38817 (1 specimen), KKT, St. SO250-14 BC (45°50.879'N 153°47.991'E), Form–EtOH, 8251 m, 21 Aug 2016; MIMB 38818 (1 specimen), KKT, St. SO250-67 BC (45°12.944'N 152°42.844'E), Form–EtOH, 9495 m, 10 Sep 2016; MIMB 38819 (2 specimens), KKT, St. SO250-75 BC (44°39.883'N 151°28.136'E), Form–EtOH, 8221 m, 12 Sep 2016; MIMB 38820 (3 specimens), KKT, St. SO250-79 BC (45°12.99'N 152°42.76'E), Form–EtOH, 9428 m, 13 Sep 2016; MIMB 38821 (3 specimens), KKT, St. SO250-82 BC (45°01.363'N 151°02.899'E), Form–EtOH, 5220 m, 14 Sep 2016; MIMB 38822 (1 specimen), KKT, St. SO250-100 BC (44°12.31'N 150°39.08'E), Form–EtOH, 9412 m, 20 Sep 2016.

Diagnosis The species can be recognized by its prominent paleal structure originating from high epidermal folds resembling ears, and by the presence of only one pair of abdominal neuropodia of thoracic type (instead of two as usual). Description (based on the holotype and paratypes) Holotype complete, 14 mm long, 0.8 mm wide; all branchiae missing. Paratypes (complete specimens) ranging from 5 to 18 mm long, 0.3–1 mm wide. Paratype MIMB 38798 with branchiae. Preserved specimens whitish, with or without pigment patterns on prostomium. Prostomium trilobed, anteriorly rounded, Ampharete-type (Figs. 4A–C), usually with two dark fields on prostomium. Buccal tentacles papillated (Fig. 5H). Paleae well developed, originating from high epidermal fold resembling ear (Figs. 4C and 5E). Inner side of each paleal epidermal fold fused with outer pair of branchiophores (Figs. 4C, 5A–C and R). Paleal chaetae (up to 40) with finely serrated (visible under SEM) gradually tapering long tips (Figs. 5D–G), arranged in semicircle, of the same width and length as the most developed notochaetae, but only half of their length protruding paleal epidermal fold (Fig. 5E). Three pairs of branchiae without median gap. Branchiophores (inner, middle and outer pairs) arranged in transversal line forming a prominent fold. Inner pair of branchiophores connected with notopodia of S4 (TCh2), both lateral (medial and outer) pairs not showing any distinct connection with segments. All branchiophores smooth, outer pair usually slightly smaller in diameter than two others (middle and inner) (Figs. 5R). All branchiostyles smooth. Middle and outer pairs of branchiae with branchiostyles longer than inner one. Inner pair of branchiostyles bent dorsally, extending to TCh10–12. Outer pair longer than remaining ones, bent dorsally, extending to TCh12–14. Seventeen TS, 15 TCh, and 12 TU. Notopodia of SIII (TCh1) reduced, with small lobes, few (3–4) thin, long notochaetae, located directly behind paleae, and completely covered by these (Figs. 5A, B, D, and O). Notopodia of SIV (TCh2) with rounded to elongate lobes, reduced in size, smaller than subsequent ones, with well-developed notochaetae (Figs. 4B, C, 5A, B, D, and O). Fifth-to-last pair of notopodia (TCh11, TU8) modified Anobothrus-type, slightly elevated and connected dorsally with low glandular ridge (Figs. 4A, 5I), notochaetae and neuropodial uncini not modified. Notopodia of last thoracic chaetiger (TCh15) with small elongated dorsal cirri (Figs. 4D, F, 5J, L). Thoracic neuropodial tori from TCh4 (SVI), whitish in methylene blue staining, slightly decreasing in size towards posterior. Circular glandular band before TU1 (Figs. 4A–C). One pair of nephridial papillae, not separated by gap, located behind base of innermost pair of branchiae.

Abdomen with 12 AU. Neuropodia of first abdominal unciniger (AU1) of thoracic type (Figs. 4D, 5J). Abdominal neuropodia from AU2 to posterior end forming distinct, prolonged erect pinnules with uncini in marginal position (Figs. 4A, D, 5G). Rudimental abdominal notopodia and neuropodial cirri absent. Notochaetae simple, arranged in two rows, anterior row with short chaetae, posterior row with chaetae about twice as long (Fig. 5K). All notochaetae on both modified (Figs. 5K, P) and normal (Fig. 5Q) notopodia covered with scales. TU1 with up to 30, TU8 with 23–25, TU12 with up to 21 uncini per neuropodium. Thoracic uncini pectinate, with 6–7 teeth in lateral view (Fig. 4G), arranged in 5 vertical rows in frontal view (Fig. 5M). AU1 with up to 20, AU2 with 30–40, AU10 with up to 30 uncini per neuropodium. Abdominal uncini pectinate, with 4–5 teeth in lateral view (Fig. 4G), arranged in 6–7 vertical rows in frontal view (Fig. 5N). Pygidium with small rounded papillae (Fig. 4E). Tube thin-walled, muddy. Remarks Anobothrus auriculatus sp. nov. differs from other known Anobothrus species with three pairs of branchiae (A. dayi Imajima, Reuscher & Fiege, 2013, A. flabelligerulus Imajima, Reuscher & Fiege, 2013, and A. laubieri (Desbruyères, 1978)) in having paleae originating from prominent ear-shaped epidermal folds, the presence of a circular white band before TU1 (instead of TU2 or TU3), in having small dorsal cirri at the last pair of notopodia, and in having only one pair of abdominal neuropodia of thoracic type (instead of two as usual). Paleae originating from a similar distinct disc-like structure are only known for A. paleaodiscus Schüller & Jirkov, 2013, an abyssal species described from the Southern Ocean. However, A. paleaodiscus has four pairs of branchiae, and very conspicuous paleae that are very stout and much longer than those of A. auriculatus sp. nov. Etymology The specific epithet comes from the Latin auricula – ear, and -atus – provided with or having the nature of, in reference to the shape of the paleal structure. Distribution Northwest Pacific, Kuril–Kamchatka Trench and adjacent abyssal plain, 5120–9584 m (Fig. 1B).

Anobothrus jirkovi sp. nov. (Figs. 6, 7A–O) Material examined Holotype: MIMB 38787, western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-10 AGT (46°16.415'N 152°03.040'E — 46°16.719'N 152°03.878'E), Form–EtOH, 3360–3361 m, 27 Jul 2015. Paratypes: MIMB 38788 (1 specimen), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377 m, 26 Jul 2015; MIMB 38789 (1 specimen), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377 m, 26 Jul 2015; MIMB 38790 (1 specimen), KKT area, KuramBio-I, RV Sonne, cr. 223, St. SO223-4-3 EBS (46°58.34'N 154°33.39'E — 46°58.46'N 154°33.03'E), EtOH, 5681– 5780 m, 6 Aug 2012; MIMB 38791 (1 specimen), KKT, KuramBio-II, RV Sonne, cr. 250, St. SO250-10 EBS (43°49.43'N 151°46.96'E — 43°48.45'N 151°47.17'E), EtOH, 5120 m, 20 Aug 2016; MIMB 38792 (9 specimens), KKT, KuramBio-II, RV Sonne, cr. 250, St. SO250-85 EBS (45°02.26'N 151°02.14'E — 45°01.64'N 151°03.68'E), EtOH, 5265 m, 15 Sep 2016; KGB MGU-Pol-26 (2 specimens), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377 m, 26 Jul 2015; KGB MGU-Pol-27 (4 specimens), KKT, KuramBio-II, RV Sonne, cr. 250, St. SO250-85 EBS (45°02.26'N 151°02.14'E — 45°01.64'N 151°03.68'E), EtOH, 5265 m, 15 Sep 2016; ZM MGU-Pl-974 (1 specimen), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377 m, 26 Jul 2015; ZIN-1/50755 (2 specimens), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377 m, 26 Jul 2015; ZIN-2/50756 (1 specimen), KKT area, KuramBio-I, RV Sonne, cr. 223, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; ZIN-3/50757 (5 specimens), KKT, KuramBio-II, RV Sonne, cr. 250, St. SO250-85 EBS (45°02.26'N 151°02.14'E — 45°01.64'N 151°03.68'E), EtOH, 5265 m, 15 Sep 2016; ZMH-X1 (3 specimens), KKT, KuramBio-II, RV Sonne, cr. 250, St. SO250-85 EBS (45°02.26'N 151°02.14'E — 45°01.64'N 151°03.68'E), EtOH, 5265 m, 15 Sep 2016.

