New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica

Journal of Microbiological Methods 55 (2003) 727 – 737 www.elsevier.com/locate/jmicmeth

New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica P. Fickers a,b, M.T. Le Dall a, C. Gaillardin a, P. Thonart b, J.M. Nicaud a,* a

Laboratoire Microbiologie et Ge´ne´tique Moleculaire, CNRS INRA INAP-G UMR2585, Institut National Agronomique Paris-Grignon, F-78850 Thiverval-Grignon, France b Centre Wallon de Biologie Industrielle, Service de Technologie Microbienne, Universite´ de Lie`ge, Bd du Rectorat Bat. 40, B-4000 Lie`ge, Belgium Received 10 June 2003; received in revised form 30 July 2003; accepted 30 July 2003

Abstract Yarrowia lipolytica is one of the most extensively studied nonconventional yeasts. Unfortunately, few methods for gene disruption have been reported for this yeast, and all of them are time-consuming and laborious. The functional analysis of unknown genes requires powerful disruption methods. Here, we describe such a new method for rapid gene disruption in Y. lipolytica. This knockout system combines SEP method and the Cre-lox recombination system, facilitating efficient marker rescue. Versatility was increased by using both auxotrophic markers like ylURA3 and ylLEU2, as well as the antibiotic resistance marker hph. The hph marker, which confers resistance to hygromycin-B, allows gene disruption in a strain lacking any conventional auxothrophic marker. The disruption cassette was shown to integrate at the correct locus at an average frequency of 45%. Upon expression of Cre recombinase, the marker was excised at a frequency of 98%, by recombination between the two lox sites. This new method for gene disruption is an ideal tool for the functional analysis of gene families, or for creating large-scale mutant collections in general. D 2003 Elsevier B.V. All rights reserved. Keywords: Gene disruption; Cre-lox; Recombinase; Yarrowia lipolytica

1. Introduction Yarrowia lipolytica is one of the most extensively studied nonconventional yeast. Strains of this species are most frequently isolated from lipid- or proteincontaining substrates such as cheese, olive oil as well as sewage. This substrate preference has been attrib* Corresponding author. Tel.: +33-1-30-81-54-50; fax: +33-130-81-54-57. E-mail address: [email protected] (J.M. Nicaud). 0167-7012/$ - see front matter D 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2003.07.003

uted to the existence of an efficient production and secretion of proteolytic and hydrophobic substrate degrading enzymes in this yeast (for review, see Barth and Gaillardin, 1996). A recent study reported the genomic exploration of 4940 random sequence tags revealed at least 1229 novel genes (Casaregola et al., 2000). Moreover, through an ongoing sequencing program (http://www.cbi.labri.fr/Genolevures/), the entire sequence of the six Y. lipolytica chromosomes will soon be available. The next challenge will be the characterisation and functional analysis of the corresponding gene products. One of the approaches will

728

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

be to delete on a high-throughput basis the corresponding genes in the genome. In Y. lipolytica, many genes belong to large gene families. Thus, the functional analysis of an unknown gene may require the disruption of all members of a gene family before the real phenotype of a null mutant can be assessed. To do this, a powerful method to rapidly produce multiple disrupted strains is needed. Unfortunately, in contrast to the situation for other yeasts such as Sacharomyces cerevisiae, few methods have been developed for Y. lipolytica. A PCR-mediated gene disruption method, based on the counter selectable ylURA3 marker, has been reported (Nicaud et al., 1998). Two cassettes were constructed: a promoter – URA3 –terminator used for gene disruption by selection of Ura+ transformants and a promoter – terminator cassette used for marker rescue by selection of Ura
transformants on 5-fluoroorotic acid (5-FOA) medium (Barth and Gaillardin, 1996). This method, successfully applied to functional analysis of the acyl-oA oxidase family (Wang et al., 1999), was laborious, time-consuming, and limited to the ylURA3. We describe here a new method for rapid gene disruption, combining the SEP method (Maftahi et al., 1996) adapted for Y. lipolytica (Nicaud et al., 1998) and the Cre-lox recombination system (Sauer, 1987). In this method, we introduced two new selectable markers: the nutritive marker ylLEU2, which encodes beta-isopropylmalate dehydrogenase, and the heterologous hph gene, which confers resistance to the antibiotic hygromycin-B (HygR). Finally, we constructed an additional cre expression plasmid carrying the HygR marker. These tools greatly facilitate the marker rescue and reuse and thus offer a convenient and efficient way to create multiple gene deletions in a short period of time. Moreover, the use of a heterologous selectable marker such as HygR makes it possible to disrupt a specific gene in wildtype or industrial strains devoid of any auxothrophic marker.

