New quantitative assay of Hepatitis B and C viruses by competitive PCR using alternative internal sequences

Journal of Virological Methods ELSEVIER

Journal of Virological Methods 65 (1997) 299-305

New quantitative assay of Hepatitis B and C viruses by competitive PCR using alternative internal sequences Christopher Payan a,b,, Nary V6al b,c Bernadette Crescenzo-Chaigne a, Laurent B61ec a, Jacques Pillot a a Unit d'Immunologie Microbienne, Institut Pasteur, 28 rue du Docteur Roux, 75015 Paris, France b Laboratoire de Virologie, Centre Hospitalier Universitaire, 4 rue Larrey, 49033 Angers, France c Laboratoire d'h~modynamique splanchnique, Faeultd de Mddecine, Rue de Haute-Recul~e, 49000 Angers, France

Accepted 4 February 1997

Abstract A competitive PCR was developed for quantitation of hepatitis B virus (HBV) D N A and hepatitis C virus (HCV) RNA, alternatively, using only two constructions containing both priming sites. D N A s corresponding to the HBV-S gene and the HCV-5' non-coding region were introduced into distinct plasmids. HBV plasmid was used as a standard for HBV-DNA quantitation, in competition with the HCV plasmid as internal control. HBV and HCV plasmids also served as template for transcription of HBV-RNA and HCV-RNA, which was used as internal control and standard, respectively, in competition for HCV-RNA quantitation. The analyzed samples for HBV and HCV quantitation were processed in the same way in competition with the internal controls and to the respective calibration curves obtained by serial dilutions of the mimic standard. This method showed very good specificity and sensitivity, allowing absolute quantitation in a large linear range from 5 viral genomic copies per assay up to 106 copies, in sera of chronically HBV and HCV infected patients, as well as in supernatants of cell cultures inoculated with these viruses. © 1997 Elsevier Science B.V. K e y w o r d s : Competitive PCR; HBV; HCV

Abbreviations: AQPCR, alternative quantitative polymerase chain reaction; cPCR, competitive polymerase chain reaction; SRT-PCR, single-step reverse transcription-polymerase chain reaction; HBV, hepatitis B virus; HCV, hepatitis C virus; TS, target sequence; IC, internal control; 5'-NCR, 5' non-coding region (of HCV genome); ELISA, enzyme linked immuno assay; MML-V, moloney murine leukemia virus; OD, optical density. * Corresponding author. Tel.: + 33 41 355435; fax: + 33 41 354164.

1. Introduction A l t h o u g h the p o l y m e r a s e c h a i n r e a c t i o n ( P C R ) is a p o w e r f u l t o o l for a m p l i f i c a t i o n o f g e n o m i c D N A o r R N A t a r g e t sequences (TS), the use o f this recent t e c h n o l o g y to achieve q u a n t i t a t i o n o f the t a r g e t has been h i n d e r e d b y the v a r i a t i o n s

0166-0934/97/$17.00 © 1997 Elsevier Science B.V. All rights reserved. PII S0166-0934(97)02201-5

300

C. Payan et al./Journal of Virological Methods" 65 (1997) 299 305

observed during the PCR from tube to tube and at each cycle step of the amplification (Linz, 1990; Higuchi et al., 1993). Extraction procedures for isolation of the genomic target are also responsible for variations due to a loss of 20-30% of the initial amount of nucleic acids in the extracted sample (Manzin et al., 1994) and to the concentration of some non-protein PCR inhibitors (Poli et al., 1993). These variations can be avoided by coextraction and the coamplification of the genomic target sequence (TS) with an internal control sequence (IC) in a competitive PCR (cPCR) (Raeymaekers, 1993). This implies the construction of a specific IC nucleic acid with the same priming sequences as the amplified target sequence to assure coamplification. So far, each novel cPCR involves a new plasmid construction and cloning for specific IC. A new approach was therefore developed using an alternative quantitative PCR (AQPCR). This method consisted of a competitive PCR (cPCR) for viral DNA and a competitive single-step reverse transcription-PCR (cSRT-PCR) for viral RNA quantitations, involving alternatively only two constructions. Hepatitis B and C viruses have the same cell tropism and have been found to be frequently associated (Mimms et al., 1993).