Additional material: MIMB S-Pol-07/1–2 (2 specimens on SEM stub), KKT area, KuramBio-I, RV Sonne, cr. 223, St. SO223-4-3 EBS (46°58.34'N 154°33.39'E — 46°58.46'N 154°33.03'E), Form–EtOH, 5681–5780 m, 6 Aug 2012; MIMB S-Pol-07/3 (1 specimen on SEM stub), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377, 26 Jul 2015; MIMB 38793 (1 specimen), KKT, KuramBio-II, RV Sonne, cr. 250, St. SO250-8 EBS (43°49.55'N 151°46.25'E — 43°48.59'N 151°46.47'E), EtOH, 5136 m, 19 Aug 2016; MIMB 38794 (2 specimens), western abyssal slope of the KKT, SokhoBio, RV Akademik M.A. Lavrentyev, cr. 71, St. Sokh-9-7 EBS (46°16.164'N 152°03.095'E — 46°16.070'N 152°03.324'E), Form–EtOH, 3371–3377, 26 Jul 2015. Diagnosis The species is characterized by its rather prominent lower lip, and fleshy cup-shaped paleal base, dark colored in methylene blue staining. Description (based on the holotype and paratypes) Holotype complete, but broken in abdominal region, located inside its tube, 8 mm long, 0.8 mm wide; all branchiae missing. Paratypes (complete specimens) ranging from 5 to 8 mm long, 0.5–0.8 mm wide. Preserved specimens whitish, with or without pigment patterns on prostomium. Prostomium trilobed, anteriorly rounded, Ampharete-type, usually with two dark fields on prostomium. Buccal tentacles papillated. Lower lip rather enlarged, broad (Fig. 6A, B). Paleae (up to 12–13) well developed, much longer and slightly thicker than most developed notochaetae, gradually tapering long capillaries, anteriorly surpassing the prostomium (Figs. 6A, B, D, 7B, C, E). Paleal chaetae arranged in semicircle, originating from fleshy cupshaped base (Figs. 6D, E, 7E) with central dermal hump (dark colored in methylene blue staining). Three pairs of branchiae without median gap. Branchiophores (inner, middle and outer pairs) arranged in transversal line forming a fold. Inner pair of branchiophores connected with notopodia of S4 (TCh2), both lateral (medial and outer) pairs not showing any distinct connection with segments. All branchiophores smooth, approximately equal in diameter (Figs. 6D, 7C, D). All branchiostyles smooth, cirriform. Inner pair of branchiae with branchiostyles distinctly shorter than middle and outer ones. Middle pair longer than remaining ones (Figs. 7A, D).

Seventeen TS, 15 TCh, and 12 TU. Notopodia of SIII (TCh1) reduced, with small lobes (visible under SEM), and few well developed notochaetae. Notopodia of SIV (TCh2) with rounded to elongate lobes, reduced in size, smaller than subsequent ones, with well-developed notochaetae (Figs. 6D, E, 7E). Fifth-to-last pair of notopodia (TCh11, TU8) modified Anobothrus-type, slightly elevated and connected dorsally with low glandular ridge (Figs. 6A, 7H), notochaetae and neuropodial uncini not modified. Thoracic neuropodial tori from TCh4 (SVI), whitish in methylene blue staining, gradually decreasing in size towards posterior. Anterior thoracic neuropodia about twice as long as posterior ones. Circular glandular band before TU3 (Figs. 6A, B). One pair of nephridial papillae, not separated by gap, located behind base of innermost pair of branchiae (Figs. 7B, C). Abdomen with 12 AU. Neuropodia of first two abdominal uncinigers (AU1 and AU2) of thoracic type (tori instead of pinnules). Neuropodial lobe forming pinnules from AU3 to posterior end. Rudimental abdominal notopodia and neuropodial cirri absent. Notochaetae simple, arranged in two rows, anterior row with short chaetae, posterior row with chaetae about twice as long (Figs. 7J, K). All notochaetae on both modified and normal notopodia covered with scales, bilimbate in upper half (Figs. 6G, 7K, L). TU1 with up to 60, TU8 with up to 40, TU12 with up to 35 uncini per neuropodium. Thoracic uncini pectinate, with 5–6 teeth in lateral view (Fig. 6F), arranged in 3 vertical rows in frontal view (Fig. 7M). AU1 with up to 35, AU3 with up to 20 uncini per neuropodium. Abdominal uncini pectinate, with 4–5 teeth in lateral view (Fig. 6F), arranged in 6–7 vertical rows in frontal view (Fig. 7O). Pygidium with two prominent lateral lobes and 3–4 small rounded dorsal papillae (Figs. 6C, 7 I). Tube thin-walled, densely covered with sand grains and sponge spicules, protruding above its surface. Remarks Most specimens are incomplete; most complete specimens are broken in abdomen and located inside their tubes. The new species is similar to the deep water Arctic species A. laubieri in having 3 pairs of branchiae, and the same number of thoracic and abdominal chaetigers. The two species also share morphology (long and thin gradually tapering capillaries) and number (up to 15) of paleal chaetae. The new species differs from A. laubieri by the presence of a circular white band before TU3, rather than before TU2, by the presence of papillated buccal tentacles instead of smooth ones, by the presence of smooth tips of the paleal chaetae instead of finely serrated ones (visible under SEM, see Fig. 7R), and in having one pair of nephridial papillae not separated by a gap

(papillae located very close to each other behind the base of innermost pair of branchiae) instead of pair of nephridial papillae separated by a wide gap (located behind middle pair of branchiae) (Fig. 7P). Igor Jirkov (2001) has examined the holotype and paratypes of A. laubieri and revealed that the species has one pair of nephridial papillae separated by a wide gap, rather than without a gap, as stated in the original description. Examination of the specimens of A. laubieri from the Norwegian Sea (RV Sevastopol, cr. 15, St. 2489 (67°30'N 00°00'E), 3760 m, 1959, det. I. Jirkov), conducted under SEM (Figs. 7P–U), confirms his opinion. The only other species with 3 pairs of branchiae and a circular white band before TU3, A. flabelligerulus, has fourth-to-last pair of notopodia (TU9) modified Anobothrus-type, 14TCh, and 10AU. Etymology The species is named after Igor Jirkov, in recognition of his extensive research on the taxonomy of ampharetid polychaetes. Distribution Northwest Pacific, Kuril–Kamchatka Trench and adjacent abyssal plain, 3360–5780 m (Fig. 1B).

Anobothrus sonne sp. nov. (Figs. 8–10) Material examined All specimens were collected from the Kuril-Kamchatka Trench area on board R/V Sonne, cruise 223 (KuramBio-I) and 250 (KuramBio-II), and from the Kuril Basin (KB) of the Sea of Okhotsk on board RV Akademik M.A. Lavrentyev, cr. 71 (SokhoBio). Holotype: MIMB 38774, KKT, St. SO250-28 EBS (45°54.43'N 152°47.02'E — 45°54.52'N 152°47.20'E), EtOH, 6051 m, 26 Aug 2016. Paratypes: MIMB 38775 (2 specimens), KKT, St. SO250-28 EBS (45°54.43'N 152°47.02'E — 45°54.52'N 152°47.20'E), EtOH, 6051 m, 26 Aug 2016; MIMB 38776 (5 specimens), KKT area, St. SO223-4-3 EBS (46°58.34'N 154°33.03'E — 46°58.46'N 154°33.39'E), EtOH, 5681–5780 m, 6 Aug 2012; MIMB 38777 (3 specimens; 1 spec. with branchiae), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; MIMB 38778 (10 specimens), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; MIMB 38779 (20 specimens), KB of the Okhotsk Sea, St. Sokh-4-9 EBS (47°12.127'N 149°37.136'E — 47°11.951'N