2. Materials and methods 2.1. Plasmids, strains and media Plasmids, Escherichia coli and Y. lipolytica strains used in this study are listed in Table 1, and the

oligonucleotides used for PCR amplification are listed in Table 2. E. coli strain DH5a (Gibco BRL, Rockville, MD), used for transformation and for the amplification of recombinant plasmid DNA, was grown at 37 jC in Luria –Bertani medium supplemented with 100 Ag/ml of ampicillin (Euromedex, Souffelweyersheim, France) or 40 Ag/ml kanamycin sulphate (Sigma-Aldrich, St. Louis, MO) when required. The media and techniques used for Y. lipolytica have been described elsewhere (Barth and Gaillardin, 1996), and standard media and techniques were used for E. coli (Sambrook et al., 1989). Yeasts were grown at 28 jC on YPD or YNB supplemented for auxothrophic requirements (Wang et al., 1999). For HygR selection, transformants were plated on YPDhyg containing 100 Ag/ml hygromycin-B (Gibco BRL), whereas for selection of Ura+ and Leu+ clones, transformants were plated on YNBcasa (YNB with 0.2% casamino acid, Difco, Detroit, MI) and YNBura (YNB with 0.01% uracil, Sigma-Aldrich), respectively. YNB-trybutyrin plates (YNB-tryb) was used for extracellular lipase activity detection as previously described (Pignede et al., 2000). 2.2. General genetic techniques Standard molecular genetic techniques were used (Sambrook et al., 1989). Restriction enzymes and T4 polynucleotide kinase were obtained from Gibco BRL or New England Biolabs (Beverly, MA). Meganuclease I-SceI was purchased from Roche Diagnostics (Mannheim, Germany). Genomic DNA from yeast transformants was prepared as described by Querol et al. (1992). PCR amplification was performed on a Perkin-Elmer Gene Amp 2400 PCR apparatus (Perkin-Elmer Biosystem, Foster City, CA) in a final volume of 50 Al containing 5 Al 10  Taq buffer [100 mM Tris – HCl, pH 9, 500 mM KCl, 1% Triton X-100, 15 mM MgCl2], 200 AM dNTP (200 AM of each dATP, dCTP, dGTP and dTTP), 30 –60 ng of template, 50 pmol of the appropriate primers and 0.5 units each of Taq (Promega, Madison, WI) and Pfu (Stratagene, La Jolla, CA) DNA polymerases. We carried out 25 PCR cycles as follows: denaturation at 94 jC for 30 s, annealing at 60 jC for 20 s and extension at 72 jC for 1 min/kb. PCR fragments were purified using Wizard PCR Preps (Promega) and DNA fragments were recovered from agarose gels

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

729

Table 1 Strains and plasmids used in this study Strain (host strain)

Plasmid, genotype

Reference Promega

JME459 (DH5a) JME130 (DH5a)

A80dlacZDm15, recA1, endA1, gyrA96, thi-1, hsdR17 (rk
, mk+), supE44, relA1, deoR, D(lacZYA-argF)U169 pBluescript II KS+ (ColE1 ori, LacZ, bla) pKSURA3 (ylURA3 in pBluescript II KS+)

JME327 (DH5a)

JMP21 (expression vector carrying LEU2 marker)

JME458 JME512 JME507 JME509 JME508 JME472 JME514 JME515 JME516 JME461 JME547 JME548

pUB4 (hph ARS68 CEN in pBluescript II KS+) JMP112 (LPR synthetic oligonucleotide in pBluescript II KS+) JMP113 (1.2 kb ylURA3 fragment in JMP112, MU cassette) JMP114 (1.8 kb ylLEU2 fragment in JMP112, ML cassette) JMP115 (1.6 kb hph fragment in JMP112, MH cassette) JMP116 (2 kb PCR fragment containing ylLIP2 PT cassette) JMP121 (MU cassette in JMP116, PUT cassette) JMP122 (MH cassette in JMP116, PHT cassette) JMP123 (ML cassette in JMP116, PLT cassette) pRRQ2 (Cre ARS68 LEU2 in Bluescript KS+) pUB4-CRE (2.1 kb Cre fragment in pUB4) pUB4-CREinv (2.1 kb Cre fragment in pUB4, opposite orientation)

Stratagene Nicaud et al., unpublished results Nicaud et al., unpublished results Kerscher et al., 2001 This work This work This work This work This work This work This work This work Richard et al., 2001 This work This work

MATA MATA MATA MATA MATA

CLIB139 This work This work This work This work

E. coli strains DH5a

(DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a) (DH5a)

Y. lipolytica strains Po1d MTLY49 MTLY50 MTLY57 MTLY58

ura3-302 ura3-302 ura3-302 ura3-302 ura3-302

leu2-270 leu2-270 leu2-270 leu2-270 leu2-270

xpr2-322 xpr2-322 xpr2-322 xpr2-322 xpr2-322

using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). DNA sequencing was performed as described by Maftahi et al. (1996) on an automated sequencer (ABI model 373A, Perkin-Elmer Biosystem) using synthetic primers and the dye terminator procedure. The Genetics Computer Group package (University of Wisconsin, Madison, WI) was used for sequence analysis. 2.3. Construction of disruption cassettes 2.3.1. Construction of pKSLPR Oligonucleotides LoxEco1 and LoxEco3 were annealed with oligonucleotides LoxEco2 and LoxEco4, respectively (Table 2), after phosphorylation with T4 polynucleotide kinase. The two resulting fragments were annealed and cloned as a PstI –XhoI fragment in pBluescript II KS+ (Stratagene) to generate plasmid JMP112 carrying the LPR cassette (Fig. 1A). The plasmid was then tested by restriction

lip2Dhph Dlip2 lip2DURA3 lip2DLEU2

analysis using I-SceI, PstI, XhoI and EcoRI and sequenced using T7 and SP6 universal oligonucleotide primer pairs. 2.3.2. Positioning the marker gene between loxP and loxR in the LPR cassette First, marker gene were obtained by PCR amplification as follows: the f 1.2-kb ylURA3 fragment was amplified from pKSURA3, carrying the ylURA3 open reading frame (ORF), using the oligonucleotide primers Ura3EP1/Ura3ET1 (Nicaud, unpublished results). The f 1.8-kb ylLEU2 fragment was obtained using the oligonucleotide primers Leu2EP1/ LeuET1 and plasmid JMP21, carrying the ylLEU2 ORF as a template. The f 1.6-kb hph fragment was rescued from pUB4 (Kerscher et al., 2001) using the oligonucleotide primers HygEP1/HygET1. Each primer pair was designed to amplify EcoRI-ended fragments, thus allowing their cloning between loxP and loxR sites of the LPR cassette to yield JMP113

730

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

Table 2 Oligonucleotide sequence used in this study Primer

Sequence (5V!3V)a

Site

Loxeco1 Loxeco2 Loxeco3 Loxeco4 Ura3EP1 Ura3ET1 Ura3P2 Leu2EP1 Leu2ET1 Leu2P1 Leu2P4 HygEP1 HygET1 Lip2P1 Lip2P2 Lip2T1 Lip2T2 L2P500 L2T500 L2P1500 L2T1500 L2P2000 L2T2000

GATCCTAGGGATAACAGGGTAATTATCGCTTCGGATAACTCCTGCTATACGAAGTTATACGAATTCAGAATAACT TAACTTCGTATAGCAGGAGTTATCCGAAGCGATAATTACCCTGTTATCCCTAG TCGTATAATGTATGCTATACGAAGTTATGTAGGGATAACAGGGTAATC TCGAGATTACCCTGTTATCCCTACATAACTTCGTATAGCATACATTATACGAAGTTATTCTGAATTCGTA TAACAGGAATTCGCGCCCAGAGAGCCATTGACGTTCT CTGTTAGAATTCCGAGAAACACAACAACATGCCCCATTG GCGAGAAACACAACAACATGCCCCA GATTTCGAATTCCGCCTGAGTCATCATTTATTTACCAGTT AATATATGAATTCGAATATACAGTAACAAGCTACCACCAC GATTTCCGTCGTCGCCTGAGTCAT GAATATACAGTAACAAGCTACCAC ATCCAGGAATTCGAGCACCGCCGCCGCAAGGAATGG AAGGGGAATTCTCGACTATTCCTTTGCCCTCGGAC GGTCGGAATAATTACTGTGGACC CATTACCCTGTTATCCCTAGACTTGGGTATCAATTGAGGGCTTTC CTAGGGATAACAGGGTAATGTCTCGGAGGAGCTGCAGCCC TTGCTTAACACCAGTATCAGAACACAGAC GGAGGTGGACCTGCAAGGGAATTCAG CCAATCACATTGACCTGCTGGAGCAG GGAGAAGAGTGCACCCTCTGTTAGATAG CCACCTTCTTTACCCCAACCCGAC GCCCCGACCATACCTGTTACTCG CATGTCGATACTAGCTTTATCAAGTCTCTCGTGG

– – – – EcoRI EcoRI

a

EcoRI EcoRI – – EcoRI EcoRI – I-SceI I-SceI – – – – – – –

Underlined segments indicate restriction sites used for cloning.

(MU cassette), JMP114 (ML cassette) and JMP115 plasmids (MH cassette), respectively (Fig. 1B). The resulting constructs were sequenced using T7 and SP6 universal primers to assess marker orientation. 2.3.3. Construction of the promoter – terminator cassette The PT cassette was obtained in two steps by PCR amplification using the SEP methods (Maftahi et al., 1996). First the promoter (P) and terminator (T) regions, consisting of f 1.06 and f 0.97 kb fragments situated upstream and downstream from the

ylLIP2 ORF, respectively (accession no. AJ012632), were amplified using Y. lipolytica Po1d genomic DNA as a template, with the primers Lip2P1/Lip2P2 and Lip2T1/Lip2T2, respectively. Primers Lip2P2 and Lip2T1 contain the rare meganuclease I-SceI recognition sequence (PCR 1 in Fig. 1C). P –I-SceI and ISceI –T resulting fragments were then pooled and used as a templates for amplification of the P – I-SceI – T cassette with the oligonucleotide primers Lip2P1/ Lip2T2 (PCR2 in Fig. 1C). This cassette was then cloned as a blunt-ended fragment into EcoRV-digested and dephosphorylated pBluescript II KS+. The result-

Fig. 1. Schematic representation of the construction of the disruption cassettes. (A) Representation of the LPR cassette; the loxR and loxP regions separated by a EcoRI site were flanked by the rare restriction site I-SceI; the cassette was cloned as a PstI – XhoI fragment into pBluescript II KS+. (B) Schematic representation of the MU, ML and MH marker cassettes; ylURA3, ylLEU2 and hph genes were amplified by PCR with primers pairs Ura3EP1/Ura3ET1, Leu2EP1/Leu2ET1 and HygEP1/HygET1, respectively, and integrated as EcoRI fragments into the LPR cassette. (C) Preparation of the PT cassette; the promoter and terminator regions of the ylLIP2 gene were amplified using the specific oligonucleotide pairs Lip2P1/Lip2P2 (P) and Lip2T1/Lip2T2 (T), respectively; oligonucleotide Lip2P2 and Lip2T1 contains one strand of a 20bp additional sequence, which can be cleaved by the rare cutting site I-SceI. A second PCR was performed, using oligonucleotide pair Lip2P1/ Lip2T2 and PCR1 products as a template. The PCR2 PT product was cloned into EcoRV site of pBluescript II KS+ as a blunt-ended fragment. (D) Schematic representation of the PUT, PLT and PHT cassette; the f 1.2, f 1.8 and f 1.6 kb I-SceI fragments corresponding to ylURA3, ylLEU2 and hph, respectively, were introduced into the PT cassette at the I-SceI restriction site to generate the PUT, PLT and PHT cassettes, respectively.

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

Fig. 1.

731

732

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

ing construct, denominated JMP116, was checked by restriction analysis with I-SceI and sequenced using the universal oligonucleotide primers T6/SP7. 2.3.4. Construction of the final PUT, PLT and PHT disruption cassettes loxR – URA3 –loxP, loxR – LEU2 – loxP and loxR – hph – loxP module were rescued from JMP113, JMP114 and JMP115, respectively, by I-SceI digestion and cloned into JMP116 at the corresponding ISceI site. The plasmids, designated JMP121, JMP122 and JMP123 carrying the PUT, PLT and PHT cassettes, respectively, were checked by restriction analysis using EcoRI and I-SceI (Fig. 1D). 2.4. Construction of new cre expression plasmids Plasmid RRQ2 (hp4d-cre, LEU2) (Richard et al., 2001) was digested with SalI to release the f 2.1-kb fragment containing the cre gene under control of the hp4d hybrid promoter (Madzak et al., 2000). This fragment was ligated into SalI-digested and dephosphorylated pUB4 (Kerscher et al., 2001) to yield pUB4-CRE and pUB4-CREinv (Fig. 4). These constructs were checked by EcoRI and EcoRV restriction analyses to determine the orientation of the gene. 2.5. Generation of the disruption cassette and transformation of yeast cells All the disruption cassettes PUT, PLT and PHT were generated by PCR amplification using the oligonucleotide primer pair Lip2P1/Lip2T2 and JMP121, JMP122 and JMP123 plasmids, respectively, as templates. Yeast cells were transformed by the lithium acetate method (Le Dall et al., 1994), using 300 ng of purified PCR product. Ura+ and Leu+ transformants were selected on YNBcasa and YNBura, respectively. For selection for hygromycin resistance, transformants were plated onto YPDhyg (100 Ag/ml). Transformant appeared after 36 –48 h of incubation at 28 jC. 2.6. Expression of the Cre recombinase and marker excision Yeast cells were transformed with pRRQ2 (hp4dcre, ylLEU2) for ylURA3 or hph marker excision or

with pUB4-CRE (hp4d-cre, hph) when ylLEU2 or ylURA3 markers were used for gene disruption. The transformants were then selected for Leu+ and HygR phenotypes on YNBura or YPDhyg media, respectively. To cure cells of the cre expression plasmid, cells were grown on YPD for 12 h from a 1:1000 diluted YPD pre-culture. pRRQ2-transformed cells were then streaked on YNBcasa, on which the Leu
segregants were easily identified (Fig. 4D). The loss of pUB4-CRE was checked by replica plating on YPD and YPDhyg. 2.7. Verification of correct disruption and of Cremediated marker rescue Detection of the correct ylLIP2 ORF deletion was realized by either analytical PCR or Southern hybridization. For PCR-mediated verification, the forward L2P1500 and the reverse L2T1500 oligonucleotide primers, located upstream and downstream of the yllip2Dhph locus, respectively, were used to verify correct gene disruption. For correct PHT cassette exchange, the forward L2P1500 and the reverse oligonucleotide primer located within the marker ORF were used. Thus, L2P1500/UraP2 and L2P1500/Leu2P2 primer pairs were used to check that the PHT cassette had been correctly exchanged with the PUT and PLT cassettes, respectively. For Southern blot analysis, yeast genomic DNA from the Dlip2 strain was digested with HindIII, separated by electrophoresis in a 0.8% agarose gel and transferred onto Hybond-N+ nylon membrane (Amersham Pharmacia Biotech, Uppsala, Sweden) as previously described (Le Dall et al., 1994). DNA was then fixed to the membrane by exposure to UV irradiation into a CL100 Ultraviolet Crosslinker (UVP, Upland, CA). A probe corresponding to ylLIP2 ORF was labeled with [32P]dCTP, using the MegaPrime kit (Amersham Pharmacia Biotech). The membrane was hybridized with the probe at 45 jC in 50% formamide– 5  SSC [75 mM sodium citrate buffer, 750 mM NaCl] –5  Denhardt’s solution [0.02% Ficoll 400, 0.02% BSA, 0.02 PVP 36], 0.3% sodium dodecyl sulphate (SDS), 100 Ag salmon sperm DNA/ml for 16 h. Membranes were scanned with a STORM 860 PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and analysed with Molecular Dynamics ImageQuaNT software. Correct pop-out of

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

the marker was verified by analytical PCR with oligonucleotide primers L2P1500/L2T1500 as described above.

3. Results and discussion 3.1. Construction of new gene disruption cassettes In Y. lipolytica, few methods for gene disruption have been reported, and all of them are time-consuming and laborious. Therefore, the aim of this work was to design a more efficient gene knockout method for use in this yeast. To simplify the use of multiple selection markers, we have developed disruption cassettes containing the homologous ylURA3 and ylLEU2 genes, and the heterologous marker hph conferring resistance to hygromycin-B (Hyg) into the disruption cassette. The ylURA3 and ylLEU2 markers were used because Y. lipolytica strains containing deletion alleles are available: ura3-302 (Nicaud et al., 1989b), ura3-41 (Mauersberger et al., 2001) and allele leu2-270 (Barth and Gaillardin, 1996). The heterologous marker presents several advantages. Firstly, direct selection of HygR transformants on complete medium was very efficient and resulted in transformation frequencies similar to those observed with conventional auxotrophic markers (Cordero Otero and Gaillardin, 1996). Secondly, the lack of homology between hph and yeast genes permits disruption cassette integration at the correct locus. Lastly, it was possible to introduce gene disruptions in both wild-type and industrial strains, which often lack the standard auxotrophic markers present in laboratory strains. As the number of marker genes is limited in Y. lipolytica, efficient procedures for marker rescue are required for gene families disruption. We therefore used Cre-lox technology to excise the selectable markers, which could then be reused. The selectable maker in the disruption cassettes were flanked by a loxP and a loxR element permitting its ready excision via the action of the Cre recombinase which induce recombination between the lox sites. The cre recombinase gene was inserted into a new replicating plasmid carrying hph (HygR) as a selectable marker. With the strategy described herein, one can sequentially delete several genes using disruption cassettes

733

with different markers, followed by a one-time Cremediated excision. The disruption cassettes were constructed in three steps. In the first step, a docking platform for the selectable marker was constructed. As shown in Fig. 1A, this was achieved by inserting I-SceI – loxR – EcoRI –loxP – I-SceI motif as a PstI– XhoI fragment into pBluescript II KS+, yielding plasmid JMP112. For construction of the loxR –marker gene – loxP cassette, ylURA3, hph and the ylLEU2 genes were isolated by PCR and cloned into JMP112 between the two lox sites, as an EcoRI fragment, yielding JMP113, JMP114 and JMP115, respectively (Fig. 1B). The ylURA3 and ylLEU2 genes were amplified with their own promoter and terminator whereas the hph gene was amplified with the constitutive hybrid promoter hp4d (Madzak et al., 2000) and the terminator from the XPR2 gene encoding Y. lipolytica extracellular protease (Nicaud et al., 1989a). Marker orientation between the two lox sites was determined by plasmid sequencing. The ylURA3 marker gene was present in the same orientation as loxR and loxP whereas the ylLEU2 and hph markers were in the opposite orientation (Fig. 1B). The second steps consist in the construction of the PT, containing part of the upstream and downstream regions of the gene to be disrupted, separated by the rare I-SceI restriction site (Fig. 1C). To evaluate the efficiency of this new gene disruption method, the ylLIP2 gene, encoding an extracellular lipase, was used to generate the P – ISceI– T cassette. This gene was selected because its deletion can be rapidly evaluated on tributyrin plates (loss of extracellular lipase activity). As previously reported for disruption of the POX gene family, P and T fragments of 1 kb in length were sufficient to generate correct gene disruption in 50% of the transformants (Wang et al., 1999). Therefore, oligonucleotide primer pairs were designed to generate f 1 kb P and T fragments. The final step consisted to introduce the loxR – marker gene – loxP cassette into the PT cassette at the I-SceI site to obtain PUT, PLT and PHT disruption cassettes (Fig. 1D). 3.2. Deletion of the ylLIP2 ORF We first tested the fidelity of the new cassette for targeted gene disruption by deleting the 1.2-kb ylLIP2 ORF by homologous recombination using the PHT

734

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

Fig. 2. Schematic view of PCR-based gene disruption. (A) The PHT cassette was used to generate the lip2Dhph disruption by homologous recombination and by selection of hygromycin-resistant clones. (B) Pop-out of the hph gene by transformation of the lip2Dhph clones with pRRQ2 or pUB4-CRE, a replicative plasmid encoding the Cre recombinase, resulting in a Dlip2 strain.

cassette carrying hph as a selectable marker (Fig. 2A). The Y. lipolytica Po1d strain was transformed with PHT cassette and HygR colonies were selected on YPDhyg. Typically, 6.3  103 transformants were obtained per Ag of PCR fragments. We checked the transformant phenotype by replica plating on YNBtryb plates and screened for a loss of extracellular lipase activity. Correct disruption was then confirmed by analytical PCR and by Southern hybridization (see Materials and methods; Fig. 3). We found that 43% of the transformants with a HygR phenotype presented the correct yllip2 disruption. A lip2Dhph strain was kept and designated MTLY49. We then assessed the ylURA3 and ylLEU2 selectable markers for gene disruption. We transformed the MTLY49 strain with the PUT and PLT cassettes for PHT cassette exchange. Cassette exchange was preferred to direct ylLIP2 ORF disruption because this method made it possible to visualise correct gene exchange directly on a plate. Transformation frequencies did not differ significantly for the PUT and PLT cassettes, and were similar to that for the PHT cassette. Ura+ and Leu+ transformants were selected on YNBcasa and YNBura, respectively, and replica plated on YPDhyg medium to verify that the hph gene had been lost, indicating correct cassette integration. This was further confirmed by analytical PCR using L2P1500/Ura3P2 and L2P1500/Leu2P2 primer pairs for the ylURA3 and ylLEU2 markers, respectively (data not shown). The frequency of correct cassette

integration was about 44% for ylURA3 and 18% for ylLEU2. The resulting strains, lip2DURA3 and lip2DLEU2, were designated MTLY57 and MTLY58, respectively. The lower yield of correct integrations obtained with the PLT cassette reflects higher level of ylLEU2 conversion rather than ylLIP2 gene deletion. Indeed, within the PLT cassette, the promoter and terminator regions of ylLEU2 share 438 and 704 bp, respectively, with the leu2-270 allele (Nicaud et al., 1989b), whereas there are only 101 and 282 bp, respectively, common to the ylURA3 marker of the PUT cassette and the ura3-302 allele. This was confirmed by analytical PCR, using oligonucleotide primers Leu2P1/Leu2P2 located, 321 bp upstream from the ylLEU2 ATG and 302 downstream from the ylLEU2 STOP codon, respectively. If correct cassette exchange occurred, we expected to obtain two bands: a 1.8-kb band corresponding to the ylLEU2 allele present in the PLT cassette and a 1.1kb band corresponding to the leu2-270; whereas, in case of leu2-270 to ylLEU2 conversion, we expected to obtain only the 1.8-kb band (data not shown). 3.3. Influence of the length of P and T on recombination efficiency Comparable results were obtained with both PHT (43%) and PUT (44%) disruption cassette. However, a much lower yield of correct gene disruption was obtained with the PLT cassette (18%), due to a high

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

735

Fig. 3. Verification of gene disruption. (A) Schematic representation of the ylLIP2 locus and localisation of the LIP2 probe used. (B) Verification of gene disruption by PCR. Lane A: 3.6-kb fragment corresponding to the PHT disruption cassette obtained by PCR amplification using JMP122 plasmid as a template and the oligonucleotide primers Lip2P/Lip2T2. Lanes B and C: ylLIP2 locus of strain MTLY49 (lip2Dhph) and MTLY50 (Dlip2) amplified by PCR, using the oligonucleotide primer pair L2P1500/L2T1500 (4.6 and 3 kb fragments, respectively). The 1 kb plus DNA ladder from Promega was used as the molecular size standard (M). (C) Verification of gene disruption by Southern blot analysis. Genomic DNA from the MTLY49 and Po1D strain was digested with HindIII and probed with a radiolabelled fragment corresponding to the ylLIP2 ORF. The strong hybridisation signal at 1559 bp corresponds to the ylLIP2 gene. Lambda DNA digested with BstEII was used as the molecular size standard.

frequency of marker conversion. To optimise the PLT cassette, we determined the optimal lengths of P and T fragments to be used in the disruption cassettes. Various forward and reverse oligonucleotide primer pairs were designed to amplify P and T fragments of 500, 1000, 1500 and 2000 bp (Table 2). PCR amplification with the MTLY58 (lip2DLEU2) genomic DNA using L2T500/L2T500, L2T1000/ L2T1000, L2T1500/L2T1500 and L2T2000/ L2T2000 oligonucleotide primer pairs generated disruption cassettes of 2.8, 3.8, 4.8 and 5.8 kb, respectively, which were used for PHT cassette exchange in the MTLY49 strain (lip2Dhph). Typically, we obtained transformation frequencies of 1.7 –2  103 transformants/Ag DNA. Correct gene exchange was observed in 20%, 26%, 25% and 76% of the transformants for P and T length of 500, 1000, 1500 and 2000 bp, respectively. These results indicate that the

length of P and T should be greater than that of the ylLEU2 fragment to favour gene deletion rather than marker conversion. Indeed, only if P and T were both 2 kb in length did recombination efficiency increase significantly. 3.4. Marker excision The lip2D marker strains were transformed with a cre-expressing plasmid to permit recombination between the loxP and loxR sites, and thus to excise the selectable marker (Fig. 2B). The new constructs pUB4-CRE (Fig. 4B) and pUB4-CREinv (Fig. 4C) were tested for marker excision efficiency by screening for a Ura
phenotype on YNBcasa after transformation of the lip2DURA3 strain (MTLY57) (data not shown). Both vectors triggered the loss of the ylURA3 marker with an efficiency close to 80%. Nevertheless,

736

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

Fig. 4. Schematic representation of the Cre-recombinase encoding plasmid and segregation of the plasmid. (A) The replicative plasmid pRRQ2 containing the cre and ylLEU2 genes. (B, C) The replicative pUB4-CRE and pUB4-CREinv plasmids containing the cre and hph genes. Plasmids were obtained by insertion of the 2.1-kb cre fragment rescued from pRRQ2 by SalI digestion into the corresponding site of pUB4 (19). (D) Segregation of pRRQ2. After two successive 12-h cultures in YPD, cells were streaked on YNBcasa and grown for 12 h. The Leu
strains which had lost pRRQ2 formed small, smooth colonies whereas the Leu+ colonies formed large, rough colonies.

we chose to use pUB4-CRE rather than pUB4CREinv, because of a concern that the hp4d promoter, reversed in pUB4-CREinv, might result in spontaneous recombination, as reported for other replicative plasmids (Fournier et al., 1993). The lip2DURA3 strains could be transformed either with pRRQ2 (cre, LEU2) (Fig. 4A) or with pUB4-CRE (cre, hph) (Fig. 4B) whereas lip2Dhph and lip2DLEU2 strains could only be transformed with pRRQ2 and pUB4CRE, respectively. Transformants were then selected on YNBura or YPDhyg, with a mean frequency of

5  105 transformants/Ag plasmid. Transformants were then replica plated on YNBura, YNBcasa or YPDhyg, to verify the loss of the selectable marker depending on the disruption cassette used. Loss of the selectable marker was confirmed by analytical PCR, using the primer pair L2P1500/L2T1500 (Fig. 3B). The marker excision was very efficient and 98% correct recombination between loxP and loxR sites was observed. The resulting lip2Dlox strain was designated MTLY50 (Dlip2). The cells were then cured of the cre-expressing plasmid by two successive

P. Fickers et al. / Journal of Microbiological Methods 55 (2003) 727–737

12-h cultures in nonselective YPD medium and replica plating on YPD and YPDhyg to check for loss of HygR, or on YNBcasa to check for loss of the ylLEU2 marker. With pRRQ2, Leu+ and Leu
segregants could readily be distinguished phenotypically on YNBcasa (Fig. 4D).

4. Conclusion We have designed a new method for rapid and efficient targeted disruption of multiple genes in the yeast Y. lipolytica. In the disruption cassettes, the auxotrophic ylURA3 and ylLEU2 as well as the heterologous hph marker were flanked by lox sequences allowing for their rapid excision in the presence of Cre recombinase. The set of three different gene disruption cassettes and two different cre-expressing plasmids greatly expands the possibilities for gene knockouts in Y. lipolytica. This method is ideal for both laboratory or industrial Y. lipolytica strains that often lack the conventional auxotrophic markers, and has been used to create multiple gene disruption (Fickers et al., in press).

Acknowledgements We thank Dr. S. Kerscher for providing pUB4. This work was supported by the Institut National de la Recherche Scientifique and by the Centre National de la Recherche Scientifique. P. Fickers is a recipient of a fellowship from the Fond pour la Formation a` la Recherche dans l’Industrie et l’Agriculture. References Barth, G., Gaillardin, C., 1996. Yarrowia lipolytica. In: K, W. (Ed.), Nonconventional Yeasts in Biotechnology. Springer-Verlag, Berlin-Heidelberg, pp. 313 – 388. Casaregola, S., Neuveglise, C., Lepingle, A., Bon, E., Feynerol, C., Artiguenave, F., Wincker, P., Gaillardin, C., 2000. Genomic exploration of the hemiascomycetous yeasts: 17. Yarrowia lipolytica. FEBS Lett. 487, 95 – 100. Cordero Otero, R., Gaillardin, C., 1996. Efficient selection of hygromycin-B resistant Yarrowia lipolytica transformants. Appl. Microbiol. Biotechnol. 46, 143 – 148. Fournier, P., Abbas, A., Chasles, M., Kudla, B., Ogrydziak, D.M., Yaver, D., Xuan, J.W., Peito, A., Ribet, A.M., Feynerol, C., et

737

al., 1993. Colocalization of centromeric and replicative functions on autonomously replicating sequences isolated from the yeast Yarrowia lipolytica. Proc. Natl. Acad. Sci. U. S. A. 90, 4912 – 4916. Kerscher, S.J., Eschemann, A., Okun, P.M., Brandt, U., 2001. External alternative NADH: ubiquinone oxidoreductase redirected to the internal face of the mitochondrial inner membrane rescues complex I deficiency in Yarrowia lipolytica. J. Cell. Sci. 114, 3915 – 3921. Le Dall, M.T., Nicaud, J.M., Gaillardin, C., 1994. Multiple-copy integration in the yeast Yarrowia lipolytica. Curr. Genet. 26, 38 – 44. Madzak, C., Treton, B., Blanchin-Roland, S., 2000. Strong hybrid promoters and integrative expression/secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. J. Mol. Microbiol. Biotechnol. 2, 207 – 216. Maftahi, M., Gaillardin, C., Nicaud, J.M., 1996. Sticky-end polymerase chain reaction method for systematic gene disruption in Saccharomyces cerevisiae. Yeast 12, 859 – 868. Mauersberger, S., Wang, H.J., Gaillardin, C., Barth, G., Nicaud, J.M., 2001. Insertional mutagenesis in the n-alkane-assimilating yeast Yarrowia lipolytica: generation of tagged mutations in genes involved in hydrophobic substrate utilization. J. Bacteriol. 183, 5102 – 5109. Nicaud, J., Fabre, E., Beckerich, J., Fournier, P., Gaillardin, C., 1989a. Coning, sequencing and amplification of the alkaline extracellular protease (XPR2) gene of the yeast Yarrowia lipolyttica. J. Biotechnol. 12, 285 – 298. Nicaud, J.M., Fabre, E., Gaillardin, C., 1989b. Expression of invertase activity in Yarrowia lipolytica and its use as a selective marker. Curr. Genet. 16, 253 – 260. Nicaud, J., Le Clainche, A., Le Dall, M., Wang, H., Gaillardin, C., 1998. Yarrowia lipolytica, a yeast model for the genetic studies of hydroxy fatty acids biotransformation into lactone. J. Mol. Catal., B Enzym. 5, 175 – 181. Pignede, G., Wang, H., Fudalej, F., Gaillardin, C., Seman, M., Nicaud, J.M., 2000. Characterization of an extracellular lipase encoded by LIP2 in Yarrowia lipolytica. J. Bacteriol. 182, 2802 – 2810. Querol, A., Barrio, E., Huerta, T., Ramon, D., 1992. Molecular monitoring of wine fermentations conducted by active dry yeast strains. Appl. Environ. Microbiol. 58, 2948 – 2953. Richard, M., Quijano, R.R., Bezzate, S., Bordon-Pallier, F., Gaillardin, C., 2001. Tagging morphogenetic genes by insertional mutagenesis in the yeast Yarrowia lipolytica. J. Bacteriol. 183, 3098 – 3107. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sauer, B., 1987. Functional expression of the Cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 2087 – 2096. Wang, H.J., Le Dall, M.T., Wach, Y., Laroche, C., Belin, J.M., Gaillardin, C., Nicaud, J.M., 1999. Evaluation of acyl coenzyme A oxidase (Aox) isozyme function in the n-alkane-assimilating yeast Yarrowia lipolytica. J. Bacteriol. 181, 5140 – 5148.