- Email: [email protected]
New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis
Molecular and Cellular Probes xxx (2016) 1e6
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Original research article
New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis € ck b, Christa Ewers a, Tobias Eisenberg a, b Ahmad Fawzy a, b, c, *, Michael Zscho €t, Institut für Hygiene und Infektionskrankheiten der Tiere, Frankfurter Straße 85-89 35392, Gießen, Germany Justus Liebig Universita Landesbetrieb Hessisches Landeslabor, Schubertstraße 60 D-35392 Gießen, Germany c Cairo University, Faculty of Veterinary Medicine, Department of Medicine and Infectious Diseases, Giza Square 12211, Egypt a
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 December 2015 Received in revised form 4 February 2016 Accepted 4 February 2016 Available online xxx
Variable number tandem repeat (VNTR) is a frequently employed typing method of Mycobacterium avium paratuberculosis (MAP) isolates. Based on whole genome sequencing in a previous study, allelic diversity at some VNTR loci seems to over- or under-estimate the actual phylogenetic variance among isolates. Interestingly, two closely related isolates on one farm showed polymorphism at the VNTR 7 locus, raising concerns about the misleading role that it might play in genotyping. We aimed to investigate the underlying basis of VNTR 7-polymorphism by analyzing sequence data for published genomes and field isolates of MAP and other M. avium complex (MAC) members. In contrast to MAP strains from cattle, strains from sheep displayed an “imperfect” repeat within VNTR 7, which was identical to respective allele types in other MAC genomes. Subspecies- and strain-specific single nucleotide polymorphisms (SNPs) and two novel (16 and 56 bp) repeats were detected. Given the combination of the three existing repeats, there are at least five different patterns for VNTR 7. The present findings highlight a higher polymorphism and probable instability of VNTR 7 locus that needs to be considered and challenged in future studies. Until then, sequencing of this locus in future studies is important to correctly assign the underlying allele types.1 © 2016 Elsevier Ltd. All rights reserved.
Keywords: Paratuberculosis Mycobacterium Imperfect SNPs VNTR
1. Introduction Mycobacterium avium paratuberculosis (MAP) is a member of the M. avium complex (MAC) and the causative agent of Johne's disease, one of the most economically important diseases in ruminants [1]. The disease is characterized by emaciation and chronic granulomatous enteritis and is suspected to play a role in Crohn's disease in humans [2]. Genotyping of these pathogens helps to better understand the epidemiology of disease and allows sources of infection to be identified, with an ultimate goal of designing more efficient control programs [3]. According to host preference, MAP was originally classified as cattle (C) and sheep (S) types. Later, pulsed-field gel electrophoresis (PFGE) was able to further classify S strains into type I and type III, while assigning solely type II to all C
* Corresponding author. E-mail address: [email protected] (A. Fawzy). 1 Note: Partial VNTR 7 sequences reported here have been deposited in the GenBank database under accession numbers KT824780, KT833325, KT833326, KT833327 and KT833328.
strains [4]. Nowadays, mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) genotyping is one of the most widely used typing methods of MAP isolates. This is a rapid PCR-based method that provides higher typing resolution within the main strains, and its results can be readily compared among laboratories using an online database [5]. Ahlstrom et al. [6] described some limitations of MIRU-VNTR typing compared with SNP analysis based on whole genome sequencing data, where MIRU-VNTR over- or under-estimated the phylogenetic variance among MAP isolates. This necessitates a reevaluation of the loci included in the MIRU-VNTR typing scheme. Among the MIRU-VNTR loci used, polymorphism at the VNTR 7 locus in two closely related isolates from the same farm raises a key question as to the suitability of VNTR 7 for molecular epidemiology. In order to gain a deeper insight into the underlying basis of polymorphism at this locus, we aimed to investigate respective sequence data.
http://dx.doi.org/10.1016/j.mcp.2016.02.002 0890-8508/© 2016 Elsevier Ltd. All rights reserved.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
2
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
2. Materials and methods 2.1. Analysis of the available MAP genomes We used an online tool (http://insilico.ehu.es/PCR/index.php? mo¼Mycobacterium) for in silico amplification of the VNTR 7 locus in MAP strain k10 (GenBank accession number: NC_002944)
using primers designed by Thibault et al. [7]. All homologous sequences of MAP (n ¼ 31) and other MAC (n ¼ 31) origins were obtained by BLAST N analysis and compared using an online multiple sequence alignment software (http://tcoffee.crg.cat/apps/ tcoffee/do:regular) hosted by the Centre for Genomic Regulation, Barcelona [8].
Fig. 1. Multiple sequence alignment of published partial sequences of VNTR 7 locus of Mycobacterium avium complex (MAC) origin (GenBank accession numbers are provided next to each sequence). In contrast to (MAP) cattle (C) genomes (one asterisk), which always displayed either one or two 22 bp perfect repeats (highlighted with red and green colors), all MAP sheep (S) genomes (#) had a 22 bp imperfect repeat with a length of 12 bp (highlighted in blue), which was identical to all other MAC genomes (^). A (C > T) SNP at position 89 bp (three asterisks) clearly differentiates between MAP and all other MAC isolates, while a (G > A) SNP at position 100 bp (Two asterisks) differentiates between MAP C and S types (positions were calculated relative to a 203 bp PCR product amplified usinh primers described by Thibault et al. (2007).(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
3
Fig. 1. (Continued).