149°36.990'E), EtOH, 3366 m, 17 Jul 2015; MIMB 38780 (25 specimens), KB of the Okhotsk Sea, St. Sokh-2-8 EBS (46°41.094'N 147°27.386'E — 46°41.157'N 147°27.710'E), Form–EtOH, 3351–3352, 13 Jul 2015; KGB MGU-Pol-28 (2 specimens), KKT, St. SO250-28 EBS (45°54.43'N 152°47.02'E — 45°54.52'N 152°47.20'E), EtOH, 6051 m, 26 Aug 2016; KGB MGU-Pol-29 (7 specimens), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; KGB MGU-Pol-30 (20 specimens), KB of the Okhotsk Sea, St. Sokh-4-9 EBS (47°12.127'N 149°37.136'E — 47°11.951'N 149°36.990'E), EtOH, 3366 m, 17 Jul 2015; KGB MGU-Pol-31 (10 specimens), KB of the Okhotsk Sea, St. Sokh-2-8 EBS (46°41.094'N 147°27.386'E — 46°41.157'N 147°27.710'E), Form–EtOH, 3351–3352, 13 Jul 2015; ZM MGU-Pl-975 (7 specimens), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376– 5380 m, 11 Aug 2012; ZM MGU-Pl-976 (10 specimens), KB of the Okhotsk Sea, St. Sokh-2-8 EBS (46°41.094'N 147°27.386'E — 46°41.157'N 147°27.710'E), Form–EtOH, 3351–3352, 13 Jul 2015; ZIN-1/50758 (3 specimens), KKT area, St. SO223-4-3 EBS (46°58.34'N 154°33.03'E — 46°58.46'N 154°33.39'E), EtOH, 5681–5780 m, 6 Aug 2012; ZIN-2/50759 (5 specimens), KKT area, St. SO223-3-9 EBS (47°14.66'N 154°42.88'E — 47°14.76'N 154°43.03'E), EtOH, 4987–4991 m, 5 Aug 2012; ZIN-3/50760 (7 specimens), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; ZIN4/50761 (15 specimens), KB of the Okhotsk Sea, St. Sokh-4-9 EBS (47°12.127'N 149°37.136'E — 47°11.951'N 149°36.990'E), EtOH, 3366 m, 17 Jul 2015; ZIN-5/50762 (10 specimens), KB of the Okhotsk Sea, St. Sokh-2-8 EBS (46°41.094'N 147°27.386'E — 46°41.157'N 147°27.710'E), Form–EtOH, 3351–3352, 13 Jul 2015; ZMH-X1 (7 specimens), KKT area, St. SO223-5-9 EBS (43°34.46'N 153°58.13'E — 43°34.30'N 153°58.16'E), EtOH, 5376–5380 m, 11 Aug 2012; ZMH-X2 (15 specimens), KB of the Okhotsk Sea, St. Sokh-4-9 EBS (47°12.127'N 149°37.136'E — 47°11.951'N 149°36.990'E), EtOH, 3366 m, 17 Jul 2015; ZMH-X3 (10 specimens), KB of the Okhotsk Sea, St. Sokh-2-8 EBS (46°41.094'N 147°27.386'E — 46°41.157'N 147°27.710'E), Form–EtOH, 3351–3352, 13 Jul 2015. Additional material: MIMB S-Pol-05/1-6 (6 specimens on SEM stub), KKT, St. SO250-87 EBS (45°00.76'N 151°05.53'E — 45°01.65'N 151°05.52'E), EtOH, 5492 m, 16 Sep 2016; MIMB 38781 (226 specimens), KB of the Okhotsk Sea, St. Sokh-4-9 EBS (47°12.127'N 149°37.136'E — 47°11.951'N 149°36.990'E), EtOH, 3366 m, 17 Jul 2015; MIMB 38782 (130 specimens), KB of the Okhotsk Sea, St. Sokh-2-8 EBS (46°41.094'N 147°27.386'E — 46°41.157'N 147°27.710'E), Form–EtOH, 3351–3352 m, 13 Jul 2015; MIMB 38783 (156 specimens), KB of the Okhotsk Sea, St. Sokh-7-4 EBS (46°57.466'N 151°05.068'E — 46°57.494'N 151°04.917'E), Form–EtOH, 3300 m, 22 Jul 2015; MIMB 38784 (80 specimens), KB of the Okhotsk Sea, St.

Sokh-6-7 EBS (48°03.234'N 150°00.468'E — 48°03.122'N 150°00.145'E), Form–EtOH, 3350– 3351 m, 20 Jul 2015; MIMB 38785 (7 specimens), KB of the Okhotsk Sea, St. Sokh-1-4 BC (46°09.053'N 145°59.924'E), Form–EtOH, 3305 m, 9 Jul 2015; MIMB 38786 (94 specimens), KB of the Okhotsk Sea, St. Sokh-1-9 EBS (46°05.037'N 146°00.465'E — 46°08.727'N 146°00.227'E), Form–EtOH, 3307 m, 10 Jul 2015. Diagnosis The species is recognized by the presence of papillate ventral fold originating from fused SII–III, and the outermost pair of rounded tubercles located between paleae and the outer pair of branchiophores, giving the erroneous impression that the species bears four pairs of branchiae. Description (based on the holotype and paratypes) Holotype complete, 7 mm long, 0.5 mm wide, with two large dark fields on prostomium; all branchiae missing. Paratypes (complete specimens) ranging from 5 to 8 mm long, 0.25–0.5 mm wide. Paratype MIMB 38777 with branchiae. Preserved specimens whitish, with or without pigment patterns on prostomium. Prostomium trilobed, anteriorly rounded, Ampharete-type (Figs. 8A–C, 9A, C, D), usually with two large dark fields on prostomium. Buccal tentacles papillated (Fig. 9G). Paleae (up to 15) well developed, longer and wider than most developed notochaetae, flat in basal and median parts, with gradually tapering long tips (Figs. 8C, E and 10A, B). Three pairs of branchiae without median gap. Branchiophores (inner, middle and outer pairs), and one pair of outermost rounded tubercles located between paleae and outer pair of branchiophores (Figs. 8C, E and 9B, indicated by arrow) arranged in transversal line forming a high fold. Inner pair of branchiophores connected with notopodia of S4 (TCh1), both lateral (medial and outer) pairs and outermost pair of tubercles originating from fused SII–III. All branchiophores smooth, medial one of each group approx. 1.5 times wider and slightly longer than others (Figs. 8C, E and 9B). All branchiostyles smooth. Middle and outer pairs of branchiae with branchiostyles longer and thicker than inner one. Inner pair of branchiostyles bent dorsally, extending to TCh3–4. Middle pair longer and thicker than remaining ones, bent dorsally, extending to TCh6–7. Seventeen TS, 14 TCh, and 12 TU. Fused SII–III with paleae, three pairs of branchiophores, one pair of outermost rounded tubercles, and ventral fold with 8–12 rounded papillae (Figs. 8A–C and 9A, C–F). Notopodia of SIII absent, without notochaetae. Notopodia of SIV (TCh1) small, with well-developed notochaetae (Figs. 9C, D). Fifth-to-last pair of notopodia (TCh10, TU8) modified Anobothrus-type, slightly elevated and connected dorsally with low

glandular ridge (Figs. 8A and 9A, H), notochaetae and neuropodial uncini not modified. Thoracic neuropodial tori from TCh3 (SVI), whitish in methylene blue staining, slightly increasing in size towards posterior. Circular glandular band before TU2 (Figs. 8A, B). One pair of nephridial papillae, not separated by gap, located behind base of innermost pair of branchiae, and nephridial papillae behind notopodia of TU1 and TU2 visible under SEM (Figs. 8C and 9J). Abdomen with 12 AU. Neuropodia of first two abdominal uncinigers (AU1 and AU2) of thoracic type (tori instead of pinnules, Figs. 9H and 10K). Rudimental abdominal notopodia and neuropodial cirri absent. Notochaetae simple, bilimbate in upper half (Fig. 8F), arranged in two rows, anterior row with short chaetae, posterior row with chaetae about twice as long (Fig. 9C, D). All notochaetae on both modified (Figs. 8F and 10C, D) and normal (Fig. 10L) notopodia covered with scales. TU with up to 17 pectinate uncini per neuropodium, with 6–7 teeth in lateral view (Fig. 8G), arranged in 5–6 vertical rows in frontal view (Figs. 9E, H). AU3 with 15 pectinate uncini per neuropodium, with 4–5 teeth in lateral view (Fig. 8H), arranged in 5–6 vertical rows in frontal view (Fig. 10F). AU7 with 12 uncini per neuropodium (Fig. 10G), and posteriormost abdominal neuropodia (AU10–12) with 6–7 pectinate uncini only of the same kind (Fig. 10I, J). Pygidium with two large lateral lobes, small rounded dorsal (5–7), and ventral (3–4) papillae (Figs. 8D; 9I). Tube thin-walled, muddy. Remarks Anobothrus sonne sp. nov. differs from other known Anobothrus species with three pairs of branchiae (A. dayi, A. flabelligerulus, and A. laubieri) in having a papillate ventral fold originating from fused SII–III, and the outermost pair of rounded tubercles located between paleae and the outer pair of branchiophores. The new species is most similar to the deep water species A. laubieri in the presence of a circular white band before TU2 and a similar number of paleal chaetae (up to 15), however, A. sonne sp. nov. has 14 TCh instead of 15 TCh in A. laubieri. In the deep-sea NW Pacific, small specimens of A. jirkovi sp. nov. can be easily mistaken for small size species A. sonne sp. nov. at first sight. Despite the presence of many differences between these species, most of the differences are hardly visible in small specimens (number of TCh, position of the circular band, presence of the ventral fold). The easiest way to separate them is to use the differences in methylene blue staining. Methylene blue staining pattern of A. jirkovi sp. nov. shows dark colored prechaetal cup-shaped paleal base and postchaetal central dermal hump, rather than A. sonne sp. nov. has dark colored only outermost pair of rounded tubercles located behind paleae.