2. Materials and methods

treated twice with RNase-free DNase I, extracted with phenol-chloroform and precipitated with ethanol. Plasmids and transcripts were quantified by measuring absorbance at 260 nm. The purity of plasmids and transcripts was assessed by the 260/280 nm ratio and on a 1% agarose gel stained in ethidium bromide at 5/~g/ml. Transcripts were migrated in denaturing conditions. Plasmids and transcripts were stored at - 8 0 ° C in Tris-EDTA buffer and DEPC-treated water, respectively, containing 20 U of RNasin.

2.2. Sample preparation Five sera with HBV and five with HCV and 5 control sera, were tested by HBV and HCV AQPCR. Three supernatants of HBV and HCV infected cells (human hepatocytes-Vero HV4 cell line, human hepatoma HepG2 cell line and Vero cells) were also studied after 15 days of inoculation with these sera (Payan et al., 1995b). Each sample (100 /~1) was coextracted separately with 2 x 103 genomic sequences of pC5'NCR IC for HBV DNA and rBs IC for HCV RNA. Extraction procedures for DNA and RNA were based on, a proteinase K (Maniatis et al., 1989) and a modified guanidium method respectively (Payan et al., 1995c), phenol-chloroform extraction and ethanol precipitation. The pellet was resuspended in, 10 pl of Tris-EDTA buffer and DEPC-water, respectively.

2. I. Construction of plasmids pBs and pC5'NCR plasmids were constructed by BamH1-Xbal ligation in the pGEM-3Z plasmid lacZ region (Promega Corporation, Madison, WI, USA) of, respectively, amplified HBV S gene and HCV 5' non-coding region (NCR) products, respectively. These products were obtained from sera from patients chronically infected with HBV and HCV. They were amplified with specific 40 mer chimeric primers containing priming sequences for both viruses and BamH1-Xbal sites (Fig. 1). In vitro transcription of these plasmids with T7 RNA polymerase (Promega) allowed synthesis of the corresponding positive HBV and HCV RNA transcripts containing the S gene and the 5'NCR targets respectively. RNAs were

2.3. Competitive HBV PCR and HCV single-step RT-PCR for AQPCR Coextracted DNA or RNA (5 pl) were heat denatured and subjected to HBV PCR and to HCV single-step RT-PCR (SRT-PCR), as described previously (Payan et al., 1995a,c). Briefly, a 45-pl HBV PCR mix containing 1.5 mM of MgC12, 200 p M of dNTPs containing 10 pM of digoxigenin dUTP (Boehringer Mannheim, Germany), 25 pmol of each M D l l and MD13 HBV primer (Fig. 1), 1 U of Taq polymerase (Boehringer Mannheim) was added to denatured DNA. A 40 cycles amplification (94°C for 30 s, 60°C for 30 s, 72°C for 45 s, with a 10 min terminal elongation step at 72°C) was carried out

C. Payan et al. /Journal of Virological Methods 65 (1997) 299-305

(II) pBs cloning primers HBV sens CIBI BamH1 HCV 5'NCR (56-77) HBV S gene (600-620)=MD11 3' -3' 5' &AGGATCC TACTGTCTTCACGCAGAAAGCGTATTCCCATCCCATCATCCT antisens C2B2 5' Xbal HCV 5'NCR (340-320) HBV S gene (842-822)=MD13 3' AATCTAGA GTGCACGGTCTACGAGACCTCTTAGGGTrTAAATGTAT CCC

(31,)_ ~ : = : t

ExtractedHBV DNA5,

5"-- "

Sgene

~

~

PCR

301

5'

!

!

3'

3'

J

!

5'

HBV probe=SMD09(659-679) 5'-biotTCA GCC CGT T r c TCC TGG c ' r c AGT-3'

JPurificalion-ligafion ~" cloningin pGEM3Z pCS'NCR cloning primers HCV sens BICI 5' BamH1 HBV S gene (600-620) HCV 5~qCR(56-77)--2CH5 3' Plasmid AAGGATCC GTATrCCCATCCCATCATCCTTACTGTCTrCACGCAGAAAGC antisens B2C2 HBV S gene (842-822) HCV 5'NCR (340-320)=1CH5 3' 5' Xbal

~

~T7 transcription -- ~

-

-

Transcript

rBs

AATCTAGA TrAGGGTI'rAAATGTATACCC GTGCACGGTCTACGAGACCTC

HCV probe=CH5(141-160) 5'-biotTAG TGG TCT GCG GAA CCG GT-3'

Fig. I. (I) Construction of internal control (IC) and target standard (TS) plasmids and synthesis of IC transcripts for, respectively, HBV and HCV AQPCR. HBV-DNA of infected sera was extracted and amplified in the S region with HBV chimeric primers containing a Y-end S specific primer (open box), and a Y-portion heterologous primer in the HCV 5' NCR (solid box). The Y-end of chimeric primers contained Bam Hl-Xbal restriction sites for ligation and cloning of HBV-DNA amplified fragment in the pGEM-3Z lacZ region. HBV-RNA rBs fragment was obtained by T7 RNA polymerase in vitro transcription of the pBs plasmid. HCV pC5'NCR plasmid and rC5'NCR RNA were constructed and in vitro transcribed the same way; (If) Priming sequences for the construction of the DNA fragments are shown, with specific priming sites (underlined) and restriction sites. The specific primers were used alone for HBV (MDI 1 and MD13) and HCV (2CH5 and 1CH5) AQPCR; HBV SMD09 and HCV CH5 probes were used to distinguish coamplified native TS from IC products by specific hybridization.

in a thermocycler (Perkin Elmer 9600, USA). A 45-/21 H C V S R T - P C R mix containing 2 m M o f MgCl2, 200 /2M o f D i g d N T P s , 25 pmol o f each 2 C H 5 and 1CH5 H C V primer (Fig. 1), 10 U o f S u p e r s c r i p t M M L - V reverse transcriptase (Gibco BRL, Life Technologies, France) and 1 U o f Taq polymerase was added to denatured R N A . The whole mixture was placed out in the Perkin Elmer 9600 thermocycler for a single p r o g r a m (20 min at 42°C, 3 min at 95°C and 40 cycles amplification as above). 2.4. P C R E L I S A detection

After i n c o r p o r a t i o n o f digoxigenin d U T P s during the P C R , H B V and H C V amplified p r o d u c t s were distinguished by hybridization with specific biotinylated S M D 9 and C H 5 probes (Fig. 1) in two different wells o f a streptavidin coated mi-

croplate f r o m the P C R E L I S A detection kit (Boehringer Mannheim). Briefly, 10/21 o f alkaline denatured P C R p r o d u c t s were added to a 200/21 hybridization solution containing 5 ng o f each p r o b e in the microplate wells. The mixture was incubated for 1 h at 50°C with shaking. After intensive washing, hybridized p r o d u c t s were detected with an anti-digoxigenin m o n o c l o n a l , conjugate with p h o s p h a t a s e alkalin, and with A B T S substrat. Blue-green colored signal was measured for optical density (OD) at 405 n m in an automatic spectrophotometer. The O D ratio for the c o r r e s p o n d i n g probes, B/C for H B V or C/B for H C V , was calculated and reported to, respectively, H B V and H C V calibration curves. These curves were obtained with 10-fold diluted pBs and r C 5 ' N C R mimic standards coamplified with 2 × 103 genomic sequences o f p C 5 ' N C R and rBs IC, respectively, by H B V and H C V A Q P C R .

C. Payan et al./Journal of Virological Methods" 65 (1997) 299 305

302

2.0-

2.0

OD 405 nm

OD 405 nm 1.6

1.6=

~..._

pBs

1.2

1.2-

0.8

0.8-

0.4

0.4-

0.0

!

0

10

!

20

g

¢

30

40

0.0 ~ $0

!

10

I

2,0

I

30

I

40

$0

N u m b e r of cycles Fig. 2. HBV PCR and HCV SRT-PCR efficiencies, for the pC5'NCR and pBs plasmids (A) and for the rC5'NCR and rBs trancripts (B) at 2 × 103 copies, respectively, proceeded for PCR in seven tubes, as described in the methods. The tubes were withdrawn at every 10, then 5 amplification cycles, and the resulting PCR products were semi-quantified with specific HBV and HCV probes in ELISA digoxigenin detection.

3. Results

3.1. Sequence analysis of the internal sequence plasmids The constructed pBs and pC5'NCR IC were analysed with a Sequenase kit (USB, USA). The obtained sequences were in agreement with the adw HBV S gene and type 1 HCV 5'NCR sequences of the DNA Strider 1.2 data bank. Each plasmid contained only one copy of the insert gene, with the two priming sequences for the two viruses at each end (Fig. 1).

tration and to validate the function of the constructions. In an agarose gel stained with ethidium bromide, the last observed bands corresponded to about 10 8 and 10-1° dilutions for, plasmids and transcripts, respectively, tested five times; this was 100-fold lower than the expected concentrations in regard to the purified products (data not shown). Using specific probes in ELISA detection, the signal increased more than 10-fold. When subjected to different amplification cycling steps, the TS and IC plasmids and trancripts had identical slopes indicating similar efficiency by the HBV PCR and the HCV SRT-PCR (Fig. 2).

3.2. Control of plasmids and transcripts amplification and efficiency

3.3. Characteristics of AQPCR

pBs and pC5'NCR plasmid concentrations were evaluated by spectrophotometric measurements after gel electrophoresis control. At 260 nm, pC5'NCR and pBs plasmids were at 3.25 x 101° and 3 x 10 l° copies per/~1, and rC5'NCR and rBs transcripts were at 284 x 10 l° and 68 x 101° per /zl, respectively. Furthermore, the 260/280 nm ratios for these products were higher than 1.8 indicating nucleic acid free of proteins. Both plasmids and their corresponding transcripts were tested by end-point dilution by, HBV PCR and HCV single-step RT-PCR respectively, to evaluate the ti-

The feasibility of HBV and HCV AQPCR was shown by three different assays, allowing the construction of the calibration curves (Fig. 3). These involved the mimic pBs TS in competition with the pC5'NCR IC in HBV cPCR, and the rC5'NCR TS in competition with the rBs IC for HCV cSRT-PCR. A sensitivity of 5 and 12 viral genomic copies, respectively, per assay were found. A large linear relation between the ratio of amplified hybridized templates and the initial amount of TS, expressed in logarithmic scale, was observed upon three different curves from these

C. Payan et al. /Journal of Virological Methods 65 (1997) 299-305

303

2 Log pBs/pC IC

Log rC/rBs IC

1,

0-

0,

I-

-1,

A -2

,,

s~eerr~: ~ ~]Bv+

~-~

HV SN HBV+

I

I

I

I

I

1

2

3

4

5

~

*

B

~--

-----o~ 6

0

Serum a HCV+

Serum b HCV+ H V SN H C V +

I

I

|

l

|

1

2

3

4

$

Log H B V - D N M ~ y

6

Log H C V - R N M ~ y

Fig. 3. HBV and HCV AQPCR calibration curves. They were obtained from the optical density (OD405 nm) ratio of ELISA dig-PCR products, after competition of respectively increased concentrations of mimic pBs plasmid (HBV standard) target sequence (TS) with Constant concentration (2 x 103 copies) of pC5'NCRIC in HBV cPCR (A), and increased rC5'NCR transcript TS (HCV standard) with constant rBsIC (2 × 103 copies) in HCV cSRT-PCR (B). Three calibration curves were done for each test, with the following equations: y = - 1.004 + 0.413x, r = 0.91 (A) and y = - 1.421 + 0.462x, r = 0.94 (B). Two HBV and HCV-positive sera (a, b) and one supernatant (SN) were tested by end-point dilutions in AQPCR, in competition with the same IC concentration. Note that the curves have the same linear slope.

minimal quantities up to 106 copies. Two HBV and HCV-positive sera and one supernatant of inoculated cells tested by end-point dilutions in AQPCR gave similar slopes as the calibration curve (Fig. 3). This demonstrated that the native TS in the samples were amplified and quantified in a similar manner as the mimic TS plasmids. The specificity of AQPCR was assessed by an assay using 10 different positive and negative sera and three supernatants of HBV and HCV inoculated cells (Fig. 4). PCR signal was negative after hybridization of non-specific amplified products of other viral agents such as the human immunodeficiency virus type 1 (HIV1), cytomegalovirus (CMV) and enterovirus (EV). Cross-reaction was not observed between HBV and HCV amplicons and, respectively, HCV and HBV probes in this assay. The mean of the five negative controls OD405nm for HBV and HCV AQPCR was, respectively, at 0.0402 _+0.0052 with a cut-off at 0.1206, and 0.0491 + 0.0040 with a cut-off at 0.1473. Intraserial and interserial reproducibilities upon 5 samples tested three times were acceptable, with, 4 and 10% for HBV cPCR, and 5 and 12% for HCV cSRT-PCR, respectively.

4. Discussion

An alternative quantitative assay of viral genomes, was developed using competitive PCR with heterologous internal DNA (for HBV cPCR) or internal RNA (for HCV cSRT-PCR) fragments. These internal controls (IC) involved two HBV and HCV priming sequences introduced by chimeric priming amplification. This method allowed an easy construction of such genomic fragment, economy of plasmid or transcript as TS and IC (only two instead of four for two competitive PCR), and permitted the distinction of the coamplified sequences (native and internal) with specific probes. The coamplified products were labelled with a non-radioactive base introduced during PCR, and were detected in an ELISA microplate format, applicable to automation. Absolute quantitation of low genomic level in some samples require the use of internal sequence controls that allowed coamplification with the native sequence, with the same efficiency. The ratio of both PCR products does remain constant even if some conditions changes during amplification (Raeymaekers, 1993). This approach could

C. Payan et al. /Journal of Virological Methods 65 (1997) 299-305

304

HBV-DNA/assay 35 [S00 25

[000 15 1

500

I

II

Amplicons

~d3~ Sera

II

I

I

SN

II

Amplicons

It Sera

I SN

Samples Fig. 4. HBV and HCV AQPCR specificities upon 3 other PCR digoxigenin products (amplicons HIVI, CMV, EV), 5 positive (a, b, c, d, e) and 2 negative (a, b) HBV and HCV sera, and 3 supernatants (SN) of HBV and HCV inoculated cells (Human hepatocytes-Vero: HV, HepG2, Vero). Competitive PCR was processed with 2 x 103 copies of pC5'NCRIC (A) and rBsIC (B). The copy number range of positive samples per assay was 7 x 101-4 x 107 (A) and 3 x 10 ~ 5 x 104 (B).

not be achieved with an external standard, which quantifies native genomes in a separate tube assay (Lu et al., 1994), and does not control the effects of Taq polymerase inhibitors in the samples (Poli et al., 1993). Using a heterologous sequence, such as beta-globine or actin, is not convenient since it has different priming sequences and efficiency than the amplified native TS. Therefore, the amplification of the internal standard with homologous IC, containing mutation or deletioninsertion modifications of the native TS is used the most frequently (Pannetier et al., 1993; Clossais and Andr6, 1994; Manzin et al., 1994; Ravaggi et al., 1995). However, heteroduplex formation with hybridization of native and internal modified homologous sequences might occur, since hybridization temperature during PCR is not at high stringency. Three products are then amplified that have to be distinguished and quantified: (i) the native TS, (ii) the modified homologous IC, (iii) the heteroduplex hybrids. The first two products could be distinguished either by a differential enzymatic digestion on the

mutated region generating different size products, or by differential hybridization with specific probes. Enzymatic digestion should be avoided since it has a variable activity and heteroduplex hybrids can not be distinguished. Therefore, heterologous IC is an alternative for coamplification without a risk of heteroduplex formation, generating only the amplified native TS and the heterologous IC (Jalava et al., 1993; Secchiero et al., 1995). The heterologous IC must be similar in size, contain the same GC% and the same priming sequences as the native TS for coamplification with the same efficiency in cPCR. Since IC controls the sample variations during PCR, quantitation is achievable at saturation, as well as in the exponential phase of PCR (Higuchi et al., 1993), allowing: (i) simplicity in the PCR procedure, that is not depending on its exponential phase, (ii) high sensitivity, since the maximum of TS or IC amplicons is produced. Thus, with a 40 cycles amplification, close to the plateau phase, we obtain an optimal sensitivity and a linear range for our HBV and HCV AQPCR.

c. Payan et al./Journal of Virological Methods 65 (1997) 299 305

This new A Q P C R includes different o p t i m i z e d p r o c e d u r e s ; (i) a new m e t h o d for the c o n s t r u c tion a n d cloning o f D N A I C f r a g m e n t s a n d R N A I C synthesis for reliable c o m p e t i t i v e P C R , (ii) o p t i m i z a t i o n o f the e x t r a c t i o n p r o c e d u r e s a n d o f a single-step R T - P C R for H C V R N A d e t e c t i o n with the I C ( P a y a n et al., 1995a,c), (iii) i n c o r p o r a t i o n o f n o n - r a d i o a c t i v e labelled nucleotides in P C R for a direct labelling o f P C R p r o d u c t s (Clossais a n d A n d r 6 , 1994), a n d (iiii) d e t e c t i o n a n d q u a n t i t a t i o n o f P C R p r o d ucts o n E L I S A m i c r o p l a t e s , a v a i l a b l e to a n y l a b o r a t o r y a n d to a u t o m a t i o n ( J a l a v a et al., 1993; R a v a g g i et al., 1995). I n d e e d , n o p r e v i o u s s t u d y involves all these elements for a b s o l u t e a n d reliable g e n o m i c q u a n t i t a t i o n . Otherwise, the A Q P C R is b a s e d o n a single p o i n t q u a n t i t a tion (in d u p l i c a t e ) o f native T S in c o m p e t i t i o n with IC, r e p o r t e d to a c a l i b r a t i o n curve. This A Q P C R has several a p p l i c a t i o n s : (i) q u a n t i t a t i o n o f the viral l o a d in sera o f infected patients; (ii) p r o g n o s i s o f the disease e v o l u t i o n a n d o f the p o t e n t i a l viral t r a n s m i s s i o n in different biological samples; (iii) f o l l o w - u p o f interferon o r new antiviral molecules t h e r a p y for H B V a n d H C V infection, a n d (iv) m e a s u r e m e n t o f viral p r o d u c t i o n in cell system, as s h o w n in this study. Indeed, we o b s e r v e d an increasing H B V a n d H C V levels in s u p e r n a t a n t s o f H u m a n H e p a t o c y t e s - V e r o cell c o m p a r e d to the one o f Vero cells i n o c u l a t e d with the s a m e infected serum ( P a y a n et al., 1995b). This system m a y also be a p p l i c a b l e to o t h e r viral c o i n f e c t i o n q u a n t i t a t i o n , such as H I V 1 a n d 2, C M V a n d HIV1, a n d also for d u a l D N A o r m R N A expression in h u m a n o r a n i m a l cells.

Acknowledgements The a u t h o r s wish to t h a n k F. G u i l l o t f r o m B o e h r i n g e r M a n n h e i m SA, F r a n c e , w h o p r o vides the P C R E L I S A kits for the A Q P C R system d e v e l o p e d in this study.

305

References Clossais Besnard, N. and Andr6, P. (1994) Automated quantitative determination of hepatitis C virus viremia by reverse transcription-PCR. J. Clin. Microbiol. 32, 1887-1893. Jalava, T., Lehtovaara, P., Kallio, A. et al. (1993) Quantitation of hepatitis B virus DNA by competitive amplification and hybridization on microplates. BioTechniques 15, 134-139. Higuchi, R., Fockler, C., Dollinger, G. and Watson, R. (1993) Kinetic PCR analysis: Real-time monitoring of DNA amplification reactions. BioTechnology 11, 1026 1030. Linz, U. (1990) Thermocycler temperature variation invalidates PCR results. BioTechniques 9, 286-293. Lu, W., Han, D-H., Yuan, J. and Andrieu, J-M. (1994) Multi-target PCR analysis by capillary electrophoresis and laser-induced fluorescence. Nature 368, 269-271. Maniatis, T., Fritsch, G. and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. p. 189 Manzin, A., Bagnarelli, P., Menzo, S. et al. (1994) Quantitation of hepatitis C virus genome molecules in plasma sample. J. Clin. Microbiol. 32, 1939 1944. Mimms, T.L., Mosley, J.W., Hollinger, F.B. et al. (1993) Effect of concurrent acute infection with hepatitis C virus on acute hepatitis B virus. Brit. Med. J. 307, 1095-1097. Pannetier, C., Delassus, S., Darche, S. et al. (1993) Quantitative titration of nucleic acids by enzymatic amplification reactions run to saturation. Nucleic Acids Res. 21, 577 583. Payan, C., Bloch, F., Gaultier, I. and Blec, L. (1995a) Singlestep reverse transcription-polymerase chain reaction for hepatitis C virus RNA with DNA enzyme immunoassay hybridization. J. Virol. Methods 53, 67-175. Payan, C., Crescenzo, B. and Pillot, J. (1995b) Low production of HBV and HCV in cell culture evidenced by a double competitive PCR. Hepatology 22, 266A. Payan, C., Dupr6, T. and Blec~, L. (1995c) Detection of hepatitis C virus RNA by a reliable, optimized single-step reverse transcription polymerase chain reaction. Res. Virol. 146, 363-370. Poli, F., Cattaneo, R., Crespiatico, L. et al. (1993) A rapid and simple method for reversing the inhibitory effect of heparin on PCR for HLA class II typing. PCR Methods Appl. 2, 356-358. Raeymaekers, L. (1993) Quantitative PCR: Theoretical considerations with practical implications. Anal. Biochem. 214, 582 585. Ravaggi, A., Zonaro, A., Mazza, C. et al. (1995) Quantitation of hepatitis C virus RNA by competitive amplification of RNA from denatured serum and hybridization on microtiter plates. J. Clin. Microbiol. 33, 265-269. Secchiero P., Zella, D., Crowley, R.W. et al. (1995) Quantitative PCR for human herpesviruses 6 and 7. J. Clin. Microbiol. 33, 2124-2130.