2.2. Bacterial isolates MAP isolates (n ¼ 18) were cultured from individual faecal samples from cattle from 18 different herds in two German states (16 from Hesse and 2 from Thuringia). Herrold's egg yolk medium (HEYM) containing mycobactin J (BD, Heidelberg, Germany) was used for primary culture, and all colonies were confirmed as MAP based on mycobactin J dependency and an F57-based PCR [9]. Two M. avium subsp. hominissuis (MAH) field isolates from a pig and a gundi, respectively, were confirmed using a duplex-PCR for the detection of IS901 and IS1245 [10] as well as M. avium subsp. avium (DSM 44156) and M. avium subsp. silvaticum (DSM 44175) reference
strains were also included in this analysis. All MAC isolates other than MAP (n ¼ 4) are referred to as M. avium (MA) in this paper. 2.3. VNTR7 PCR DNA was extracted from all isolates (2e3 colonies) by boiling in 100 ml distilled water for 20 min, followed by centrifugation at 20 817 g for 5 min. The PCR reaction (20 ml) contained 10 ml of Hotstar Taq MasterMix (Qiagen, Hilden, Germany), 1 ml of each forward and reverse primer (10 pmol/ml) (TIB MOLBIOL, Berlin, Germany) [7], 6 ml DNase free PCR-grade water (Qiagen), and 2 ml of the extracted DNA. PCR conditions were: 1 (95 C, 15 min), 40
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
4
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
software was used to search for tandem repeats in the sequence data (http://tandem.bu.edu/trf/trf.html). All sequences were aligned with T-Coffee software (http://tcoffee.crg.cat/apps/tcoffee/ do:regular) [8]. 3. Results 3.1. Analysis of MAP genomes All available VNTR 7 sequences of MAP and MA origins were analyzed employing BLAST N. Although almost all sequences displayed at least one copy of the classically described 22 bp perfect repeat (CGAAATATTCGCCGTGAGAACA) [7], only MAP C sequences exhibited either one (n ¼ 1) or two (n ¼ 24) perfect copies. Interestingly, all MAP S (n ¼ 6) and MA (n ¼ 31) sequences displayed a 22 bp “imperfect” repeat with a length of 12 bp (CGTTCGGCGCGC). Two nucleotides (in bold) in the sequence of the “imperfect” repeat were different from the respective ones representing the perfect sequence, while the other 10 nucleotides (underlined) were identical. Two discriminating SNPs were also evident. One SNP (at position 89) differentiates all MAP from MA isolates, whereas the other (at position 100) is MAP (type S and C) specific (Fig. 1). 3.2. VNTR7 PCR Fig. 2. Gel electrophoresis of representative size polymorphism-based allele types of VNTR 7 locus in MAP and MA isolates studied. M: PBR 328 marker (Carl Roth, Karlsruhe, Germany); lanes 1, 4, 5, and 6 are MAP cattle isolates; lane 2 is Mycobacterium avium spp. avium reference strain (DSM 44156); lane 3 is Mycobacterium avium ssp. silvaticum reference strain (DSM 44175). Theoretical number of the classical 22 bp repeat is inserted above each band. Above each lane, letter patterns are assigned based on sequence data (Fig. 3).
(94 C, 30 s; 58 C, 30 s; 72 C, 30 s) and 1 (72 C, 10 min). PCR products were stained with ethidium bromide in a 2% agarose gel (100 V for 1.5 h) and then analyzed using a gel documentation system (BioDoc-It, UVP, UK). 2.4. Sequencing and in silico analysis PCR amplicons were purified using MicroElute DNA Cycle-Pure Kit (OMEGA bio-tek, Norcross, USA) and sent to Seqlab€ ttingen, Germany) for sequencing usMicrosynth laboratories (Go ing both forward and reverse primers. Tandem repeat finder online
To confirm the present findings using field isolates, we amplified the same locus from MAP isolates from cattle and MA isolates (including reference strains). All isolates were represented by a specific band on agarose gels. According to band size by comparison to the marker, we calculated a theoretical copy number for the 22 bp tandem repeat, originally described by Thibault et al. [7] (cf. Fig. 2). 3.3. Sequencing and in silico analysis Following the analysis of the sequenced PCR products, we detected at least one copy of the expected 22 bp tandem repeat in all isolates; furthermore, two other repeats were found in some MAP isolates from cattle with 16 bp repeat (CTGACCACGGACTCGA) and 56 bp (CACGAAATATTCGCCGTGAGAACACGTGCGGCGAAGGCTGGGCCGGCCCGAAAAGC) sizes, respectively. One copy of the 22 bp perfect repeat (underlined) is included within the 56 bp sequence. Interestingly, the “imperfect” repeat
Fig. 3. Schematic illustration of different VNTR 7 locus patterns based on combinations of the copy numbers of three different tandem repeats. Four different patterns (A, C, D, and E) were detected among MAP cattle isolates (n ¼ 18), while all MA isolates (n ¼ 4) displayed the B pattern. Sequences of each tandem repeat are provided in the text. The 56 bp tandem repeat depends on the sequence of the 22 bp one and is only complete in patterns D and E where there are two perfect copies of the 22 bp repeat. DesA3-1 (Locus tag: MAP_RS17190, Gene ID: 2721302) is the downstream gene.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