Etymology This species is named for the German research vessel Sonne used to collect the material. Distribution Northwest Pacific, abyssal Kuril Basin of the Sea of Okhotsk, Kuril–Kamchatka Trench and adjacent abyssal plain, 3300–7123 m (Fig. 1B).

Key to the species of the genus Anobothrus world-wide Twenty species of the genus, including Anobothrus nasuta (Ehlers, 1887), are listed in the WoRMS database (Read and Fauchald, 2019). However, A. nasuta, originally described in the genus Amphicteis, is supposed to belong to another genus (Jirkov, 2009; Schüller and Jirkov, 2013; Bonifácio et al., 2015), and, therefore, is excluded from the species list (Table 5) and the following key. Currently, the genus Anobothrus accounts for 22 species, including the new species here proposed. More than half of them (13 species) are registered in the North Pacific, mainly in its northwestern part (see Table 5). In total, nine Anobothrus species are reported for the NW Pacific, including the most common and widely distributed species A. gracilis inhabiting shelf and slope depths. Other two NW Pacific species, A. dayi and A. flabelligerulus, seem to be restricted to shelf waters (<50 to 800 m), while A. mironovi, A. fimbriatus, and A. jirkovi sp. nov. were found at bathyal-abyssal depths (850–5780 m). The remaining three species, A. patersoni, A. auriculatus sp. nov., and A. sonne sp. nov., considered as exclusively abyssal-hadal species occur up to 9584 m.

1. —

3 pairs of branchiae ………………………………………………….……….………….. 2 4 pairs of branchiae ……………………………………………………………………… 7

2. —

Branchiae with wide median gap …………………………………..……………... A. dayi Branchiae without median gap ……………………………….……….………………… 3

3. —

Modified notopodia on TU8 …………………………………………………………….. 4 Modified notopodia on TU9 ……………………………………………. A. flabelligerulus

4. —

First one AU of thoracic type …………………….………………. A. auriculatus sp. nov. First two AU of thoracic type …………………………..……………………………….. 5

5. —

Circular band anterior to parapodia of TU2 ….…………………………………………. 6 Circular band anterior to parapodia of TU3 …….…………………….. A. jirkovi sp. nov.

6. —

Fused SII–III with papillate ventral fold; 14TCh ……...……….………. A. sonne sp. nov. Fused SII–III without ventral fold; 15TCh ...………………………….………. A. laubieri

7. —

Paleae absent …………………………………………………………………………….. 8 Paleae present ……………………………………………………………………………. 9

8. —

Lower lip enlarged, with distinct furrows and crenulated edge …………….. A. fimbriatus Lower lip not enlarged, rounded …………………………………………..… A. apaleatus

9. —

11 TU ………………………………………………………………...………………… 10 12 TU ………………………………………………………………………………..…. 11

10. —

Modified notopodia on TU6 ……………………………………….……... A. bimaculatus Modified notopodia on TU7 …………………………………………………… A. mancus

11. —

Modified notopodia on TU8 …………………………………………………………… 12 Modified notopodia on TU9 …………………………………………..……… A. paleatus

12. — —

Circular band anterior to parapodia of TU1 ………………………….…… A. patagonicus Circular band anterior to parapodia of TU2 …………………………………………… 13 Circular band anterior to parapodia of TU3 ………………………………………..….. 14

13.

Two outer pairs of branchiophores distinctly narrower than inner; paleae fine, slimmer than most developed notochaetae, colourless …………………………..……. A. wilhelmi All pairs of branchiophores equal in diameter; paleae stout, wider than most developed notochaetae, reddish …………………………………………………….. A. rubropaleatus

— 14. —

Fourth pair of branchiophores two times slimmer and shorter than others, branchiostyles at least ten times shorter than others …………………………………………. A. patersoni Fourth pair of branchiophores of same length as others .………………………………. 15

15. —

Papillated branchiostyles present ………………….……………………….………….. 16 All branchiostyles smooth ………………………………………………………….….. 17

16. —

All branchiostyles papillated, 15TCh ………………………….…………… A. antarctica Inner pair of branchiostyle papillated, others smooth, 14TCh …..………… A. amourouxi

17. —

Paleae originating from a prominent disc-like epidermal structure, very long and stout ………………………………………………………………………….… A. paleaodiscus A prominent paleal disc-like epidermal structure absent ………………………………. 18

18. —

Paleal chaetae abruptly tapering to a delicate tip …..….……………. A. pseudoampharete Paleal chaetae gradually tapering ……………………………………………….……… 19

19. —

12AU …………………………………………………………………………………… 20 13AU ………………………………………………………………………..…. A. gracilis

20.

Inner pair of branchiophores almost 1.5 times slimmer than others, all notochaetae on both modified and normal notopodia smooth …………..……………………. A. mironovi All branchiophores of equal size, notochaetae of modified notopodia covered with scales, others smooth ……………………………………………………….……... A. glandularis

—

Acknowledgements We would like to thank the crews of the R/V Sonne and R/V Akademik M.A. Lavrentyev for help on board as well as the participants of the KuramBio-II and SokhoBio expeditions for collecting and sorting the deep-sea material, initial sorting of macrobenthic samples and making the studied polychaete species available. The authors thank Dr. I.A. Jirkov (Moscow State

University) for additional material, Dr. A.S. Maiorova (MIBM, Vladivostok) for SEM procedure assistance. The comments of the anonymous reviewers greatly improved the quality of the paper. The SokhoBio and both KuramBio I and II projects were funded by the German Ministry for Science and Education (BMBF grants 03G0223A and 03G0250A to Prof. Dr. Angelika Brandt, University of Hamburg, now Senckenberg Museum, Frankfurt, Germany), and by the Russian Ministry of Science and Education (Project 14.616.21.0077). This is KuramBio II publication #

.

Appendix A. Supplementary material Supplementary data to this article can be found online at https://

References Alalykina, I.L., 2015. Polychaete composition from the abyssal plain adjacent to the KurilKamchatka Trench with the description of a new species of Sphaerephesia (Polychaeta: Sphaerodoridae). Deep-Sea Res. II 111, 166–174. Alalykina, I.L., 2018. Composition of deep-sea polychaetes from the SokhoBio expedition with the description of a new species of Labioleanira (Annelida: Sigalionidae) from the Sea of Okhotsk. Deep-Sea Res. II 154, 140–158. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25, 3389–3402. Belyaev, G.M., 1983. Investigation of ultraabyssal fauna. Research Vessel Vitjaz and her expeditions 1949-1979. Moscow: Nauka, 258–267 (In Russian). Belyaev, G.M., 1989. Deep-sea Ocean trenches and their Fauna, 2004. Nauka Publishing, M., 1– 255 (In Russian). Brandt, A., Alalykina, I., Brix, S., Brenke, N., Błażewicz, M., Golovan, O., Johannsen, N., Hrinko, A.M., Jażdżewska, A.M., Jeskulke, K., Kamenev, G.M., Lavrenteva, A.V., Malyutina, M.V., Riehl, T., Lins, L., 2019. Depth zonation of deep-sea macrofauna the Northwest Pacific. In this issue. https://doi.org/10.1016/j.pocean.2019.102131. Bonifácio, P., Lavesque, N., Bachelet, G., Parapar, J., 2015. Anobothrus amourouxi sp. nov., a new species of Ampharetidae (Polychaeta) from the Capbreton Canyon (Bay of Biscay, NE Atlantic Ocean). Journal of the Marine Biological Association of the United Kingdom 95(5), 961–969. https://doi.org/10.1017/s0025315414002094. Castresana, J., 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17, 540–552. Chamberlin, R.V., 1919. The Annelida Polychaeta. Memoirs of the Museum of Comparative Zoology at Harvard College 48, 1–514. Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston,S.P., Edgecombe, G.D., Macaranas, J., Gray, M.R., 1998. Histone H3 and U2 snRNA DNA sequences and arthropod molecular

evolution.

Australian

Journal

of

Zoology

46,

419–437.

https://doi.org/10.1071/ZO98048. Desbruyères, D., 1978. Melythasides laubieri gen. sp. nov. Ampharetidae (Annélides Polychètes sédentaires) abyssal de la mer de Norvège. Bulletin du Muséum d'Histoire Naturelle, Paris, Ser. 3, 353(514), 231–238.

Eilertsen, M.H., Kongsrud, J.A., Alvestad, T., Stiller, J., Rouse, G.W., 2017. Do ampharetids take sedimented steps between vents and seeps? Phylogeny and habitat-use of Ampharetidae (Annelida, Terebelliformia) in chemosynthesis-based ecosystems. BMC Evolutionary Biology 17, 1–15. https://doi.org/10.1186/s12862-017-1065-1. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R.C., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294–299. Giribet, G., Carranza, S., Baguna, J., Riutort, M., Ribera, C., 1996. First molecular evidence for the existence of a Tardigrada C Arthropoda clade. Molecular Biology and Evolution 13(1), 76–84. Hartman, O., 1967. Polychaetous annelids collected by the USNS ELTANIN and Staten Island cruises, chiefly from Antarctic Seas. Allan Hancock Monographs of Marine Biology 2, 1–387. Hartmann-Schröder, G., 1965. Zur Kenntnis des Sublitorals der chilenischen Kuste unter besondere Berücksichtigung der Polychaeten und Ostracoden. Mitteilungen des Hamburgischen Zoologischen Museums und Instituts 62, 1–384. Hilbig, B., 2000. Family Ampharetidae Malmgren, 1867. In: Blake, J.A., Hilbig, B. & Scott, P.V. Taxonomic Atlas of the Benthic Fauna of the Santa Maria Basin and Western Santa Barbara Channel. 7 - The Annelida Part 4. Polychaeta: Fabelligeridae to Sternaspidae. Santa Barbara Museum of Natural History. Santa Barbara, 169–230. Imajima M., Reuscher M.G., Fiege D., 2013. Ampharetidae (Annelida: Polychaeta) from Japan. Part II: Genera with elevated and modified notopodia. Zootaxa 3647, 137–166. Jirkov, I.A., 2001. Polychaeta of the Arctic Ocean. Yanus-K Press, Moscow, 632 pp. (In Russian). Jirkov, I.A., 2009. Revision of Ampharetidae (Polychaeta) with modified thoracic notopodia. Invertebrate Zoology 5(2), 111–132. Jirkov, I.A., 2011. Discussion of taxonomic characters and classification of Ampharetidae (Polychaeta). Ital. J. Zool. 78 (Suppl. 1), 78–94. http://dx.doi.org/10.1080/11250003.2011.617216. Katoh K., Standley D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30(4), 772–80. http://dx.doi.org/10.1093/molbev/mst010. Kongsrud, J.A., Eilertsen, M.H., Alvestad, T., Kongshavn, K., Rapp, H.T., 2017. New species of Ampharetidae (Annelida: Polychaeta) from the Arctic Loki Castle vent field. Deep Sea Res. Part II Top. Stud. Oceanogr. 137, 232–45.

http://dx.doi.org/10.1016/j.dsr2.2016.08.015. Kupriyanova, E.K., Bailey-Brock, J., Nishi, E., 2011. New records of Serpulidae (Annelida, Polychaeta) collected by R/V Vityaz from bathyal and abyssal depths of the Pacific Ocean. Zootaxa 2871, 43–60. Lanfear, R., Calcott, B., Ho, S.Y.W., Guindon, S., 2012. PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol. 29, 1695–1701. Lanfear, R., Calcott, B., Kainer, D., Mayer, C., Stamatakis, A., 2014. Selecting optimal partitioning schemes for phylogenomic datasets. BMC Evol. Biol. 14, 1–14. Levinsen, G.M.R., 1884. Systematisk-geografisk Oversigt over de nordiske Annulata, Gephyrea,Chaetognathi og Balanoglossi. Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i Köbenhavn, 1883, 92–350, plates 2–3. Levenstein, R.Y., 1962. The polychaetes from three abyssal trenches in the Pacific Ocean. Zoologichesky Zhurnal 41(8), 1142–1146. Levenstein, R.Y., 1969. Polychaeta. In: Zenkevitch L.A. (Ed.). Pacific Ocean. Biology. V.2. Deep-water fauna. Moscow: Nauka, 52–62 (In Russian). Levenstein, R.Y., 1970. New and rare species of the abyssal genus Fauveliopsis McIntosh (Polychaeta, Annelida) and the peculiarities of its distribution. Proceedings of Institute of Oceanology of Russian Academy of Science 88, 227–235 (In Russian). Levenstein, R.Y., 1971. Polychaeta of the genera Macellicephala and Macellicephaloides (Aphroditidae) from the Pacific Ocean. Proceedings of Institute of Oceanology of Russian Academy of Science 92, 18–35 (In Russian). Littlewood, D.T.J., 1994. Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Molecular Phylogenetics and Evolution 3, 221–229. Malmgren, A.J., 1866. Nordiska Hafs-Annulater. Öfversigt af Königlich Vetenskapsakademiens Förhandlingar, Stockholm 22(3), 355–410. Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE), 1–8. Noren, M., Jondelius, U., 1999. Phylogeny of the Prolecithophora (Platyhelminthes) Inferred from

18S

rDNA

Sequences.

Cladistics

15,

103–112.

doi:

10.1111/j.1096-

0031.1999.tb00252.x. Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G., 2012. ABGD, automatic barcode gap discovery for primary species delimitation. Mol. Ecol. 21, 1864–1877.

Rambaut, A., Drummond, A.J., Xie, D., Baele, G., Suchard, M.A., 2018. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 67(5), 901–904. doi: 10.1093/sysbio/syy032. Read, G., Fauchald, K., 2019. World Polychaeta database. Anobothrus Levinsen, 1884. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=129158 on 2019-04-27 Reuscher, M., Fiege, D., Wehe, T., 2009. Four new species of Ampharetidae (Annelida: Polychaeta) from Pacific hot vents and cold seeps, with a key and synoptic table of characters for all genera. Zootaxa 2191, 1–40. Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A., Huelsenbeck, J.P., 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61, 539– 542. Rouse, G.W., Pleijel, F., 2001. Polychaetes. Oxford University Press, p. 354. Schüller, M., Jirkov, I.A., 2013. New Ampharetidae (Polychaeta) from the deep Southern Ocean and shallow Patagonian waters. Zootaxa 3692(1), 204–237. Sjolin, E., Erseus, C., Kallersjo, M., 2005. Phylogeny of Tubificidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. Molecular Phylogenetics and Evolution 35, 431–441. Sokolova, M.N., 1976. Large-scale division of the World Ocean by trophic structure of deep-sea macrobenthos. Proc. P.P. Shirshov Inst. Oceanol. 99, 20–30 (In Russian). Sokolova, M.N., 1981. On characteristic features of the deep-sea benthic eutrophic regions of the World Ocean. Proc. P.P. Shirshov Inst. Oceanol. 115, 5–13 (In Russian). Struck, T.H., Purschke, G., Halanych, K.M., 2006. Phylogeny of Eunicida (Annelida) and Exploring Data Congruence using a Partition Addition Bootstrap Alteration (PABA) approach. Syst. Biol. 55, 1–20. Sui J., Li X., 2013. Review of Anobothrus (Polychaeta: Ampharetidae) from China. Chinese Journal of Oceanology and Limnology 31(3), 632–635. http://dx.doi.org/10.1007/s00343013-2209-9. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. http://dx.doi.org/10.1093/molbev/mst197. Uschakov, P.V., 1955. Polychaetes of the fam. Aphroditidae of the Kuri1-Kamchatka Trench. Proceedings of Institute of Oceanology of Russian Academy of Science 12, 311–321 (In Russian).

Uschakov, P.V., 1958. Two new species of Phyllodocid Polychaeta from the Kuril-Kamchatka Trench. Proceedings of Institute of Oceanology of Russian Academy of Science 27, 204– 207 (In Russian). Vaidya, G., Lohman, D.J., Meier, R., 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27, 171–180. Whiting, M.F., Carpenter, J.M., Wheeler, Q.D., Wheeler, W.C., 1997. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Systematic Biology 46, 1–68. Zenkevitch, L.A., 1963. Biology of the Seas of the USSR. New York: Interscience. 955 pp. (In Russian).