detected in silico and the characteristic SNPs could be confirmed in the four MA isolates (Fig. 3; Supplementary Fig. 1). Based on combinations of the three different tandem repeats, at least five different locus patterns were detected among the isolates investigated here (Fig. 3; Supplementary Fig. 1). 4. Discussion We conducted this study in an attempt to decipher the MIRUVNTR loci used for MAP genotyping at the sequence level, since misleading results of this typing method were evident based on whole genome sequencing data. In particular, the VNTR 7 locus showed the most erroneous results. Polymorphism at this locus was evident for two closely related strains on one farm, while possibly as a matter of homoplasy - phylogenetically distant strains seemed to acquire the same allele type at this locus [6]. Based on in silico analysis of the VNTR 7 locus, only MAP S and MA sequences exhibited a 22 bp “imperfect” repeat with a length of 12 bp, whereas all MAP C strains displayed either one or two copies of the perfect repeat described by Thibault et al. [7]. Subspecies- and strain-specific SNPs were also evident (Fig. 1). Sequencing of the same locus from MAP and MA isolates confirmed the in silico findings and revealed two additional tandem repeats that had not been described previously (Fig. 3). In accordance with our results, additional nucleotides at the VNTR 7 locus were reported previously for three MAP S strains (type III) from sheep in Germany [11] and one MAP isolate from a red deer in Austria [12]. However, none of these studies provided precise sequence data. Moreover, the same imperfect repeat sequence was reported for the VNTR 7 locus of a MAH strain isolated from pigs in Germany [10]. As imperfect repeats are much more stable than perfect sites, due to the action of mismatch-repair system and the single stranded DNA (ssDNA) exonucleases [13], it is tempting to speculate that the imperfect repeat at the VNTR 7 locus could be conserved for MAP S strains. However, this hypothesis requires testing. One SNP differentiated all MAP from other MAC genomes, and there was another MAP strain-specific SNP at which MAP S had the same nucleotide as all MAC genomes (Fig. 1). The present findings collectively support the hypothesis that MAP S strains are an intermediate between MAH and MAP C strains, as derived from comprehensive genomic data sets [14,15]. In contrast to Thibault et al., [7], we found that the VNTR 7 locus contains not only a 22 bp repeat, but also two additional repeats (16 bp and 56 bp) (Fig. 3). Based on our findings, conducting only conventional PCR with subsequent gel electrophoresis cannot correctly assign respective repeat numbers based on size polymorphism (Fig. 2). VNTRs were first hypothesized to be non-functional intergenic DNA; however, there is sufficient evidence that they help bacteria to alter genetically and phenotypically, as an adaptation mechanism to the changing environment [16]. In our example, MAP could exploit the polymorphism possibilities at three different closely located tandem repeats as powerful machinery for adaptation via the modulation of expression of the downstream DesA3_1 gene (Fig. 3). This gene encodes a linoeoyl-CoA desaturase (EC 1.14.19.3), which is involved in linoleic acid metabolism and is thus important for mycolic acid formation in the cell wall of mycobacteria. It was shown to be upregulated in human tuberculous granuloma, possibly to evade the host immune system by modulating lipid content of the cell wall [17]. Therefore, one could speculate that gene expression in MAP may be regulated by a tandem repeatbased reversible process (phase variation) at particular stages of host-mediated bacterial growth rates. The phase variation process could be a good explanation for the findings of van Hulzen et al., [18], who speculated a clonal variance
5
of MAP strains showing polymorphism at the VNTR 7 locus within animals of different ages in the same herd with no trading history. It could also explain the homoplasy at this locus reported by Ahlstrom et al. [6] based on whole genome sequence data. Variants of highly mutable loci during the same outbreak were also previously described for other organisms, such as Shigella sonnei [19] and Escherichia coli O157:H7 [20]. Contrarily, the VNTR 7 locus was found to be stable during natural infection by monitoring the repeat number of isolates from different animals from one farm over a time period of two years [21]. Given the extremely slow growth characteristics of MAP, a more comprehensive study challenging the stability of the VNTR 7 locus should be conducted over a longer period of time and covering different disease stages, in order to determine its usefulness as a marker in epidemiological studies. In conclusion, an “imperfect” repeat at the VNTR 7 locus was detected in the MAP S and MA strains studied, and might represent a basis for differentiation between MAP S and C strains. Subspeciesand strain-specific SNPs within VNTR 7 locus are reported. Moreover, besides the classical 22 bp repeat, two more tandem repeats were detected at the VNTR 7 locus; therefore, the stability of this tandem repeat rich locus should be assessed in a longitudinal study. Until then, sequencing of the VNTR 7 locus is the only means to correctly assign the three tandem repeats. Acknowledgements We thank Ulrike Kling for her assistance to isolate MAP strains and the German Academic Exchange Service (DAAD). The Hessian State Laboratory is supported by the Hessian Ministry for the Environment, Climate Change, Agriculture and Consumer Protection. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.mcp.2016.02.002. References [1] W.C. Losinger, Economic impact of reduced milk production associated with Johne's disease on dairy operations in the USA, J. Dairy. Res. 72 (2005) 425e432. [2] E. Liverani, E. Scaioli, C. Cardamone, P. Dal Monte, A. Belluzzi, Mycobacterium avium subspecies paratuberculosis in the etiology of Crohn's disease, cause or epiphenomenon? World. J. Gastroenterol. 20 (2014) 13060e13070. [3] J.P. Bannantine, L.L. Li, S. Sreevatsan, V. Kapur, How does a Mycobacterium change its spots? Applying molecular tools to track diverse strains of Mycobacterium avium subspecies paratuberculosis, Lett. Appl. Microbiol. 57 (2013) 165e173. [4] K. Stevenson, V.M. Hughes, L. de Juan, N.F. Inglis, F. Wright, J.M. Sharp, Molecular characterization of pigmented and nonpigmented isolates of Mycobacterium avium subsp. paratuberculosis, J. Clin. Microbiol. 40 (2002) 1798e1804. [5] E. Castellanos, L. de Juan, L. Domínguez, A. Aranaz, Progress in molecular typing of Mycobacterium avium subspecies paratuberculosis, Res. Vet. Sci. 92 (2012) 169e179. [6] C. Ahlstrom, H.W. Barkema, K. Stevenson, R.N. Zadoks, R. Biek, R. Kao, et al., Limitations of variable number of tandem repeat typing identified through whole genome sequencing of Mycobacterium avium subsp. paratuberculosis on a national and herd level, BMC Genomics 16 (2015) 161. [7] V.C. Thibault, M. Grayon, M.L. Boschiroli, C. Hubbans, P. Overduin, K. Stevenson, et al., New variable-number tandem-repeat markers for typing Mycobacterium avium subsp. paratuberculosis and M. avium strains: comparison with IS900 and IS1245 restriction fragment length polymorphism typing, J. Clin. Microbiol. 45 (2007) 2404e2410. [8] C. Notredame, D.G. Higgins, J. Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. Mol. Biol. 302 (2000) 205e217. € ck, Improvement of sensitivity for [9] A. Fawzy, T. Eisenberg, A. El-Sayed, M. Zscho Mycobacterium avium subsp. paratuberculosis (MAP) detection in bovine fecal samples by specific duplex F57/IC real-time and conventional IS900 PCRs after solid culture enrichment, Trop. Anim. Health. Prod. 47 (2015) 721e726.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
6
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
[10] T. Eisenberg, R. Volmer, U. Eskens, I. Moser, A. Nesseler, C. Sauerwald, et al., Outbreak of reproductive disorders and mycobacteriosis in swine associated with a single strain of Mycobacterium avium subspecies hominissuis, Vet. Microbiol. 159 (2012) 69e76. €bius, I. Fritsch, G. Luyven, H. Hotzel, H. Ko €hler, Unique genotypes of [11] P. Mo Mycobacterium avium subsp. paratuberculosis strains of type III, Vet. Microbiol. 139 (2009) 398e404. [12] H. Gerritsmann, G.L. Stalder, J. Spergser, F. Hoelzl, A. Deutz, A. Kuebber-Heiss, et al., Multiple strain infections and high genotypic diversity among Mycobacterium avium subsp. paratuberculosis field isolates from diseased wild and domestic ruminant species in the eastern Alpine region of Austria, Infect. Genet. Evol. 21 (2014) 244e251. [13] V.V. Feschenko, L.A. Rajman, S.T. Lovett, Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 1134e1139. [14] K. Dohmann, B. Strommenger, K. Stevenson, L. de Juan, J. Stramann, V. Kapur, et al., Characterization of genetic differences between Mycobacterium avium subsp. paratuberculosis type I and type II Isolates, J. Clin. Microbiol. 41 (2003) 5215e5223. [15] J.P. Bannantine, C.W. Wu, C. Hsu, S. Zhou, D.C. Schwartz, D.O. Bayles, et al., Genome sequencing of ovine isolates of Mycobacterium avium subspecies
[16] [17]
[18]
[19]
[20]
[21]
paratuberculosis offers insights into host association, BMC, Genom 13 (2012) 89. K. Zhou, A. Aertsen, C.W. Michiels, The role of variable DNA tandem repeats in bacterial adaptation, FEMS, Microbiol. Rev. 38 (2014) 119e141. H. Rachman, M. Strong, T. Ulrichs, L. Grode, J. Schuchhardt, H. Mollenkopf, et al., Unique transcriptome signature of Mycobacterium tuberculosis in pulmonary tuberculosis, Infect. Immun. 74 (2006) 1233e1242. K.J.E. van Hulzen, H.C.M. Heuven, M. Nielen, J. Hoeboer, W.J. Santema, A.P. Koets, Different Mycobacterium avium subsp. paratuberculosis MIRU-VNTR patterns coexist within cattle herds, Vet. Microbiol. 148 (2011) 419e424. S.Y. Liang, H. Watanabe, J. Terajima, C.C. Li, J.C. Liao, S.K. Tung, et al., Multilocus variable-number tandem-repeat analysis for molecular typing of Shigella sonnei, J. Clin. Microbiol. 45 (2007) 3574e3580. A.C. Noller, M.C. McEllistrem, A.G.F. Pacheco, D.J. Boxrud, L.H. Harrison, Multilocus variable-number tandem repeat analysis distinguishes outbreak and sporadic Escherichia coli O157:H7 isolates, J. Clin. Microbiol. 41 (2003) 5389e5397. €hler, M. Weigoldt, G.F. Gerlach, P. Mo € bius, Stability of genoN. Kasnitz, H. Ko typing target sequences of Mycobacterium avium subsp. paratuberculosis upon cultivation on different media, in vitro- and in vivo passage, and natural infection, Vet. Microbiol. 167 (2013) 573e583.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Original research article
New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis € ck b, Christa Ewers a, Tobias Eisenberg a, b Ahmad Fawzy a, b, c, *, Michael Zscho €t, Institut für Hygiene und Infektionskrankheiten der Tiere, Frankfurter Straße 85-89 35392, Gießen, Germany Justus Liebig Universita Landesbetrieb Hessisches Landeslabor, Schubertstraße 60 D-35392 Gießen, Germany c Cairo University, Faculty of Veterinary Medicine, Department of Medicine and Infectious Diseases, Giza Square 12211, Egypt a
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 December 2015 Received in revised form 4 February 2016 Accepted 4 February 2016 Available online xxx
Variable number tandem repeat (VNTR) is a frequently employed typing method of Mycobacterium avium paratuberculosis (MAP) isolates. Based on whole genome sequencing in a previous study, allelic diversity at some VNTR loci seems to over- or under-estimate the actual phylogenetic variance among isolates. Interestingly, two closely related isolates on one farm showed polymorphism at the VNTR 7 locus, raising concerns about the misleading role that it might play in genotyping. We aimed to investigate the underlying basis of VNTR 7-polymorphism by analyzing sequence data for published genomes and field isolates of MAP and other M. avium complex (MAC) members. In contrast to MAP strains from cattle, strains from sheep displayed an “imperfect” repeat within VNTR 7, which was identical to respective allele types in other MAC genomes. Subspecies- and strain-specific single nucleotide polymorphisms (SNPs) and two novel (16 and 56 bp) repeats were detected. Given the combination of the three existing repeats, there are at least five different patterns for VNTR 7. The present findings highlight a higher polymorphism and probable instability of VNTR 7 locus that needs to be considered and challenged in future studies. Until then, sequencing of this locus in future studies is important to correctly assign the underlying allele types.1 © 2016 Elsevier Ltd. All rights reserved.
Keywords: Paratuberculosis Mycobacterium Imperfect SNPs VNTR
1. Introduction Mycobacterium avium paratuberculosis (MAP) is a member of the M. avium complex (MAC) and the causative agent of Johne's disease, one of the most economically important diseases in ruminants [1]. The disease is characterized by emaciation and chronic granulomatous enteritis and is suspected to play a role in Crohn's disease in humans [2]. Genotyping of these pathogens helps to better understand the epidemiology of disease and allows sources of infection to be identified, with an ultimate goal of designing more efficient control programs [3]. According to host preference, MAP was originally classified as cattle (C) and sheep (S) types. Later, pulsed-field gel electrophoresis (PFGE) was able to further classify S strains into type I and type III, while assigning solely type II to all C
* Corresponding author. E-mail address: [email protected] (A. Fawzy). 1 Note: Partial VNTR 7 sequences reported here have been deposited in the GenBank database under accession numbers KT824780, KT833325, KT833326, KT833327 and KT833328.
strains [4]. Nowadays, mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) genotyping is one of the most widely used typing methods of MAP isolates. This is a rapid PCR-based method that provides higher typing resolution within the main strains, and its results can be readily compared among laboratories using an online database [5]. Ahlstrom et al. [6] described some limitations of MIRU-VNTR typing compared with SNP analysis based on whole genome sequencing data, where MIRU-VNTR over- or under-estimated the phylogenetic variance among MAP isolates. This necessitates a reevaluation of the loci included in the MIRU-VNTR typing scheme. Among the MIRU-VNTR loci used, polymorphism at the VNTR 7 locus in two closely related isolates from the same farm raises a key question as to the suitability of VNTR 7 for molecular epidemiology. In order to gain a deeper insight into the underlying basis of polymorphism at this locus, we aimed to investigate respective sequence data.
http://dx.doi.org/10.1016/j.mcp.2016.02.002 0890-8508/© 2016 Elsevier Ltd. All rights reserved.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
2
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
2. Materials and methods 2.1. Analysis of the available MAP genomes We used an online tool (http://insilico.ehu.es/PCR/index.php? mo¼Mycobacterium) for in silico amplification of the VNTR 7 locus in MAP strain k10 (GenBank accession number: NC_002944)
using primers designed by Thibault et al. [7]. All homologous sequences of MAP (n ¼ 31) and other MAC (n ¼ 31) origins were obtained by BLAST N analysis and compared using an online multiple sequence alignment software (http://tcoffee.crg.cat/apps/ tcoffee/do:regular) hosted by the Centre for Genomic Regulation, Barcelona [8].
Fig. 1. Multiple sequence alignment of published partial sequences of VNTR 7 locus of Mycobacterium avium complex (MAC) origin (GenBank accession numbers are provided next to each sequence). In contrast to (MAP) cattle (C) genomes (one asterisk), which always displayed either one or two 22 bp perfect repeats (highlighted with red and green colors), all MAP sheep (S) genomes (#) had a 22 bp imperfect repeat with a length of 12 bp (highlighted in blue), which was identical to all other MAC genomes (^). A (C > T) SNP at position 89 bp (three asterisks) clearly differentiates between MAP and all other MAC isolates, while a (G > A) SNP at position 100 bp (Two asterisks) differentiates between MAP C and S types (positions were calculated relative to a 203 bp PCR product amplified usinh primers described by Thibault et al. (2007).(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
3
Fig. 1. (Continued).
2.2. Bacterial isolates MAP isolates (n ¼ 18) were cultured from individual faecal samples from cattle from 18 different herds in two German states (16 from Hesse and 2 from Thuringia). Herrold's egg yolk medium (HEYM) containing mycobactin J (BD, Heidelberg, Germany) was used for primary culture, and all colonies were confirmed as MAP based on mycobactin J dependency and an F57-based PCR [9]. Two M. avium subsp. hominissuis (MAH) field isolates from a pig and a gundi, respectively, were confirmed using a duplex-PCR for the detection of IS901 and IS1245 [10] as well as M. avium subsp. avium (DSM 44156) and M. avium subsp. silvaticum (DSM 44175) reference
strains were also included in this analysis. All MAC isolates other than MAP (n ¼ 4) are referred to as M. avium (MA) in this paper. 2.3. VNTR7 PCR DNA was extracted from all isolates (2e3 colonies) by boiling in 100 ml distilled water for 20 min, followed by centrifugation at 20 817 g for 5 min. The PCR reaction (20 ml) contained 10 ml of Hotstar Taq MasterMix (Qiagen, Hilden, Germany), 1 ml of each forward and reverse primer (10 pmol/ml) (TIB MOLBIOL, Berlin, Germany) [7], 6 ml DNase free PCR-grade water (Qiagen), and 2 ml of the extracted DNA. PCR conditions were: 1 (95 C, 15 min), 40
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
4
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
software was used to search for tandem repeats in the sequence data (http://tandem.bu.edu/trf/trf.html). All sequences were aligned with T-Coffee software (http://tcoffee.crg.cat/apps/tcoffee/ do:regular) [8]. 3. Results 3.1. Analysis of MAP genomes All available VNTR 7 sequences of MAP and MA origins were analyzed employing BLAST N. Although almost all sequences displayed at least one copy of the classically described 22 bp perfect repeat (CGAAATATTCGCCGTGAGAACA) [7], only MAP C sequences exhibited either one (n ¼ 1) or two (n ¼ 24) perfect copies. Interestingly, all MAP S (n ¼ 6) and MA (n ¼ 31) sequences displayed a 22 bp “imperfect” repeat with a length of 12 bp (CGTTCGGCGCGC). Two nucleotides (in bold) in the sequence of the “imperfect” repeat were different from the respective ones representing the perfect sequence, while the other 10 nucleotides (underlined) were identical. Two discriminating SNPs were also evident. One SNP (at position 89) differentiates all MAP from MA isolates, whereas the other (at position 100) is MAP (type S and C) specific (Fig. 1). 3.2. VNTR7 PCR Fig. 2. Gel electrophoresis of representative size polymorphism-based allele types of VNTR 7 locus in MAP and MA isolates studied. M: PBR 328 marker (Carl Roth, Karlsruhe, Germany); lanes 1, 4, 5, and 6 are MAP cattle isolates; lane 2 is Mycobacterium avium spp. avium reference strain (DSM 44156); lane 3 is Mycobacterium avium ssp. silvaticum reference strain (DSM 44175). Theoretical number of the classical 22 bp repeat is inserted above each band. Above each lane, letter patterns are assigned based on sequence data (Fig. 3).
(94 C, 30 s; 58 C, 30 s; 72 C, 30 s) and 1 (72 C, 10 min). PCR products were stained with ethidium bromide in a 2% agarose gel (100 V for 1.5 h) and then analyzed using a gel documentation system (BioDoc-It, UVP, UK). 2.4. Sequencing and in silico analysis PCR amplicons were purified using MicroElute DNA Cycle-Pure Kit (OMEGA bio-tek, Norcross, USA) and sent to Seqlab€ ttingen, Germany) for sequencing usMicrosynth laboratories (Go ing both forward and reverse primers. Tandem repeat finder online
To confirm the present findings using field isolates, we amplified the same locus from MAP isolates from cattle and MA isolates (including reference strains). All isolates were represented by a specific band on agarose gels. According to band size by comparison to the marker, we calculated a theoretical copy number for the 22 bp tandem repeat, originally described by Thibault et al. [7] (cf. Fig. 2). 3.3. Sequencing and in silico analysis Following the analysis of the sequenced PCR products, we detected at least one copy of the expected 22 bp tandem repeat in all isolates; furthermore, two other repeats were found in some MAP isolates from cattle with 16 bp repeat (CTGACCACGGACTCGA) and 56 bp (CACGAAATATTCGCCGTGAGAACACGTGCGGCGAAGGCTGGGCCGGCCCGAAAAGC) sizes, respectively. One copy of the 22 bp perfect repeat (underlined) is included within the 56 bp sequence. Interestingly, the “imperfect” repeat
Fig. 3. Schematic illustration of different VNTR 7 locus patterns based on combinations of the copy numbers of three different tandem repeats. Four different patterns (A, C, D, and E) were detected among MAP cattle isolates (n ¼ 18), while all MA isolates (n ¼ 4) displayed the B pattern. Sequences of each tandem repeat are provided in the text. The 56 bp tandem repeat depends on the sequence of the 22 bp one and is only complete in patterns D and E where there are two perfect copies of the 22 bp repeat. DesA3-1 (Locus tag: MAP_RS17190, Gene ID: 2721302) is the downstream gene.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
detected in silico and the characteristic SNPs could be confirmed in the four MA isolates (Fig. 3; Supplementary Fig. 1). Based on combinations of the three different tandem repeats, at least five different locus patterns were detected among the isolates investigated here (Fig. 3; Supplementary Fig. 1). 4. Discussion We conducted this study in an attempt to decipher the MIRUVNTR loci used for MAP genotyping at the sequence level, since misleading results of this typing method were evident based on whole genome sequencing data. In particular, the VNTR 7 locus showed the most erroneous results. Polymorphism at this locus was evident for two closely related strains on one farm, while possibly as a matter of homoplasy - phylogenetically distant strains seemed to acquire the same allele type at this locus [6]. Based on in silico analysis of the VNTR 7 locus, only MAP S and MA sequences exhibited a 22 bp “imperfect” repeat with a length of 12 bp, whereas all MAP C strains displayed either one or two copies of the perfect repeat described by Thibault et al. [7]. Subspecies- and strain-specific SNPs were also evident (Fig. 1). Sequencing of the same locus from MAP and MA isolates confirmed the in silico findings and revealed two additional tandem repeats that had not been described previously (Fig. 3). In accordance with our results, additional nucleotides at the VNTR 7 locus were reported previously for three MAP S strains (type III) from sheep in Germany [11] and one MAP isolate from a red deer in Austria [12]. However, none of these studies provided precise sequence data. Moreover, the same imperfect repeat sequence was reported for the VNTR 7 locus of a MAH strain isolated from pigs in Germany [10]. As imperfect repeats are much more stable than perfect sites, due to the action of mismatch-repair system and the single stranded DNA (ssDNA) exonucleases [13], it is tempting to speculate that the imperfect repeat at the VNTR 7 locus could be conserved for MAP S strains. However, this hypothesis requires testing. One SNP differentiated all MAP from other MAC genomes, and there was another MAP strain-specific SNP at which MAP S had the same nucleotide as all MAC genomes (Fig. 1). The present findings collectively support the hypothesis that MAP S strains are an intermediate between MAH and MAP C strains, as derived from comprehensive genomic data sets [14,15]. In contrast to Thibault et al., [7], we found that the VNTR 7 locus contains not only a 22 bp repeat, but also two additional repeats (16 bp and 56 bp) (Fig. 3). Based on our findings, conducting only conventional PCR with subsequent gel electrophoresis cannot correctly assign respective repeat numbers based on size polymorphism (Fig. 2). VNTRs were first hypothesized to be non-functional intergenic DNA; however, there is sufficient evidence that they help bacteria to alter genetically and phenotypically, as an adaptation mechanism to the changing environment [16]. In our example, MAP could exploit the polymorphism possibilities at three different closely located tandem repeats as powerful machinery for adaptation via the modulation of expression of the downstream DesA3_1 gene (Fig. 3). This gene encodes a linoeoyl-CoA desaturase (EC 1.14.19.3), which is involved in linoleic acid metabolism and is thus important for mycolic acid formation in the cell wall of mycobacteria. It was shown to be upregulated in human tuberculous granuloma, possibly to evade the host immune system by modulating lipid content of the cell wall [17]. Therefore, one could speculate that gene expression in MAP may be regulated by a tandem repeatbased reversible process (phase variation) at particular stages of host-mediated bacterial growth rates. The phase variation process could be a good explanation for the findings of van Hulzen et al., [18], who speculated a clonal variance
5
of MAP strains showing polymorphism at the VNTR 7 locus within animals of different ages in the same herd with no trading history. It could also explain the homoplasy at this locus reported by Ahlstrom et al. [6] based on whole genome sequence data. Variants of highly mutable loci during the same outbreak were also previously described for other organisms, such as Shigella sonnei [19] and Escherichia coli O157:H7 [20]. Contrarily, the VNTR 7 locus was found to be stable during natural infection by monitoring the repeat number of isolates from different animals from one farm over a time period of two years [21]. Given the extremely slow growth characteristics of MAP, a more comprehensive study challenging the stability of the VNTR 7 locus should be conducted over a longer period of time and covering different disease stages, in order to determine its usefulness as a marker in epidemiological studies. In conclusion, an “imperfect” repeat at the VNTR 7 locus was detected in the MAP S and MA strains studied, and might represent a basis for differentiation between MAP S and C strains. Subspeciesand strain-specific SNPs within VNTR 7 locus are reported. Moreover, besides the classical 22 bp repeat, two more tandem repeats were detected at the VNTR 7 locus; therefore, the stability of this tandem repeat rich locus should be assessed in a longitudinal study. Until then, sequencing of the VNTR 7 locus is the only means to correctly assign the three tandem repeats. Acknowledgements We thank Ulrike Kling for her assistance to isolate MAP strains and the German Academic Exchange Service (DAAD). The Hessian State Laboratory is supported by the Hessian Ministry for the Environment, Climate Change, Agriculture and Consumer Protection. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.mcp.2016.02.002. References [1] W.C. Losinger, Economic impact of reduced milk production associated with Johne's disease on dairy operations in the USA, J. Dairy. Res. 72 (2005) 425e432. [2] E. Liverani, E. Scaioli, C. Cardamone, P. Dal Monte, A. Belluzzi, Mycobacterium avium subspecies paratuberculosis in the etiology of Crohn's disease, cause or epiphenomenon? World. J. Gastroenterol. 20 (2014) 13060e13070. [3] J.P. Bannantine, L.L. Li, S. Sreevatsan, V. Kapur, How does a Mycobacterium change its spots? Applying molecular tools to track diverse strains of Mycobacterium avium subspecies paratuberculosis, Lett. Appl. Microbiol. 57 (2013) 165e173. [4] K. Stevenson, V.M. Hughes, L. de Juan, N.F. Inglis, F. Wright, J.M. Sharp, Molecular characterization of pigmented and nonpigmented isolates of Mycobacterium avium subsp. paratuberculosis, J. Clin. Microbiol. 40 (2002) 1798e1804. [5] E. Castellanos, L. de Juan, L. Domínguez, A. Aranaz, Progress in molecular typing of Mycobacterium avium subspecies paratuberculosis, Res. Vet. Sci. 92 (2012) 169e179. [6] C. Ahlstrom, H.W. Barkema, K. Stevenson, R.N. Zadoks, R. Biek, R. Kao, et al., Limitations of variable number of tandem repeat typing identified through whole genome sequencing of Mycobacterium avium subsp. paratuberculosis on a national and herd level, BMC Genomics 16 (2015) 161. [7] V.C. Thibault, M. Grayon, M.L. Boschiroli, C. Hubbans, P. Overduin, K. Stevenson, et al., New variable-number tandem-repeat markers for typing Mycobacterium avium subsp. paratuberculosis and M. avium strains: comparison with IS900 and IS1245 restriction fragment length polymorphism typing, J. Clin. Microbiol. 45 (2007) 2404e2410. [8] C. Notredame, D.G. Higgins, J. Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. Mol. Biol. 302 (2000) 205e217. € ck, Improvement of sensitivity for [9] A. Fawzy, T. Eisenberg, A. El-Sayed, M. Zscho Mycobacterium avium subsp. paratuberculosis (MAP) detection in bovine fecal samples by specific duplex F57/IC real-time and conventional IS900 PCRs after solid culture enrichment, Trop. Anim. Health. Prod. 47 (2015) 721e726.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002
6
A. Fawzy et al. / Molecular and Cellular Probes xxx (2016) 1e6
[10] T. Eisenberg, R. Volmer, U. Eskens, I. Moser, A. Nesseler, C. Sauerwald, et al., Outbreak of reproductive disorders and mycobacteriosis in swine associated with a single strain of Mycobacterium avium subspecies hominissuis, Vet. Microbiol. 159 (2012) 69e76. €bius, I. Fritsch, G. Luyven, H. Hotzel, H. Ko €hler, Unique genotypes of [11] P. Mo Mycobacterium avium subsp. paratuberculosis strains of type III, Vet. Microbiol. 139 (2009) 398e404. [12] H. Gerritsmann, G.L. Stalder, J. Spergser, F. Hoelzl, A. Deutz, A. Kuebber-Heiss, et al., Multiple strain infections and high genotypic diversity among Mycobacterium avium subsp. paratuberculosis field isolates from diseased wild and domestic ruminant species in the eastern Alpine region of Austria, Infect. Genet. Evol. 21 (2014) 244e251. [13] V.V. Feschenko, L.A. Rajman, S.T. Lovett, Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 1134e1139. [14] K. Dohmann, B. Strommenger, K. Stevenson, L. de Juan, J. Stramann, V. Kapur, et al., Characterization of genetic differences between Mycobacterium avium subsp. paratuberculosis type I and type II Isolates, J. Clin. Microbiol. 41 (2003) 5215e5223. [15] J.P. Bannantine, C.W. Wu, C. Hsu, S. Zhou, D.C. Schwartz, D.O. Bayles, et al., Genome sequencing of ovine isolates of Mycobacterium avium subspecies
[16] [17]
[18]
[19]
[20]
[21]
paratuberculosis offers insights into host association, BMC, Genom 13 (2012) 89. K. Zhou, A. Aertsen, C.W. Michiels, The role of variable DNA tandem repeats in bacterial adaptation, FEMS, Microbiol. Rev. 38 (2014) 119e141. H. Rachman, M. Strong, T. Ulrichs, L. Grode, J. Schuchhardt, H. Mollenkopf, et al., Unique transcriptome signature of Mycobacterium tuberculosis in pulmonary tuberculosis, Infect. Immun. 74 (2006) 1233e1242. K.J.E. van Hulzen, H.C.M. Heuven, M. Nielen, J. Hoeboer, W.J. Santema, A.P. Koets, Different Mycobacterium avium subsp. paratuberculosis MIRU-VNTR patterns coexist within cattle herds, Vet. Microbiol. 148 (2011) 419e424. S.Y. Liang, H. Watanabe, J. Terajima, C.C. Li, J.C. Liao, S.K. Tung, et al., Multilocus variable-number tandem-repeat analysis for molecular typing of Shigella sonnei, J. Clin. Microbiol. 45 (2007) 3574e3580. A.C. Noller, M.C. McEllistrem, A.G.F. Pacheco, D.J. Boxrud, L.H. Harrison, Multilocus variable-number tandem repeat analysis distinguishes outbreak and sporadic Escherichia coli O157:H7 isolates, J. Clin. Microbiol. 41 (2003) 5389e5397. €hler, M. Weigoldt, G.F. Gerlach, P. Mo € bius, Stability of genoN. Kasnitz, H. Ko typing target sequences of Mycobacterium avium subsp. paratuberculosis upon cultivation on different media, in vitro- and in vivo passage, and natural infection, Vet. Microbiol. 167 (2013) 573e583.
Please cite this article in press as: A. Fawzy, et al., New polymorphisms within the variable number tandem repeat (VNTR) 7 locus of Mycobacterium avium subsp. paratuberculosis, Molecular and Cellular Probes (2016), http://dx.doi.org/10.1016/j.mcp.2016.02.002