Figures captions Fig. 1. Expedition stations (A) performed between 2012 and 2016 on board of RVs Akademik M.A. Lavrentjev and Sonne, and records of the new Anobothrus species (B) collected from the studied areas. Fig. 2. Bayesian inference (BI) phylogenetic tree for the full five marker dataset (16S, 18S, 28S, COI and H3). Numbers at nodes represent the posterior probability values. Solid circles indicate full support. Fig. 3. Bayesian inference (BI) phylogenetic tree for the 16S matrix. Numbers at nodes represent the posterior probability values. Solid circles indicate full support. Fig. 4. Anobothrus auriculatus sp. nov.: A — complete specimen, lateral view, indicating circular glandular band (cb) before TU1 and transversal dorsal ridge (dr) at TU8; B — anterior end, lateral view; C — anterior end, dorsal view; D — posterior thoracic chaetiger (TCh15), first abdominal unciniger of thoracic type (AU1), and second abdominal unciniger forming a pinnule (AU2); E — pygidium, ventro-lateral view; F — notopodium of last thoracic chaetiger (TCh15), lateral view, showing a notopodial dorsal cirrus; G —uncini from TU1, AU1, AU2, and AU10 uncinigers, lateral view. (A–F: holotype MIMB 38795; G: paratype MIMB 38797). Fig. 5. Anobothrus auriculatus sp. nov., SEM micrographs: A–C — anterior end, lateral, dorsal, and frontal view; D — close-up of notopodium of first thoracic chaetiger (TCh1, SIII), located directly behind paleae; E — close-up of paleae originating from ear-shaped epidermal folds; F, G — close-up of paleal chaetae; H — detail of buccal tentacle, lateral view; I — modified fifth-tolast pair of notopodia showing a transversal dorsal ridge (dr); J — posterior thoracic (TCh15) and anterior abdominal chaetigers (AU1 and AU2); K, P —notochaetae and close-up of their tips from modified fifth-to-last chaetiger; L — light micrograph of notopodium from last thoracic chaetiger (TCh15), lateral view, showing a dorsal notopodial cirrus (dc); M — thoracic uncini, upper-frontal view; N — abdominal uncini, upper-frontal view; O — close-up of anterior end, lateral view, showing first thoracic segments (SII–SVIII, TCh1–6), and first thoracic uncinigers (TU1–3); Q — close-up of notochaetae from nine thoracic chaetiger; R — close-up of inner (in), middle (mi), and outer (ou) pairs of branchiophores, dorsal view. (A–K, M–R: MIMB S-Pol06/1–7; L: MIMB 38797).

Fig. 6. Anobothrus jirkovi sp. nov.: A — anterior end, lateral view, indicating a transversal dorsal ridge (dr) at TU8; B — close-up of anterior end, lateral view, showing first thoracic segments (SII–SIX, TCh1–7), and first thoracic uncinigers (TU1–4); C — pygidium, dorsolateral view; D — close-up of anterior end, dorsal view; showing arrangement of pairs of branchiophores, paleal base (palb), and central dermal hump (dh); E — close-up of cup-shaped paleal base, and first two thoracic chaetigers (TCh1 and TCh2), lateral view; F — uncini from TU8, AU1, AU3, and AU12 uncinigers, lateral view; G — notochaeta from modified fifth-to-last chaetiger; (A–C, E: holotype MIMB 38787; D, F, G: paratype MIMB 38789). Fig. 7. Anobothrus jirkovi sp. nov., SEM micrographs: A — anterior end with branchiae, dorsal view; B — close-up of anterior end, lateral view, showing first seven thoracic segments (SI– SVII), first two thoracic uncinigers (TU1–2), and position of nephridial pores (np); C — closeup of anterior end, dorsal view; D — close-up of anterior end with branchiae, dorsal view; showing arrangement of inner (in), middle (mi), and outer (ou) pairs of branchiophores; E — close-up of paleal base, and first two thoracic chaetigers (TCh1 and TCh2), lateral view; F — close-up of tips of paleal chaetae; G — close-up of paleae; H — modified fifth-to-last pair of notopodia showing a transversal dorsal ridge (dr); I — pygidium, dorso-lateral view; J — notopodium from last thoracic chaetiger; K — close-up of short notochaetae of anterior row from modified fifth-to-last chaetiger; L — close-up of tips of notochaetae from modified fifth-tolast chaetiger; M — thoracic uncini of TU3, upper-frontal view; N — abdominal uncini of AU1, upper-frontal view; O — abdominal uncini of AU12, upper-frontal view; (A, D, I, N, O: MIMB S-Pol-07/3; B, C, E–H, J–M: MIMB S-Pol-07/2). Anobothrus laubieri, SEM micrographs: P — close-up of anterior end, dorsal view, showing position of nephridial pores (np); Q — close-up of paleae; R — close-up of tip of paleal chaeta; S — close-up of tip of notochaeta from modified fifth-to-last chaetiger; T — modified fifth-to-last pair of notopodia showing a transversal dorsal ridge (dr); U — close-up of notochaetae from TCh9. Fig. 8. Anobothrus sonne sp. nov.: A — complete specimen, lateral view, indicating circular glandular band (cb) before TU2 and transversal dorsal ridge (dr) at TU8; B — anterior end, lateral view, indicating papillate ventral fold (vf); C — close-up of prostomium with 3 anterior chaetigers, dorso-lateral view, showing first thoracic unciniger (TU1), location of nephridial pore (np), and papillate ventral fold (vf); D — pygidium, dorso-lateral view; E — close-up of arrangement of pairs of branchiophores (in, inner; mi, middle; ou, outer), and location of outermost pair of rounded tubercles (tu), anterior view; F — notochaeta from modified fifth-to-

last chaetiger; G —uncinus from eighth thoracic unciniger (TU8), lateral view; H —uncinus from third abdominal unciniger (AU3), lateral view. (A, B, D: holotype MIMB 38774; C, E: MIMB S-Pol-05/3; F–H: paratype MIMB 38778). Fig. 9. Anobothrus sonne sp. nov., SEM micrographs: A — anterior end, lateral view; B — close-up of inner (in), middle (mi), and outer (ou) pairs of branchiophores, and outermost pair of rounded tubercles (tu), anterior view; C, D — close-up of anterior end, lateral and anterior-lateral view, showing first seven thoracic segments (SI–SVII), first two thoracic uncinigers (TU1–2), and different angle of ventral fold (vf); E, F — close-up of ventral fold of different specimens, ventral and ventro-lateral view; G — detail of buccal tentacle, lateral view; H — posterior thoracic and anterior abdominal chaetigers; modified fifth-to-last pair of notopodia showing a transversal dorsal ridge (dr); I — posterior end, ventro-lateral view; J — thoracic notopodia of chaetigers 3 and 4 (TCh) showing position of nephridial pores (np). (A–D, F, J: MIMB S-Pol05/3; E, H, I: MIMB S-Pol-05/2; G: MIMB S-Pol-05/4). Abbreviations: tu, tubercle; vf, ventral fold; dr, transversal dorsal ridge; np, nephridial pores. Fig. 10. Anobothrus sonne sp. nov., SEM micrographs: A — paleae, and close-up of outermost rounded tubercle (tu), anterior view; B — close-up of paleal chaetae; C — notopodium from modified fifth-to-last chaetiger, anterior view; D — close-up of notochaetae from modified fifthto-last chaetiger; E, H — thoracic uncini, upper-frontal view; F, G, I — abdominal neuropodia and uncini from third (AU3), seventh (AU7) and tenth (AU10) abdominal chaetigers; J — closeup of abdominal uncini of AU10; K — anterior abdominal chaetigers, lateral view, showing first two AU (AU1 and AU2) of thoracic type; L — close-up of notochaetae from nine thoracic chaetiger. (A, C–L: MIMB S-Pol-05/2; B: MIMB S-Pol-05/4).

Figure

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

Figure

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 0.05 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Anobothrus auriculatus sp. nov. 0.6

Anobothrus auriculatus sp. nov.

Anobothrus auriculatus sp. nov.

Anobothrus auriculatus sp. nov.

0.84

Anobothrus patersoni

Anobothrus gracilis ZM40

Anobothrus sonne sp. nov. 0.85

Anobothrus sonne sp. nov.

Anobothrus sonne sp. nov.

0.5

Anobothrus sonne sp. nov.

Anobothrus sonne sp. nov.

Ampharete falcata ZM43

Sosane wireni ZMBN 95447

Figure

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 0.05 55 56 57 58 59 60 61 62 63 64 65

Anobothrus auriculatus sp. nov.

0.68

Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov.

0.91

Anobothrus auriculatus sp. nov.

0.57

Anobothrus laubieri

0.99

Anobothrus patersoni Anobothrus gracilis

0.89 Anobothrus jirkovi sp. nov.

Anobothrus fimbriatus Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov.

Ampharete falcata Sosane wireni

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

Conflict of Interest

Declaration of interests X The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Table 1. Details for stations where described ampharetid species were found. Abbreviation of areas: KB – Kuril Basin of the Okhotsk Sea; KKT – Kuril Kamchatka Trench; KKT area – abyssal plain adjacent to the Kuril-Kamchatka Trench. Station

Date

Expedition

RV

Cruise Gear Fixed Start of trawling

End of trawling

Location

Depth (m)

SO223-3-9 SO223-4-3 SO223-5-9 SO223-9-9 SO250-6 SO250-8 SO250-10 SO250-14 SO250-17 SO250-28 SO250-30 SO250-40 SO250-42 SO250-52 SO250-55 SO250-67 SO250-75 SO250-77 SO250-79 SO250-82 SO250-85 SO250-87 SO250-89 SO250-97 SO250-100 Sokh-1-4 Sokh-1-9 Sokh-2-8 Sokh-4-9

05.08.12 06.08.12 11.08.12 23.08.12 18.08.16 19.08.16 20.08.16 21.08.16 22.08.16 26.08.16 27.08.16 29.08.16 30.08.16 06.09.16 06.09.16 10.09.16 12.09.16 13.09.16 13.09.16 14.09.16 15.09.16 16.09.16 16.09.16 18.09.16 20.09.16 09.07.15 10.07.15 13.07.15 17.07.15

KuramBio-I KuramBio-I KuramBio-I KuramBio-I KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II KuramBio-II SokhoBio SokhoBio SokhoBio SokhoBio

Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Sonne Ak. Lavrentyev Ak. Lavrentyev Ak. Lavrentyev Ak. Lavrentyev

223 223 223 223 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 250 71 71 71 71

47°14.76N–154°43.03E 46°58.46N–154°33.39E 43°34.30N–153°58.16E 40°34.25'N–150°59.91'E

KKT KKT KKT area KKT area KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KKT KB KB KB KB

4987–4991 5681–5780 5376–5380 5399–5421 5497 5136 5120 8251 8191 6051 6181 7081 7123 8737 8745 9495 8221 9584 9428 5220 5265 5492 8221 6575 9412 3305 3307 3351–3352 3366

EBS EBS EBS EBS BC EBS EBS BC EBS EBS EBS EBS EBS EBS EBS BC BC EBS BC BC EBS EBS EBS EBS BC BC EBS EBS EBS

EtOH EtOH EtOH EtOH Form EtOH EtOH Form EtOH EtOH EtOH EtOH EtOH EtOH EtOH Form Form EtOH Form Form EtOH EtOH EtOH EtOH Form Form Form Form EtOH

47°14.66'N–154°42.88'E 46°58.34'N–154°33.03'E 43°34.46'N–153°58.13'E 40°34.51'N–150°59.92'E 43°49.19'N–151°45.60'E 43°49.55'N–151°46.25'E 43°49.43'N–151°46.96'E 45°50.87'N–153°47.99'E 45°52.04'N–153°51.39'E 45°54.43'N–152°47.02'E 45°56.38'N–152°56.70'E 45°38.00'N–152°55.95'E 45°39.62'N–152°56.39'E 45°29.77'N–153°12.16'E 45°29.24'N–153°13.46'E 45°12.94'N–152°42.84'E 44°39.88'N–151°28.13'E 45°13.71'N–152°51.21'E 45°12.99'N–152°42.76'E 45°01.36'N–151°02.89'E 45°02.26'N–151°02.14'E 45°00.76'N–151°05.53'E 44°40.12'N–151°27.35'E 44°05.68'N–151°24.88'E 44°12.31'N–150°39.08'E 46°09.00'N–145°59.92'E 46°05.03'N–146°00.46'E 46°41.09'N–147°27.38'E 47°12.12'N–149°37.13'E

43°48.59'N–151°46.47'E 43°48.45'N–151°47.17'E 45°51.40'N–153°50.41'E 45°54.52'N–152°47.20'E 45°56.83'N–152°50.93'E 45°40.83'N–152°57.68'E 45°40.26'N–152°57.63'E 45°29.18'N–153°11.13'E 45°29.58'N–153°12.24'E

45°14.21'N–152°49.95'E

45°01.64'N–151°03.68'E 45°01.65'N–151°05.52'E 44°39.05'N–151°27.34'E 44°06.94'N–151°24.88'E

46°08.72'N–146°00.22'E 46°41.15'N–147°27.71'E 47°11.95'N–149°36.99'E

Sokh-6-7 Sokh-7-4 Sokh-9-7 Sokh-9-10

20.07.15 22.07.15 26.07.15 27.07.15

SokhoBio SokhoBio SokhoBio SokhoBio

Ak. Lavrentyev Ak. Lavrentyev Ak. Lavrentyev Ak. Lavrentyev

71 71 71 71

EBS EBS EBS AGT

Form Form Form Form

48°03.23'N–150°00.46'E 46°57.46'N–151°05.06'E 46°16.16'N–152°03.09'E 46°16.41'N–152°03.04'E

48°03.12'N–150°00.14'E 46°57.49'N–151°04.91'E 46°16.07'N–152°03.32'E 46°16.71'N–152°03.87'E

KB KB KKT KKT

3350–3351 3300 3371–3377 3360–3361

Table 2. Museum voucher number, abundance and preservation status of type material of new ampharetid species described. Species

Type

Voucher

Abundence Station

Preservation

Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus auriculatus sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov.

holotype paratype paratype paratype paratype paratype paratype additional material paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype holotype paratype paratype paratype paratype paratype additional material additional material paratype paratype

MIMB 38795 MIMB 38796 MIMB 38797 MIMB 38798 MIMB 38799 MIMB 38800 MIMB 38801 MIMB S-Pol-06/1-7 ZIN-1/50752 ZIN-2/50753 ZIN-3/50754 KGB MGU-Pol-22 KGB MGU-Pol-23 KGB MGU-Pol-24 KGB MGU-Pol-25 ZM MGU-Pl-973 ZMH-X1 ZMH-X2 ZMH-X3 MIMB 38787 MIMB 38788 MIMB 38789 MIMB 38790 MIMB 38791 MIMB 38792 MIMB S-Pol-07/1–2 MIMB S-Pol-07/3 ZIN-1/50755 ZIN-2/50756

1 5 10 4 7 2 2 7 6 6 4 6 4 5 8 6 6 2 8 1 1 1 1 1 9 2 1 2 1

75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH dried for SEM 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 10% Form–75% EtOH 10% Form–75% EtOH 10% Form–75% EtOH 75% EtOH 75% EtOH 75% EtOH dried for SEM dried for SEM 10% Form–75% EtOH 75% EtOH

SO250-17 SO250-17 SO250-52 SO250-77 SO250-10 SO250-30 SO223-5-9 SO250-17 SO250-17 SO250-89 SO250-77 SO250-17 SO250-55 SO250-77 SO250-52 SO250-17 SO250-17 SO250-77 SO250-52 Sokh-9-10 Sokh-9-7 Sokh-9-7 SO223-4-3 SO250-10 SO250-85 SO223-4-3 Sokh-9-7 Sokh-9-7 SO223-5-9

Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus jirkovi sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov. Anobothrus sonne sp. nov.

paratype paratype paratype paratype paratype holotype paratype paratype paratype paratype paratype paratype additional material paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype paratype

ZIN-3/50757 KGB MGU-Pol-26 KGB MGU-Pol-27 ZM MGU-Pl-974 ZMH-X1 MIMB 38774 MIMB 38775 MIMB 38776 MIMB 38777 MIMB 38778 MIMB 38779 MIMB 38780 MIMB S-Pol-05/1-6 ZIN-1/50758 ZIN-2/50759 ZIN-3/50760 ZIN-4/50761 ZIN-5/50762 KGB MGU-Pol-28 KGB MGU-Pol-29 KGB MGU-Pol-30 KGB MGU-Pol-31 ZM MGU-Pl-975 ZM MGU-Pl-976 ZMH-X1 ZMH-X2 ZMH-X3

5 2 4 1 3 1 2 5 3 10 20 25 6 3 5 7 15 10 2 7 20 10 7 10 7 15 10

SO250-85 Sokh-9-7 SO250-85 Sokh-9-7 SO250-85 SO250-28 SO250-28 SO223-4-3 SO223-5-9 SO223-5-9 Sokh-4-9 Sokh-2-8 SO250-87 SO223-4-3 SO223-3-9 SO223-5-9 Sokh-4-9 Sokh-2-8 SO250-28 SO223-5-9 Sokh- 4-9 Sokh-2-8 SO223-5-9 Sokh-2-8 SO223-5-9 Sokh-4-9 Sokh-2-8

75% EtOH 10% Form–75% EtOH 75% EtOH 10% Form–75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 75% EtOH 10% Form–75% EtOH dried for SEM 75% EtOH 75% EtOH 75% EtOH 75% EtOH 10% Form–75% EtOH 75% EtOH 75% EtOH 75% EtOH 10% Form–75% EtOH 75% EtOH 10% Form–75% EtOH 75% EtOH 75% EtOH 10% Form–75% EtOH

Table 3. List of specimens with GenBank accession numbers of sequences (sequences new to this study in bold, dashes indicate missing sequences for this particular fragment) used in the present study. Identification

Specimen ID

16S

18S

28S

COI

H3

Source

Anobothrus sonne sp. nov.

MISO250-28/1

MN244034

MN244046

MN244056

MN241966

MN241976

Present study

Anobothrus sonne sp. nov.

MISO250-28/2

MN244035

MN244047

MN244057

MN241967

MN241977

Present study

Anobothrus sonne sp. nov.

MISO250-28/3

MN244036

MN244048

MN244058

MN241968

MN241978

Present study

Anobothrus sonne sp. nov.

MISO250-28/4

MN244037

MN244049

MN244059

MN241969

MN241979

Present study

Anobothrus sonne sp. nov.

MISO250-28/5

MN244038

MN244050

MN244060

MN241970

MN241980

Present study

Anobothrus auriculatus sp. nov.

MISO250-77/1

MN244039

MN244051

MN244061

MN241971

MN241981

Present study

Anobothrus auriculatus sp. nov.

MISO250-77/2

MN244040

MN244052

MN244062

MN241972

MN241982

Present study

Anobothrus auriculatus sp. nov.

MISO250-77/3

MN244041

MN244053

MN244063

MN241973

MN241983

Present study

Anobothrus auriculatus sp. nov.

MISO250-77/4

MN244042

MN244054

MN244064

MN241974

MN241984

Present study

Anobothrus patersoni Jirkov, 2009

MISO223-4-3

MN244043

MN244055

MN244065

MN241975

MN241985

Present study

Anobothrus fimbriatus Imajima, Reuscher & Fiege, 2013

MISokh-2-7

MN244044

-

-

-

-

Present study

Anobothrus jirkovi sp. nov.

MISO250-85

MN244045

-

-

-

-

Present study

Anobothrus gracilis (Malmgren, 1866)

ZM40

MG253121

MG253168

MG253239

MG270106

-

Eilertsen et al. (2017)

Anobothrus laubieri (Desbruyères, 1978)

AM21

MG253080

MG253132

MG253190

-

-

Eilertsen et al. (2017)

Ampharete falcata Eliason, 1955

ZM43

MG253124

MG253169

MG253241

MG270099

-

Eilertsen et al. (2017)

Sosane wireni (Hessle, 1917)

ZM47

KX513562

KX513577

-

KX497039

-

Kongsrud et al. (2017)

Table 4. List of primers used in the present study. Forward primer sequences are denoted in bold font. Target locus Primer name Primer sequence 5′–3′

Reference

16SRNA

Ann F AnnR

GCGGTATCCTGACCGTRRCWAAGGTA TCCTAAGCCAACATAGAGGTGCCAA

Sjolin et al. (2005) Folmer et al. (1994)

COI

LCO1490 HCO2198

GGTCAACAAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA

Folmer et al. (1994) Folmer et al. (1994)

28S RNA

LSU5 LSU3

ACCCGCTGAATTTAAGCAT TCCTGAGGGAAACTTCGG

Littlewood (1994) Folmer et al. (1994)

18S RNA

Tim A 1100R 3F 18Sbi 18Sa2.0 9R

AMCTGGTTGATCCTGCCAG GATCGTCTTCGAACCTCTG GTTCGATTCCGGAGAGGGA GAGTCTCGTTCGTTATCGGA ATGGTTGCAAAGCTGAAAC GATCCTTCCGCAGGTTCACCTAC

Noren and Jondelius (1999) Noren and Jondelius (1999) Giribet et al. (1996) Whiting et al. (1997 Whiting et al. (1997 Giribet et al. (1996)

H3

aF aR

ATGGCTCGTACCAAGCAGAC ATATCCTTRGGCATRATRGTGAC

Colgan et al. (1998) Colgan et al. (1998)

Table 5. World-wide distribution of known Anobothrus species. Species

Distribution

Depth (m) Reference

Anobothrus amourouxi Bonifácio, Lavesque, Bachelet & Parapar, 2015 Anobothrus antarctica Monro, 1939

NE Atlantic: Bay of Biscay Circumantarctic

108–364 175–2060

Bonifácio et al. (2015) Jirkov (2009)

Anobothrus apaleatus Reuscher, Fiege & Wehe, 2009

NW Pacific: Kuril Basin of the Okhotsk Sea; NE Pacific: off Oregon, USA; SE Pacific: Antarctic Ridge NW Pacific: Kuril–Kamchatka Trench and adjacent abyssal plain NE Pacific: off California, USA

524–3352

Reuscher et al. (2009)

5120–9584

present study

880–1645

Fauchald (1972)

30–125 1997–3377

Imajima et al. (2013) Imajima et al. (2013)

17–825

Imajima et al. (2013)

50–385 9–1960

Jirkov (2009) Jirkov (2009)

3360–5780

present study

Anobothrus laubieri (Desbruyères, 1978)

NW Pacific: Pacific coast of Japan, East China Sea NW Pacific: Pacific coast of Hokkaido, Japan; Kuril Basin of the Okhotsk Sea, western slope of the Kuril-Kamchatka Trench NW Pacific: Pacific coast of Japan, Sea of Japan, Korea Strait South Pacific: off Chili Widely distributed in Arctic, North Atlantic, and North Pacific NW Pacific: Kuril–Kamchatka Trench and adjacent abyssal plain Arctic: from Norwegian to Chukchi Sea

155–3965

Jirkov (2009)

Anobothrus mancus Fauchald, 1972

NE Pacific: off California, USA

730–2295

Fauchald (1972)

Anobothrus mironovi Jirkov, 2009

Widely distributed in Pacific

850–3890

Jirkov (2009)

Anobothrus paleaodiscus Schüller & Jirkov, 2013

Antarctic: Weddell Sea

1047–4720

Schüller and Jirkov (2013)

Anobothrus paleatus Hilbig, 2000

NE Pacific: off California, USA

550–610

Hilbig (2000)

Anobothrus patagonicus (Kinberg, 1866)

East Antarctica; Magellan Strait

10–400

Jirkov (2009)

Anobothrus patersoni Jirkov, 2009

North Pacific and North Atlantic

3260–8292

Jirkov (2009)

Anobothrus pseudoampharete Schüller, 2008

Antarctic: Weddell Sea

774–4574

Schüller (2008)

Anobothrus rubropaleatus Schüller & Jirkov, 2013 Anobothrus sonne sp. nov.

South Atlantic: off Uruguay NW Pacific: Kuril Basin of the Sea of Okhotsk, Kuril–Kamchatka Trench and adjacent abyssal plain South Atlantic: South Africa; Antarctic: Weddell Sea

50 3300–7123

Schüller and Jirkov (2013) present study

1047–4720

Schüller and Jirkov (2013)

Anobothrus auriculatus sp. nov. Anobothrus bimaculatus Fauchald, 1972 Anobothrus dayi Imajima, Reuscher & Fiege, 2013 Anobothrus fimbriatus Imajima, Reuscher & Fiege, 2013 Anobothrus flabelligerulus Imajima, Reuscher & Fiege, 2013 Anobothrus glandularis (Hartmann-Schröder, 1965) Anobothrus gracilis (Malmgren, 1866) Anobothrus jirkovi sp. nov.

Anobothrus wilhelmi Schüller & Jirkov, 2013

Highlights   

Three new species of ampharetid polychaetes are described from the abyssal and hadal NW Pacific. All the new species are characterized by the presence of 3 pairs of branchiae and unique features. Both morphological data and phylogenetic analysis provided the evidence for the presence of the three new species in the studied area.

Declaration of interests X The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: