- Email: [email protected]
New regulators of biofilm development in Candida glabrata
Research in Microbiology 163 (2012) 297e307 www.elsevier.com/locate/resmic
New regulators of biofilm development in Candida glabrata Marta Riera a,1, Estelle Mogensen a,2, Christophe d’Enfert b,c, Guilhem Janbon a,* b
a Institut Pasteur, Unite´ des Aspergillus, De´partement Parasitologie et Mycologie, F-75015 Paris, France Institut Pasteur, Unite´ Biologie et Pathoge´nicite´ Fongiques, De´partement Ge´nomes et Ge´ne´tique, F-75015 Paris, France c INRA, USC2019, F-75015 Paris, France
Received 23 November 2011; accepted 15 February 2012 Available online 3 March 2012
Abstract Biofilm formation plays an important role in fungal pathogenesis. In this work, we used a genetic screen in order to identify and characterize genes involved in the formation of biofilms by the opportunistic fungal pathogen Candida glabrata. We identified the Cst6p transcription factor as a negative regulator of the EPA6 gene that encodes an adhesin central to C. glabrata biofilm formation. Analysis of single and double mutant strains showed that Cst6p acts in a pathway independent of the Yak1/Sir4 pathway also known to regulate expression of EPA6 and consequently biofilm formation. In contrast, we showed that the chromatin remodelling Swi/Snf complex positively regulates biofilm formation in C. glabrata. RT-qPCR experiments demonstrated that EPA6 expression, and thus biofilm formation, depends on the integrity of the Sir complex. Finally, we showed that Swi/Snf-dependent regulation of biofilm formation is adhesin-specific. Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Candida glabrata; Biofilm; Adhesin; Chromatin; Silencing
1. Introduction In the past two decades, Candida glabrata has become an increasingly prevalent pathogen worldwide (Chen et al., 2008; Fidel et al., 1999; Malani et al., 2001; Roetzer et al., 2011). After Candida albicans, it represents the second cause of fungal infections of the bloodstream (Hajjeh et al., 2004), oropharynx (Coco et al., 2008) and urinary tract (Kauffman et al., 2000). Patients who are subjected to chemotherapy or transplantation or harbour medical devices present a higher risk of developing Candida infections (Ramage et al., 2006).
* Corresponding author. E-mail addresses: [email protected] (M. Riera), [email protected] (E. Mogensen), [email protected] (C. d’Enfert), [email protected] (G. Janbon). 1 Present address: Dept. Molecular Genetics, Center for Research in Agricultural Genomics (CRAG), Bellaterra (Cerdanyola del Valles), 08193 Barcelona, Spain. 2 Present address: Sup’Biotech, 66 rue Guy Moˆquet, 94800 Villejuif, France.
Mechanisms that elicit virulence in C. glabrata are still poorly understood (Kaur et al., 2005). However, secretion of phospholipases, survival and replication within macrophages, and synthesis of adhesins have been shown to contribute to infection (Cormack et al., 1999; Kaur et al., 2007; Weig et al., 2004). C. glabrata is able to colonize host tissues as well as abiotic surfaces, where it develops as multilayered biofilm structures (Iraqui et al., 2005). Biofilm development contributes to increased resistance to antifungal agents and results in persistent infections (d’Enfert, 2009; Donlan and Costerton, 2002). Biofilm formation involves cell-substrate and cellecell interactions. Therefore, expression of specific adhesins at the cell surface is essential throughout biofilm development (Silva et al., 2011). In C. glabrata, adherence is mediated by cell wall adhesins encoded by the EPA gene family (Cormack et al., 1999; De Las Penas et al., 2003; Frieman et al., 2002). Similarly to the flocculin/lectins encoded by FLO genes in Saccharomyces cerevisiae, C. glabrata Epa proteins are predicted to be glycosylphosphatidylinositol (GPI)-anchored cell wall proteins that bind host cell carbohydrates. Three members of the EPA gene family (EPA1,
0923-2508/$ - see front matter Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2012.02.005
298
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
EPA6 and EPA7) mediate adherence of C. glabrata to human epithelial cells (Castano et al., 2005; Domergue et al., 2005), whereas EPA6 encodes the main adhesin involved in biofilm formation (Iraqui et al., 2005). In addition, adhesinlike proteins have also been identified in the cell wall of C. glabrata and are involved in adherence and biofilm formation (de Groot et al., 2008; Kraneveld et al., 2011). The expression of all of the characterized EPA genes is regulated by transcriptional silencing via the Sir complex (Castano et al., 2005; Iraqui et al., 2005; Rosas-Hernandez et al., 2008). For instance, EPA2-5 genes are constitutively silenced. In contrast, expression of EPA6 occurs in the stationary phase, and we previously demonstrated that EPA6 expression is regulated by Yak1p, a kinase that controls Sir4pand Rif1p-dependent subtelomeric silencing (Iraqui et al., 2005). These results suggest that maintenance of the telomere structure, where EPA genes are located, and regulation of silencing mechanisms play important roles in C. glabrata biofilm formation. The aim of the present study was to further investigate regulation of the expression of the adhesinencoding gene EPA6 in C. glabrata during biofilm development. Through genetic analyses, we identified and characterized new genes involved in biofilm formation. We showed that EPA6 expression is positively regulated by the chromatin remodelling Swi/Snf complex, whereas transcription factor Cst6p is a negative regulator of EPA6 transcription. 2. Materials and methods 2.1. Strains and media C. glabrata strains used in this study are listed in Table 1; all strains were isogenic to the BG2 strain (Fidel et al., 1996). Synthetic complete (SC) and eUra DO synthetic media and YPDrich medium were prepared as previously described (Sherman, 1992). All strains were grown at 37 C. When needed, 5-fluoroorotic acid (FOA) was added to eUra DO synthetic medium at 1 g l1. The bacterial strain Escherichia coli XL1-Blue (Stratagene, La Jolla, CA) was used for propagation of all plasmids. 2.2. Gene disruption Disruption of the SNF2, SNF6 and CST6 genes was achieved by homologous recombination of a cassette constructed Table 1 Strains used in this work. Strain name
Genotype
Reference or source
BG2 CG122 CG129 CG160 CG177 CG180 CG178/CG179 CG187/CG188 CG187/CG188 CG234/CG135
Clinical isolate epa6-1 yak11 sir4D::ura3 snf6::URA3 snf2::URA3 cst6::URA3 snf6D::ura3 yak1-1 cst6D::ura3 yak1-1 sir4D::ura3 snf6D::URA3
Fidel et al., 1996 Iraqui et al., 2005 Iraqui et al., 2005 Iraqui et al., 2005 This work This work This work This work This work This work
by fusion PCR using a strategy similar to that described by Kuwayama et al. (2002), with primers 1e8, 9e16 and 17e24, respectively (Table 2). The resulting fusion construct contained the auxotrophic selectable marker URA3 flanked by 50 and the 30 -regions of the target genes. Gene deletions were then obtained as previously described (Iraqui et al., 2005) using strain BG14 as recipient strain. They were confirmed by PCR (using the internal and the external primers; Table 2) and Southern blot analyses. Double mutant strains were constructed by transformation of a Ura- derivative of the single mutant strain selected on FOA medium as previously described (Iraqui et al., 2005). 2.3. RNA purification Strains were grown in liquid SC medium supplemented with 2% glucose for 24 h under shaking conditions. Cells were washed with sterile water, re-suspended in an appropriate volume of SC medium supplemented with 0.2% glucose in order to adjust the OD600 to 1.0 and incubated for another 24 h. They were harvested by centrifugation at 4 C, washed in ice-cold water and lyophilized. Total RNA was purified using the Trizol reagent (Invitrogen), following the manufacturer’s recommendations. 2.4. RT-qPCR Purified RNA was treated with DNase I (Roche) to eliminate residual genomic DNA. Synthesis of cDNA was performed using the QuantiTect reverse transcription kit (Qiagen), following the manufacturer’s instructions (1 mg RNA per reaction). The expression level of EPA6 and EPA1 genes was determined by qPCR using 5 ml of the appropriate dilutions of cDNA and 0.32 mM of primers 27e28 and 29e30 respectively (Table 2). Amplification reactions were performed using a thermal cycler (Bio-Rad) and resulting amplicons labelled with fluorescent dye SYBR Green (Bio-Rad). Results were analyzed using iCycler IQ real-time detection software (BioRad). The Ct values obtained in triplicate were averaged (Ct values considered if variation <0.5 units) and normalized to that of the housekeeping gene ACT1 (primers 25e26, Table 2). The statistical significance of differences in EPA6 and EPA1 expression levels, expressed as a percentage of that of the BG2 strain, was determined by applying a paired t-test ( p < 0.001). A dissociation curve was generated for each sample in order to ascertain that the correct amplicon was obtained. All RT-qPCR data were from at least two independent experiments (a least two RNA preparations) and three measurements. 2.5. Biofilm assays Strains were grown in SC medium supplemented with 2% glucose for 24 h under shaking conditions. This step was repeated once in order to obtain synchronous cell populations. Cells were treated under the same conditions as previously described (Riera et al., 2012; Iraqui et al., 2005), except that the
Table 2 Primer list. Primer name
Primer sequence (50 -30 )
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
Snf2-50 5 Snf2-50 3 Snf2-30 5 Snf2-30 3 Mkrsnf2f Mkrsnf2r Snf2ex Snf2ex2 Snf6-50 5 Snf6-50 3 Snf6-30 5 Snf6-30 3 Mkrsnf6f Mkrsnf6r Snf6ex Snf6ex2 Cst6-50 5 Cst6-50 3 Cst6-30 5 Cst6-30 3 Mkrcst6f Mkrcst6r Cst6ex Cst ex2 rtACT1F rtACT1R rtEPA6F rtEPA6R rtEPA1F rtEPA1R
GTGTGAGGGTACGGAGTGAGATG GTCATAGCTGTTTCCTGCATTGGCAGCGTTCTTACCGTG TACAACGTCGTGACTGGGCTAACGAAAACACCCCTCAAGAC GAAAATCTATTCGAGCGGGGACGACC GTCTTGAGGGGTGTTTTCGTTAGCCCAGTCACGACGTTGTA CACGGTAAGAACGCTGCCAATGCAGGAAACAGCTATGAC GAACGTGTTGAGCTAGGAAAGAGC GCTGCACTCGAAGATAGCAGATTCAC CAGAGATGCCTAGAAGGACTTGC GTCATAGCTGTTTCCTGCAGTCCTATTCCTCTGGACACG TACAACGTCGTGACTGGGGAATACGAGGCCGAACCATTC GTACAGGAACGGAGGGATGTG GAATGGTTCGGCCTCGTATTCCCCAGTCACGACGTTGTA CGTGTCCAGAGGAATAGGACTGCAGGAAACAGCTATGAC GGCCCAGGTAAGAATAGTGTGC TTGGTACTGGTGCTTGAGAGAGG GAGGAGAAGGCAAACGGAAAG GTCATAGCTGTTTCCTGTTCAGCGCAGTGTATCGTCTAC TACAACGTCGTGACTGGGGTGTCTCGGCTGATGTGCTATT GGTACTATGCTGGCGTCAATG AATAGCACATCAGCCGAGACACCCCAGTCACGACGTTGTA GTAGACGATACACTGCGCTGAACAGGAAACAGCTATGA GAGTGGGATGAGATGCACAAAG CTAATTGACTGGGGCCTTGCT GGCTTTCGATTTCTCACC GTGGCAACGGTTTGATGC GAAATCAGGATCGAATCCATG GTGGTAATGTATCAAACAGCG GGGCTCAAAAACAGCTAAG TAACAGTTGTTTTCGTTTGAT
Strain name
Insertion site (position)
Locus
Homologues in S. cerevisiae
Function in S. cerevisiae
Biofilm phenotype
CG202, CG203
Intergenic (42412)
CAGL0C04367g/ CAGL0C04389g
YBL001c (ECM15)/ YDR224c (HTB1, HTB2)
Minus
CG204
Intergenic (345992)
CAGL0E03674g/ CAGL0E03718g
YLL028w (TPO1)/ YHL025w (SNF6)
CG207
Intergenic (541040)
CG124, CG201
Intergenic (898047, 897723)
CAGL0F05335g/ CAGL0F05357g CAGL0F09075g/ CAGL0F09097g
YDR208w MSS4/ YDR207c UME6 YHR205w SCH9/ YHR206w SKN7
CG205 CG208
Intragenic (292286) Intragenic (567716)
CAGL0A02816g CAGL0G05896g
YDR368w YPR1 YHR143w DSE2
ECM15: protein of unknown function/HTB1, 2:core histone proteins required for chromatin assembly and chromosome function TPO1:Polyamine transporter/SNF6:Subunit of the SWI/SNF chromatin remodelling complex involved in transcriptional regulation MSS4: kinase involved in actin cytoskeleton organization/UME6: Key transcriptional regulator SCH9 Protein kinase involved in transcriptional activation of osmostress-responsive genes/SKN7: Nuclear response regulator and transcription factor YPR1: 2- methylbutyraldehyde reductase Daughter cell-specific secreted protein with similarity to glucanases, degrades cell wall
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
Primer number
Minus
Minus Minus
minus Minus 299
(continued on next page)
300
Table 2 (continued ) Strain name
Insertion site (position)
Locus
Homologues in S. cerevisiae
Function in S. cerevisiae
Biofilm phenotype
CG200, CG123, CG126 CG206
Intragenic (476654, 472286, 473362) Intergenic (472487)
CAGL0B04895g
YLR176c RFX1
Minus
YGL253w HXK2
CG219-234, CG136 CG209
Intergenic (149947149931, 150101) Intergenic (375046)
CAGL0A04829g/ CAGLOA04851g CAGL0J01551r/ CAGL0J01595g CAGL0I04224g/ CAGL0I04246g
tRNA-Val (AAC)/ YPR015c YGL163c RAD54/ YGL162w SUT1
CG217, CG218
Intergenic (489948, 489296) Intergenic (845785)
CAGL0I05148g/ CAGL0I05170g CAGL0I08657r/ CAGL0I08679r CAGL0I10147g/ CAGL0I10200g
YDL174c DLD1/ YIL036w CST6 tRNA-Arg (ACG)/ tRNA-Ser (AGA) YAR050W FLO1/ YHR211W FLO5
RFX1 Major transcriptional repressor of DNAdamage-regulated genes Hexokinase isoenzyme 2 that catalyzes phosphorylation of glucose in the cytosol tRNA-Val (AAC)/YPR015c Transcription factor Zinc finger, C2H2 type YGL163c RAD54 DNA-dependent ATPase member of the Swi2/Snf2-like family/SUT1 hypoxic protein involved in sterol uptake" DLD1: D-lactate ferricytochrome C oxidoreductase/ CST6: ATF/CREB activator
CAGL0F00110g/ CAGL0F00187g CAGL0M00132g/ CAGL0M00154g
pseudogene/ YMR319c FET4 YIR019c STA1/ YNL268w LYP1
CG212
Intergenic (985028, 984957)
CG216
Intergenic(17038)
CG210
Intergenic (15400)
Plus Plus
Plus Plus
FLO1, FLO5: confer cellecell adhesion (flocculation) in S.cerevisae. In Candida glabrata (EPA genes) confer adhesion to mammalian host tissues Pseudogene/YMR319c FET4 Low-affinity Fe(II) transporter of the plasma membrane STA1: encodes an extracellular glucoamylase, activated by the Swi/Snf complex./LYP1:Lysine permease
Plus
Plus Plus
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
CG213-215
Minus
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
incubation time for the metabolic assay with XTT was increased to 1.5 h. Each experiment included 4e8 biological replicates. Cell adherence was expressed as a percentage of that of the wildtype strain. Differences between means of cell adherence were determined by the two-tailed paired t-test ( p < 0.001). 3. Results 3.1. Identification of biofilm mutants Using a library of insertional mutants of C. glabrata (Cormack et al., 1999), we had previously identified mutant strains with altered ability to form biofilms (Iraqui et al., 2005). These mutants were classified into two phenotypic groups named Biofilm and Biofilmþþ, determined by a decreased or an increased level of adherence, respectively. Using a subset of four mutant strains, we identified four genes (RIF1, SIR4, EPA6 and YAK1) involved in biofilm formation. Here we report the characterization of another subset of insertional mutant strains. The results obtained are presented in Table 3. A total of 43 Biofilm mutant strains were analyzed. For five strains, we were unable to recover any plasmid and consequently could not identify the insertion site. Eventually, we identified 15 different regions of insertion, 8 of them associated with a Biofilm phenotype and 7 associated with a Biofilmþþ phenotype. Twelve of these insertions were located in intergenic regions, whereas 3 were intragenic insertions (Table 3). Although C. glabrata does not produce true hyphae, we found that several of the Biofilm mutant strains had insertions close to genes related to hyphal development or virulence Table 3 List of the positions of the insertion sites obtained from biofilm mutant strains. Strain name
Insertion site (position)
Locus
CG202, CG203
Intergenic (42412)
CG204
Intergenic (345992)
CG207
Intergenic (541040)
CG124, CG201 CG205 CG208 CG200, CG123, CG126 CG206
Intergenic (898047, 897723) Intragenic (292286) Intragenic (567716) Intragenic (476654, 472286, 473362) Intergenic (472487)
CAGL0C04367g/ CAGL0C04389g CAGL0E03674g/ CAGL0E03718g CAGL0F05335g/ CAGL0F05357g CAGL0F09075g/ CAGL0F09097g CAGL0A02816g CAGL0G05896g CAGL0B04895g
CG219-234, CG136 CG209
Intergenic (149947149931, 150101) Intergenic (375046)
CG217, CG218
Intergenic (489948, 489296) Intergenic (845785)
CG212 CG213-215 CG216
Intergenic (985028, 984957) Intergenic (17038)
CAGL0A04829g/ CAGLOA04851g CAGL0J01551r/ CAGL0J01595g CAGL0I04224g/ CAGL0I04246g CAGL0I05148g/ CAGL0I05170g CAGL0I08657r/ CAGL0I08679r CAGL0I10147g/ CAGL0I10200g CAGL0F00110g/ CAGL0F00187g
301
in C. albicans. In three mutant strains (CG200, CG123 and CG126), the plasmid was inserted close to the CAGL0B04895g ORF that is orthologous to the C. albicans RFX2 gene regulating DNA-damage responses, morphogenesis, virulence and adherence (Hao et al., 2009). The CG124 and CG201 mutant strains contained an insertion upstream of the CAGL0F09075g ORF that encodes the Sch9p protein kinase also required for cell growth, filamentation and virulence in C. albicans (Liu et al., 2010). In addition, the insertion present in the CG207 strain was located near CAGL0F05357g, a locus that encodes a protein similar to Ume6p, a key transcriptional regulator involved in hyphal extension, virulence and biofilm dispersion in C. albicans (Banerjee et al., 2008; Uppuluri et al., 2010). Comparison of proteomic profiles of C. glabrata in the planktonic and biofilm modes of growth recently revealed that biofilm growth is associated with increased levels of stress response proteins and decreased amounts of glycolytic enzymes, which may potentially contribute to the high antifungal tolerance of C. glabrata biofilms (Seneviratne et al., 2010). Accordingly, some Biofilm mutant strains had insertions mapping close to or within a gene encoding a protein induced by osmotic or oxidative stress or glucose metabolism. CG205 had an insertion located within the CAGL0A02816g gene, similar to YPR1, a gene coding an aldo-ketoreductase that is rapidly induced by osmotic and oxidative stress in yeast (Ford and Ellis, 2002). CG206 had an insertion within the CAGL0A04829g gene that encodes a hexokinase isoenzyme that catalyzes phosphorylation of glucose in the cytosol. Two different insertion sites identified in Biofilmþþ mutants were located close to tRNA genes. Interestingly, the insertion located downstream of CAGL0J01551r that encodes tRNA-Val (AAC) was found in 6 mutants (CG219 to CG224). Another insertion (CG212 strain) was located between tRNAArg (CAGL0I08657r) and tRNA-Ser (CAGL0I08679r). tRNA genes have been shown to be involved in blocking the spreading of silencing in the yeast S. cerevisiae (Donze et al., 1999). A tRNAThr gene located adjacent to the silenced HMR locus blocks the spreading of silencing, and deleting this gene leads to increased spreading of Sir-mediated silencing similar to the observations in S. pombe (Haldar and Kamakaka, 2006). Three Biofilmþþ mutants (CG213 to CG215) had insertion sites between the EPA-like genes CAGL0I10147g and CAGL0I10200g that are located in regions immediately adjacent to the telomeres, where they are normally transcriptionally silenced. Another important group of Biofilm mutant strains presented insertions within or close to genes encoding chromatin structure elements or potential regulators consistent with the role of chromatin structure in biofilm formation. Mutant strains CG202 and CG203 had an insertion site located close to the gene CAGL0C04389g encoding a core histone protein (HTB1, HTB2), required for chromatin assembly (Wallis et al., 1980). We focused our interest on two groups of mutants. The first group was represented by two mutant strains (CG217 and CG218) with plasmid insertions downstream of the 30 UTR
302
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
region of the CAGL0I05170g gene. This ORF encodes a protein similar to S. cerevisiae Cst6p, a basic leucine zipper (bZIP) transcription factor of the ATF/CREB family involved in chromosome stability and telomere maintenance (Ouspenski et al., 1999). The second group of mutants was represented by three strains (CG204, CG209 and CG210) with insertion sites close to genes encoding proteins with functions related to the chromatin remodelling Swi/Snf complex (SNF6, STA1 and RAD54). This highly conserved protein complex is involved in the remodelling of chromatin structure, thus regulating the expression of a large number of genes (Martens and Winston, 2003). 3.2. Cst6p regulates biofilm formation and modulates EPA6 gene expression independently of the Yak1p/Sir4p signalling pathway To assess whether CST6 regulates biofilm formation in C. glabrata, we constructed a cst6D deletion mutant by gene replacement and we tested its ability to form biofilms. As expected, the cst6D strain presented a 3- to 4-fold increased ability to form biofilms as compared to the wild-type strain (Fig. 1a). Nevertheless, biofilm formation by the cst6D strain remained lower than that of the previously isolated sir4D mutant (Fig. 1a; Iraqui et al., 2005). EPA6 has been shown to encode the main adhesin involved in biofilm development in C. glabrata and its transcription is altered in yak1-1 and sir4D biofilm mutants (Iraqui et al., 2005) Therefore, we tested whether EPA6 expression was also affected in the cst6D mutant. When the mutant strains were grown in the same medium as those used for biofilm production, a more than 2fold increase in EPA6 expression was observed in the cst6D mutant strain as compared to original strain (Fig. 1b). These results showed that Cst6p is a negative regulator of biofilm formation and EPA6 expression. In order to determine whether Cst6p acts in a Yak1pdependent or independent pathway, we constructed two independent cst6D yak1-1 double mutant strains. We then assessed their biofilm phenotypes. As shown in Fig. 1c, the cst6D yak11 double mutants presented a strong Biofilm phenotype. Consistently, we were unable to detect EPA6 expression by using semi-quantitative RT-PCR in the cst6D yak1-1 mutants (data not shown). The sir4D yak1-1 mutant displayed a Biofilmþþ phenotype associated with a strong EPA6 expression level, suggesting that Yak1p regulation of biofilm formation was dependent on Sir4p and on the integrity of the subtelomeric silencing machinery (Iraqui et al., 2005). The present results suggest that Yak1p and Cst6p control EPA6 expression, and consequently biofilm formation, independently in C. glabrata. 3.3. The Swi/Snf complex regulates biofilm formation in C. glabrata As previously mentioned, three strains presented insertion sites close to genes encoding proteins with a function related to the chromatin remodelling Swi/Snf complex. We were thus
Fig. 1. CST6 affects biofilm formation in C. glabrata. (a) Biofilm formation was measured using a XTT reduction assay in wild-type BG2, sir4D and cst6D strains. 100% activity corresponds to the amount of XTT reduced by the original strain (BG2). The reported values are the means SD of three independent experiments. (b) Transcription of EPA6 assessed by RT-qPCR in wild-type BG2, sir4D and cst6D strains. Values were normalized according to the ACT1 gene and EPA6 expression in wild-type BG2 was normalized to 1.00. (c) Biofilm formation was measured by XTT reduction assay in wild-type BG2, yak1-1, cst6D and cst6D yak1-1 strains. 100% Ac correspond to the amount of XTT reduced by the parent strain (BG2). The reported values are the means SD of three independent experiments.
interested in determining the role of the Swi/Snf complex in biofilm development. The Swi/Snf nucleosome-remodelling complex activates transcription by remodelling nucleosomes. It was first identified in the yeast S. cerevisiae and is a large complex that contains at least 11 distinct polypeptides (Cairns et al., 1994). Cross-linking of the Swi/Snf complex to DNA occurs mostly via the Snf2p and Snf6p subunits. These two components are critical for the direct interaction of the Swi/ Snf complex with the nucleosome (Sengupta et al., 2001). We thus constructed SNF6 and SNF2 disruption mutants and analyzed them for their ability to form biofilms and to express the adhesin-encoding gene EPA6. As shown in Fig. 2a, biofilm
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
303
presented a growth defect (data not shown). Consistently, the snf6D sir4D and the snf6D yak1-1 double mutants grew less well than the sir4D and the yak1D strains, respectively (data not shown). In synthetic complete medium (SC), the snf2D (doubling time ¼ 2.35 h) and snf6D (doubling time ¼ 2.2 h) mutants displayed a 2-fold reduction in growth rate compared to the parent strain (doubling time ¼ 1 h) (Fig. 2c). We thus questioned whether the stage of the cells during planktonic growth could influence biofilm formation in microtiter plates. snf6D Cells were recovered at different stages of the growth curve and tested for their ability to form biofilms. In contrast to what has been published for the wild-type strain (Iraqui et al., 2005), the ability of the snf6D strain to form biofilms decreased as this strain was progressing through the stationary phase of growth (Fig. 3a). However, biofilm formation by the snf6D strain was always reduced relative to the wild-type strain. Consistently, EPA6 transcription was reduced by 94 0.7% in the snf6D mutant at all times except at 10 h of growth, when EPA6 expression peaked at 42 3.5% of the wild-type (Fig. 3b). In contrast, the snf2D mutant showed an average reduction of 90 2% compared to the wild-type strain and this level remained stable from 8 to 24 h of growth (Fig. 3b).
Fig. 2. SNF2 and SNF6 are required for biofilm formation in C. glabrata. (a) Biofilm formation was measured using a XTT reduction assay in wild-type BG2, snf2D and snf6D strains. 100% activity corresponds to the amount of XTT reduced by the parent strain (BG2). The reported values are the means SD of three independent experiments. (b) Transcription of EPA6 assessed by RT-qPCR in wild-type BG2, snf2D and snf6D strains. (c) Growth defect of C. glabrata strains associated with SNF2 and SNF6 disruptions. Cells were grown on liquid SC þ Ura þ 0.2% glucose.- BG2; :snf6D; C snf2D.
production of the snf2D and snf6D mutant strains was 3e5% and 20e25% of that of the wild-type strain, respectively. EPA6 expression in the snf2D and snf6D deletion mutants was determined by RT-qPCR on RNA extracted from cells grown in the same medium as that used for biofilm production. The snf2D and the snf6D strains exhibited a 90%e95% reduction, respectively, in EPA6 expression compared to the wild-type strain (Fig. 2b). The low levels of EPA6 transcription observed in the snf mutant strains correlated with their reduced ability to develop a biofilm. Planktonic growth of mutants affected in the Yak1/Sir pathway or in the Swi/Snf function was compared. After 48 h of growth on solid rich medium (YPD), the sir4D and yak1-1 mutants exhibited growth similar to that of the wild-type strain, whereas both snf2D and snf6D mutant strains
Fig. 3. Impact of the growth stage on biofilm formation and EPA6 transcription. (a) Biofilm formation by the snf6D mutant according to the stage of growth. Cells were recovered by centrifugation at different stages of growth along the growth curve. Cell concentration was adjusted to 0D600 ¼ 1 in fresh medium and cells were tested for biofilm formation as described in Materials and methods. Results were compared to those obtained with the wild-type strain after 24 h of growth (100%). (b) EPA6 expression according to the stage of growth in snf2D (grey) and snf6D (white) mutant strains as compared to strain BG2 (black).
304
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
3.4. The Swi/Snf complex modulates EPA6 expression in a Sir4p-dependent manner Transcription of the adhesin-encoding gene EPA6 has been reported to be regulated via the Yak1/Sir signalling pathway (Iraqui et al., 2005). We next wanted to investigate whether the Swi/Snf complex acts in the same pathway as SIR3 and SIR4 or functions independently. For this purpose, we constructed two independent sir4D snf6D double deletion mutants. We assessed their biofilm phenotypes and determined EPA6 expression levels in the cells grown under biofilm growth conditions. Both mutants showed increased cell adherence relative to the wildtype strain despite reduced ability to form biofilm relative to a sir4D strain (Fig. 4a). Concordantly, the expression of EPA6 was similar in the sir4D and sir4D snf6D strains (Fig. 4b). We also constructed two independent snf6D yak1-1 double mutant strains. These strains showed a biofilm defect similar to that of the snf6D and yak1-1 strains (Fig. 4b), although assays to measure the very low expression of EPA6 in this background were unsuccessful, with results being too poorly reproducible (data not shown). Overall, these results suggest that the Swi/Snf complex contributes to the process of biofilm formation in a manner dependent on the integrity of the Sir complex. 3.5. The Swi/Snf complex does not regulate expression of EPA1 in the same way as EPA6 The EPA6 gene belongs to a large family of genes almost all of which are located close to or within subtelomeric
Fig. 4. The Swi/Snf complex modulates EPA6 expression in a Sir4p-dependent manner. (a) Biofilm formation was measured using a XTT reduction assay in wild-type BG2, snf6D, sir4D, sir4D snf6D, yak1-1, and snf6D yak1-1 strains. 100% activity corresponds to the amount of XTT reduced by the parent strain (BG2). Reported values are the means SD of three independent experiments. (b) Transcription of EPA6 assessed by RT-qPCR in wild-type BG2, sir4D and cst6D strains. Values were normalized according to the ACT1 gene.
regions. Historically, the first member identified in this family was named EPA1 and encodes a protein involved in adhesion to host cells (Cormack et al., 1999). We analyzed the expression of EPA1 in the snf2D and snf6D mutant strains at different stages of growth. In the BG2 wild-type strain, as anticipated, we observed EPA1 expression only at the earliest times of growth (1 h and 3 h, Fig. 5) (Cormack et al., 1999). Surprisingly, at that stage, expression of EPA1 was stronger in the snf2D and snf6D mutant strains. After 6 h of growth, EPA1 expression became barely detectable in the mutant strains, and could not be detected in the wild-type strain. This pattern of expression contrasted with that observed for EPA6 (Fig. 3b) suggesting that Swi/Snf regulation of the EPA genes is genespecific in C. glabrata. 4. Discussion We had previously demonstrated that Epa6p is required for biofilm formation in C. glabrata (Iraqui et al., 2005). We also showed that the Yak1p kinase regulates the expression of EPA6 and that this regulation is dependent on the presence of the intact subtelomeric silencing machinery. Here we have identified new C. glabrata genes for which an insertional mutation in the coding region or in its vicinity results in a defect in biofilm formation. Further to this, we have extended our study to investigate the role of the Cst6p transcription factor and the Swi/Snf complex in biofilm formation by C. glabrata. First, we have shown that a protein similar to S. cerevisiae Cst6p, a basic leucine zipper (bZIP) transcription factor of the ATF/CREB family involved in chromosome stability and telomere maintenance (Ouspenski et al., 1999), is involved in the control of biofilm formation by C. glabrata. Our results demonstrated that deletion of CST6 in C. glabrata affects biofilm formation. We showed that the transcription factor is a negative regulator of the adhesin-encoding gene EPA6. Moreover, phenotypic analysis of the cst6D yak1-1 double mutant suggested that Cst6p regulates EPA6 expression and consequently biofilm formation independently of the Yak1p/
Fig. 5. Expression of EPA1 in Swi/Snf mutant strains. EPA1 expression was measured in wild-type strain BG2 (black), snf2D mutant strain (grey) and snf6D mutant strain (white) according to growth stage. (:) BG2; (-) snf2D, () snf6D.
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
Sir4p signalling pathway. Although we have no information thus far regarding the pathway(s) in which Cst6p may be involved in regulating biofilm formation in C. glabrata, this protein was recently identified as a heat-responsive transcription factor in S. cerevisiae (Wu and Li, 2008). Interestingly, heat shock response proteins show elevated levels in C. glabrata biofilms (Seneviratne et al., 2010), suggesting possible overlap between these two types of regulatory modules in which Cst6p could act. We also identified three mutant strains with insertions close to genes encoding proteins with functions related to the Swi/ Snf chromatin remodelling complex, namely SNF6 that encodes a subunit of the Swi/Snf chromatin remodelling complex, RAD54 that encodes a DNA-dependent ATPase member of the Swi2/Snf2-like family and STA1 that encodes a glucoamylase and is activated by the Swi/Snf complex. Here we demonstrate that the Swi/Snf complex is involved in biofilm formation in C. glabrata. Indeed, snf2D and snf6D mutants presented a reduction in their growth rates, a decreased level of EPA6 expression compared to the wildtype strain and consequently decreased ability to form biofilm. Although the exact biochemical roles of all Swi/Snf components is not known, it has been shown that the conserved Swi1 and Snf5 proteins bind transcriptional activators in S. cerevisiae (Neely et al., 2002). Moreover, microarray studies have shown that the Swi/Snf complex regulates ca. 6% of all S. cerevisiae genes. As these genes are distributed throughout the genome, remodelling of the chromatin structure by the Swi/Snf complex appears to be sequenceindependent (Holstege et al., 1998; Sudarsanam et al., 2000). This complex can be targeted to promoters via its recruitment by transcription activators or repressors (Dimova et al., 1999; Peterson and Workman, 2000; Prochasson et al., 2003; Yudkovsky et al., 1999). Moreover, using reporter genes, it has been shown that the complex mediates silencing of genes located at telomeres (Dror and Winston, 2004). Therefore, in two phylogenetically related organisms such as S. cerevisiae and C. glabrata, the Swi/Snf complex can trigger transcriptional activation or repression at telomeres depending on the recruiting transcription factors. In our study, analysis of sir4D snf6D and snf6D yak1-1 double mutants suggested that the Swi/Snf complex modulates EPA6 expression in a Sir4pdependent manner. While we do not know whether this regulation is direct or indirect in C. glabrata, it has been recently shown that the Swi/Snf complex antagonizes Sir3p binding to minichromosomes in S. cerevisiae (Sinha et al., 2009). Although Sir3p clearly plays a role in the expression level of EPA6 (Castano et al., 2005; Iraqui et al., 2005), regulation of Sir3p binding to subtelomeric regions by the Swi/Snf complex in C. glabrata remains to be demonstrated. Similarly, in C. albicans the Swi/Snf complex is required for hyphal development and pathogenicity (Mao et al., 2006), but the direct target(s) of this complex are still unknown. Swi/Snf regulation of EPA6 appears specific, since the Swi/ Snf complex does not regulate expression of EPA1 in the same way as EPA6. Differential regulation of EPA genes by the different proteins of the subtelomeric silencing machinery has
305
already been reported. Indeed, it has been shown that most EPA genes located in subtelomeric regions are subject to negative regulation by Rap1 and the Sir proteins (Castano et al., 2005; De Las Penas et al., 2003; Iraqui et al., 2005). Nevertheless, whereas deletion of SIR4 results in overexpression of 37 genes, including subtelomerically located EPA genes (Ma et al., 2009), the absence of the yKu70/yKu80 heterodimer and of Rif1p has differential consequences on regulation of subtelomeric silencing at the different C. glabrata chromosomes (Rosas-Hernandez et al., 2008; Ramı´rezZavaleta et al., 2010). Therefore, although similar in structure, each subtelomeric region appears to be individually transcriptionally regulated. It was already known that the Swi/ Snf complex could modulate the structure of the chromatin to activate or repress transcription in eukaryotes. In C. glabrata, its action in remodelling repressive and active chromatin states at the EPA loci remains to be understood. The new regulators identified in the present work (Cst6p and the Swi/Snf complex) are in addition to a number of previously identified factors influencing the expression of EPA genes. Indeed, regulation of adhesion genes in C. glabrata appears very complex and different external signals have been demonstrated to alter EPA gene expression (Fig. 6). For instance, EPA6 is expressed during murine urinary tract infection, but remains silent in a systemic infection. Domergue et al. demonstrated that expression in the urinary tract is the result of nicotinic acid limitation in this host niche (Domergue et al., 2005). Those authors hypothesized that poor accessibility in nicotinic acid would result in a reduction of NADþ necessary for the activity of the Sir2p histone deacetylase (Domergue et al., 2005). More recently, it was demonstrated that EPA6 and EPA1, but not EPA7, are activated in the presence of two widely used preservatives (paraben and sorbic acid) (Mundy and Cormack, 2009). Those same authors also showed that hypoxic conditions induced EPA6 expression (Domergue et al., 2005; Mundy and Cormack, 2009). Finally, it was shown that biofilm conditions and high cell density were inducers of EPA6, whereas EPA1 was expressed mostly in the lag phase (De Las Penas et al., 2003; Iraqui et al., 2005). This complex regulation of adhesin genes in C. glabrata is
Fig. 6. Model for EPA6 regulation in C. glabrata.
306
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
reminiscent of the highly complex regulation of S. cerevisiae FLO genes. Indeed, FLO11 is one of the genes regulated by the Swi/Snf complex. This gene is also regulated by transcription factors Flo8 and Mss11 and the cAMP signalling pathway (van Dyk et al., 2005). Similarly, in S. cerevisiae, regulation of FLO11 expression appears to be dependent on several factors acting directly or indirectly at the level of transcription (Octavio et al., 2009). An understanding of the regulation of expression of EPA genes will represent a major challenge in the future, as their adhesin gene products represent key elements in the regulation of C. glabrata interactions with the host. Acknowledgements We are very grateful to Brendan P. Cormack (John Hopkins University School of Medecine, Baltimore) for providing the insertional mutant library. This work was supported by a grant from the Institut Pasteur (PTR173). References Banerjee, M., Thompson, D.S., Lazzell, A., Carlisle, P.L., Pierce, C., Monteagudo, C., Lo´pez-Ribot, J.L., Kadosh, D., 2008. UME6, a novel filament-specific regulator of Candida albicans hyphal extension and virulence. Mol. Biol. Cell. 19, 1354e1365. Cairns, B.R., Kim, Y.-J., Sayre, M.H., Laurent, B.C., Kornberg, R.D., 1994. A multisubunit complex containing the SWI/ADR6, SWI2/SNF2, SWI3, SNF5, and SNF6 gene products isolated from yeast. Proc. Natl. Acad. Sci. U S A 91, 1950e1954. Castano, I., Pan, S.J., Zupancic, M., Hennequin, C., Dujon, B., Cormack, B.P., 2005. Telomere length control and transcriptional regulation of subtelomericadhesins in Candida glabrata. Mol. Microbiol. 55, 1246e1258. Chen, S.C., Tong, Z.S., Lee, O.C., Halliday, C., Playford, E.G., Widmer, F., Kong, F.R., Wu, C., Sorrell, T.C., 2008. Clinician response to Candida organisms in the urine of patients attending hospital. Eur. J. Clin. Microbiol. Infect. Dis. 27, 201e208. Coco, B.J., Bagg, J., Cross, L.J., Jose, A., Cross, J., Ramage, G., 2008. Mixed Candida albicans and Candida glabrata populations associated with the pathogenesis of denture stomatitis. Oral Microbiol. Immunol. 23, 377e383. Cormack, B.P., Ghori, N., Falkow, S., 1999. An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 285, 578e582. de Groot, P.W., Kraneveld, E.A., Yin, Q.Y., Dekker, H.L., Gross, U., Crielaard, W., de Koster, C.G., Bader, O., Klis, F.M., Weig, M., 2008. The cell wall of the human pathogen Candida glabrata: differential incorporation of novel adhesin-like wall proteins. Eukaryot. Cell 7, 1951e1964. De Las Penas, A., Pan, S.J., Castano, I., Alder, J., Cregg, R., Cormack, B.P., 2003. Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata are encoded in subtelomeric clusters and subject to RAP1- and SIR-dependent transcriptional silencing. Genes Dev. 17, 2245e2258. d’Enfert, C., 2009. Hidden killers: persistence of opportunistic fungal pathogens in the human host. Curr. Opin. Microbiol. 12, 358e364. Dimova, D., Nackerdien, Z., Furgeson, S., Eguchi, S., Osley, M.A., 1999. A role for transcriptional repressors in targeting the yeast Swi/Snf complex. Mol. Cell 4, 75e83. Domergue, R., Castan˜o, I., De Las Pen˜as, A., Zupancic, M., Lockatell, V., Hebel, J.R., Johnson, D., Cormack, B.P., 2005. Nicotinic acid limitation regulates silencing of Candida adhesins during UTI. Science 308, 866e870.
Donlan, R.M., Costerton, J.W., 2002. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin. Microbiol. Rev. 15, 167e193. Donze, D., Adams, C.R., Rine, J., Kamakaka, R.T., 1999. The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev. 13, 698e708. Dror, V., Winston, F., 2004. The Swi/Snf chromatin remodeling complex is required for ribosomal DNA and telomeric silencing in Saccharomyces cerevisiae. Mol. Cell. Biol. 24, 8227e8235. Fidel Jr., P.L., Cutright, J.L., Tait, L., Sobel, J.D., 1996. A murine model of Candida glabrata vaginitis. J. Infect. Dis. 173, 425e431. Fidel Jr., P.L., Vazquez, J.A., Sobel, J.D., 1999. Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans. Clin. Microbiol. Rev. 12, 80e96. Ford, G., Ellis, E.M., 2002. Characterization of Ypr1p from Saccharomyces cerevisiae as a 2-methylbutyraldehyde reductase. Yeast 19, 1087e1096. Frieman, M.B., McCaffery, J.M., Cormack, B.P., 2002. Modular domain structure in the Candida glabrata adhesin Epa1p, a beta1, 6glucan-crosslinked cell wall protein. Mol. Microbiol. 46, 479e492. Hao, B., Clancy, C.J., Cheng, S., Raman, S.B., Iczkowski, K.A., Nugyen, M.H., 2009. Candida albicans RFX2 encodes a DNA binding protein involved in DNA damage responses, morphogenesis, and virulence. Eukaryot. Cell 8, 627e639. Hajjeh, R.A., Sofair, A.N., Harrison, L.H., Lyon, G.M., ArthingtonSkaggs, B.A., Mirza, S.A., Phelan, M., Morgan, J., Lee-Yang, W., Ciblak, M.A., Benjamin, L.E., Sanza, L.T., Huie, S., Yeo, S.F., Brandt, M.E., Warnock, D.W., 2004. Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates collected from 1998 to 2000 in a population-based active surveillance program. J. Clin. Microbiol. 42, 1519e1527. Haldar, D., Kamakaka, R.T., 2006. tRNA genes as chromatin barriers. Nat. Struct. Mol. Biol. 13, 192e193. Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.I., Hengartner, C.J., Green, M.R., Golub, T.R., Lander, E.S., Young, R.A., 1998. Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95, 717e728. Iraqui, I., Garcia-Sanchez, S., Aubert, S., Dromer, F., Ghigo, J.M., d’Enfert, C., Janbon, G., 2005. The Yak1p kinase controls expression of adhesins and biofilm formation in Candida glabrata in a Sir4p-dependent pathway. Mol. Microbiol. 55, 1259e1271. Kauffman, C.A., Vazquez, J.A., Sobel, J.D., Gallis, H.A., McKinsey, D.S., Karchmer, A.W., Sugar, A.M., Sharkey, P.K., Wise, G.J., Mangi, R., Mosher, A., Lee, J.Y., Dismukes, W.E., 2000. Prospective multicenter surveillance study of funguria in hospitalized patients. The National Institute for Allergy and Infectious Diseases (NIAID) Mycoses study group. Clin. Infect. Dis. 30, 14e18. Kaur, R., Domergue, R., Zupancic, M.L., Cormack, B.P., 2005. A yeast by any other name: Candida glabrata and its interaction with the host. Curr. Opin. Microbiol. 8, 378e384. Kaur, R., Ma, B., Cormack, B.P., 2007. A family of glycosylphosphatidylinositol-linked aspartyl proteases is required for virulence of Candida glabrata. Proc. Natl. Acad. Sci. U S A 104, 7628e7633. Kraneveld, E.A., de Soet, J.J., Deng, D.M., Dekker, H.L., de Koster, C.G., Klis, F.M., Crielaard, W., de Groot, P.W., 2011. Identification and differential gene expression of adhesin-like wall proteins in Candida glabrata biofilms. Mycopathologia 172, 415e427. Kuwayama, H., Obara, S., Morio, T., Katoh, M., Urushihara, H., Tanaka, Y., 2002. PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Res. 30, E2. Liu, W., Zhao, J., Li, X., Li, Y., Jiang, L., 2010. The protein kinase CaSch9p is required for the cell growth, filamentation and virulence in the human fungal pathogen Candida albicans. FEMS Yeast Res. 10, 462e470. Malani, P.N., Bradley, S.F., Little, R.S., Kauffman, C.A., 2001. Trends in species causing fungaemia in a tertiary care medical centre over 12 years. Mycoses 44, 446e449. Ma, B., Pan, S.J., Domergue, R., Rigby, T., Whiteway, M., Johnson, D., Cormack, B.P., 2009. High-affinity transporters for NADþ precursors in Candida glabrata are regulated by Hst1 and induced in response to niacin limitation. Mol. Cell. Biol. 29, 4067e4079.
M. Riera et al. / Research in Microbiology 163 (2012) 297e307 Mao, X., Cao, F., Nie, X., Liu, H., Chen, J., 2006. The Swi/Snf chromatin remodeling complex is essential for hyphal development in Candida albicans. FEBS Lett. 580, 2615e2622. Martens, J.A., Winston, F., 2003. Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Curr. Opin. Genet. Dev. 2, 13136e13142. Mundy, R.D., Cormack, B., 2009. Expression of Candida glabrata adhesins after exposure to chemical preservatives. J. Infect. Dis. 199, 1891e1898. Neely, K.E., Hassan, A.H., Brown, C.E., Howe, L., Workman, J.L., 2002. Transcription activator interactions with multiple SWI/SNF subunits. Mol. Cell. Biol. 22, 1615e1625. Octavio, L.M., Gedeon, K., Maheshri, N., 2009. Epigenetic and conventional regulation is distributed among activators of FLO11 allowing tuning of population-level heterogeneity in its expression. PLoS Genet. 5, e1000673. Ouspenski, I.I., Elledge, S.J., Brinkley, B.R., 1999. New yeast genes important for chromosome integrity and segregation identified by dosage effects on genome stability. Nucleic Acids Res. 27, 3001e3008. Peterson, C.L., Workman, J.L., 2000. Promoter targeting and chromatin remodeling by the SWI/SNF complex. Curr. Opin. Genet. Dev. 10, 187e192. Prochasson, P., Neely, K.E., Hassan, A.H., Li, B., Workman, J.L., 2003. Targeting activity is required for SWI/SNF function in vivo and is accomplished through two partially redundant activator-interaction domains. Mol. Cell 12, 983e990. Ramage, G., Martinez, J.P., Lopez-Ribot, J.L., 2006. Candida biofilms on implanted biomaterials: a clinically significant problem. FEMS Yeast Res. 6, 979e986. Ramı´rez-Zavaleta, C.Y., Salas-Delgado, G.E., De Las Pen˜as, A., Castan˜o, I., 2010. Subtelomeric silencing of the MTL3 locus of Candida glabrata requires yKu70, yKu80, and Rif1 proteins. Eukaryot. Cell 9, 1602e1611. Riera, M., Moreno-Ruiz, E., Goyard, S., d’Enfert, C., Janbon, G., 2012. Biofilm formation studies in microtiter plate format. In: Brand, A.C., MacCallum, D.M. (Eds.), Host-Fungus Interactions. Humana Press Inc. Methods in Molecular Biology. Roetzer, A., Gabaldo´n, T., Schu¨ller, C., 2011. From Saccharomyces cerevisiae to Candida glabrata in a few easy steps: important adaptations for an opportunistic pathogen. FEMS Microbiol. Lett. 14, 1e9. Rosas-Hernandez, L.L., Juarez-Reyes, A., Arroyo-Helguera, O.E., De Las Penas, A., Pan, S.J., Cormack, B.P., Castano, I., 2008. yKu70/yKu80 and
307
Rif1 regulate silencing differentially at telomeres in Candida glabrata. Eukaryot. Cell 7, 2168e2178. Seneviratne, C.J., Wang, Y., Jin, L., Abiko, Y., Samaranayake, L.P., 2010. Proteomics of drug resistance in Candida glabrata biofilms. Proteomics 10, 1444e1454. Sengupta, S.M., VanKanegan, M., Persinger, J., Logie, C., Cairns, B.R., Peterson, C.L., Bartholomew, B., 2001. The interactions of yeast SWI/SNF and RSC with the nucleosome before and after chromatin remodeling. J. Biol. Chem. 276, 12636e12644. Sherman, F., 1992. Getting started with yeast. In: Guthrie, c., Fink, G.R. (Eds.), 1992. Guide to Yeast Genetics and Molecular Biology, vol. 194. Academic Press, San Diego, CA, pp. 3e21. Sinha, M., Watanabe, S., Johnson, A., Moazed, D., Peterson, C.L., 2009. Recombinational repair within heterochromatin requires ATP-dependent chromatin remodeling. Cell 138, 1109e1121. Silva, S., Negri, M., Henriques, M., Oliveira, R., Williams, D.W., Azeredo, J., 2011. Adherence and biofilm formation of non-Candida albicans Candida species. Trends Microbiol. 19, 241e247. Sudarsanam, P., Iyer, V.R., Brown, P.O., Winston, F., 2000. Whole-genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U S A 97, 3364e3369. Uppuluri, P., Chaturvedi, A.K., Srinivasan, A., Banerjee, M., Ramasubramaniam, A.K., Ko¨hler, J.R., Kadosh, D., Lopez-Ribot, J.L., 2010. Dispersion as an important step in the Candida albicans biofilm developmental cycle. PLoS Pathog. 6, e1000828. van Dyk, D., Pretorius, I.S., Bauer, F.F., 2005. Mss11p is a central element of the regulatory network that controls FLO11 expression and invasive growth in Saccharomyces cerevisiae. Genetics 169, 91e106. Wallis, J.W., Hereford, L., Grunstein, M., 1980. Histone H2B genes of yeast encode two different proteins. Cell 3, 799e805. Weig, M., Jansch, L., Gross, U., De Koster, C.G., Klis, F.M., De Groot, P.W., 2004. Systematic identification in silico of covalently bound cell wall proteins and analysis of protein-polysaccharide linkages of the human pathogen Candida glabrata. Microbiology 150, 3129e3144. Wu, W.S., Li, W.H., 2008. Identifying gene regulatory modules of heat shock response in yeast. BMC Genomics 9, 439. Yudkovsky, N., Logie, C., Hahn, S., Peterson, C.L., 1999. Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators. Genes Dev. 13, 2369e2374.
New regulators of biofilm development in Candida glabrata Marta Riera a,1, Estelle Mogensen a,2, Christophe d’Enfert b,c, Guilhem Janbon a,* b
a Institut Pasteur, Unite´ des Aspergillus, De´partement Parasitologie et Mycologie, F-75015 Paris, France Institut Pasteur, Unite´ Biologie et Pathoge´nicite´ Fongiques, De´partement Ge´nomes et Ge´ne´tique, F-75015 Paris, France c INRA, USC2019, F-75015 Paris, France
Received 23 November 2011; accepted 15 February 2012 Available online 3 March 2012
Abstract Biofilm formation plays an important role in fungal pathogenesis. In this work, we used a genetic screen in order to identify and characterize genes involved in the formation of biofilms by the opportunistic fungal pathogen Candida glabrata. We identified the Cst6p transcription factor as a negative regulator of the EPA6 gene that encodes an adhesin central to C. glabrata biofilm formation. Analysis of single and double mutant strains showed that Cst6p acts in a pathway independent of the Yak1/Sir4 pathway also known to regulate expression of EPA6 and consequently biofilm formation. In contrast, we showed that the chromatin remodelling Swi/Snf complex positively regulates biofilm formation in C. glabrata. RT-qPCR experiments demonstrated that EPA6 expression, and thus biofilm formation, depends on the integrity of the Sir complex. Finally, we showed that Swi/Snf-dependent regulation of biofilm formation is adhesin-specific. Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Candida glabrata; Biofilm; Adhesin; Chromatin; Silencing
1. Introduction In the past two decades, Candida glabrata has become an increasingly prevalent pathogen worldwide (Chen et al., 2008; Fidel et al., 1999; Malani et al., 2001; Roetzer et al., 2011). After Candida albicans, it represents the second cause of fungal infections of the bloodstream (Hajjeh et al., 2004), oropharynx (Coco et al., 2008) and urinary tract (Kauffman et al., 2000). Patients who are subjected to chemotherapy or transplantation or harbour medical devices present a higher risk of developing Candida infections (Ramage et al., 2006).
* Corresponding author. E-mail addresses: [email protected] (M. Riera), [email protected] (E. Mogensen), [email protected] (C. d’Enfert), [email protected] (G. Janbon). 1 Present address: Dept. Molecular Genetics, Center for Research in Agricultural Genomics (CRAG), Bellaterra (Cerdanyola del Valles), 08193 Barcelona, Spain. 2 Present address: Sup’Biotech, 66 rue Guy Moˆquet, 94800 Villejuif, France.
Mechanisms that elicit virulence in C. glabrata are still poorly understood (Kaur et al., 2005). However, secretion of phospholipases, survival and replication within macrophages, and synthesis of adhesins have been shown to contribute to infection (Cormack et al., 1999; Kaur et al., 2007; Weig et al., 2004). C. glabrata is able to colonize host tissues as well as abiotic surfaces, where it develops as multilayered biofilm structures (Iraqui et al., 2005). Biofilm development contributes to increased resistance to antifungal agents and results in persistent infections (d’Enfert, 2009; Donlan and Costerton, 2002). Biofilm formation involves cell-substrate and cellecell interactions. Therefore, expression of specific adhesins at the cell surface is essential throughout biofilm development (Silva et al., 2011). In C. glabrata, adherence is mediated by cell wall adhesins encoded by the EPA gene family (Cormack et al., 1999; De Las Penas et al., 2003; Frieman et al., 2002). Similarly to the flocculin/lectins encoded by FLO genes in Saccharomyces cerevisiae, C. glabrata Epa proteins are predicted to be glycosylphosphatidylinositol (GPI)-anchored cell wall proteins that bind host cell carbohydrates. Three members of the EPA gene family (EPA1,
0923-2508/$ - see front matter Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2012.02.005
298
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
EPA6 and EPA7) mediate adherence of C. glabrata to human epithelial cells (Castano et al., 2005; Domergue et al., 2005), whereas EPA6 encodes the main adhesin involved in biofilm formation (Iraqui et al., 2005). In addition, adhesinlike proteins have also been identified in the cell wall of C. glabrata and are involved in adherence and biofilm formation (de Groot et al., 2008; Kraneveld et al., 2011). The expression of all of the characterized EPA genes is regulated by transcriptional silencing via the Sir complex (Castano et al., 2005; Iraqui et al., 2005; Rosas-Hernandez et al., 2008). For instance, EPA2-5 genes are constitutively silenced. In contrast, expression of EPA6 occurs in the stationary phase, and we previously demonstrated that EPA6 expression is regulated by Yak1p, a kinase that controls Sir4pand Rif1p-dependent subtelomeric silencing (Iraqui et al., 2005). These results suggest that maintenance of the telomere structure, where EPA genes are located, and regulation of silencing mechanisms play important roles in C. glabrata biofilm formation. The aim of the present study was to further investigate regulation of the expression of the adhesinencoding gene EPA6 in C. glabrata during biofilm development. Through genetic analyses, we identified and characterized new genes involved in biofilm formation. We showed that EPA6 expression is positively regulated by the chromatin remodelling Swi/Snf complex, whereas transcription factor Cst6p is a negative regulator of EPA6 transcription. 2. Materials and methods 2.1. Strains and media C. glabrata strains used in this study are listed in Table 1; all strains were isogenic to the BG2 strain (Fidel et al., 1996). Synthetic complete (SC) and eUra DO synthetic media and YPDrich medium were prepared as previously described (Sherman, 1992). All strains were grown at 37 C. When needed, 5-fluoroorotic acid (FOA) was added to eUra DO synthetic medium at 1 g l1. The bacterial strain Escherichia coli XL1-Blue (Stratagene, La Jolla, CA) was used for propagation of all plasmids. 2.2. Gene disruption Disruption of the SNF2, SNF6 and CST6 genes was achieved by homologous recombination of a cassette constructed Table 1 Strains used in this work. Strain name
Genotype
Reference or source
BG2 CG122 CG129 CG160 CG177 CG180 CG178/CG179 CG187/CG188 CG187/CG188 CG234/CG135
Clinical isolate epa6-1 yak11 sir4D::ura3 snf6::URA3 snf2::URA3 cst6::URA3 snf6D::ura3 yak1-1 cst6D::ura3 yak1-1 sir4D::ura3 snf6D::URA3
Fidel et al., 1996 Iraqui et al., 2005 Iraqui et al., 2005 Iraqui et al., 2005 This work This work This work This work This work This work
by fusion PCR using a strategy similar to that described by Kuwayama et al. (2002), with primers 1e8, 9e16 and 17e24, respectively (Table 2). The resulting fusion construct contained the auxotrophic selectable marker URA3 flanked by 50 and the 30 -regions of the target genes. Gene deletions were then obtained as previously described (Iraqui et al., 2005) using strain BG14 as recipient strain. They were confirmed by PCR (using the internal and the external primers; Table 2) and Southern blot analyses. Double mutant strains were constructed by transformation of a Ura- derivative of the single mutant strain selected on FOA medium as previously described (Iraqui et al., 2005). 2.3. RNA purification Strains were grown in liquid SC medium supplemented with 2% glucose for 24 h under shaking conditions. Cells were washed with sterile water, re-suspended in an appropriate volume of SC medium supplemented with 0.2% glucose in order to adjust the OD600 to 1.0 and incubated for another 24 h. They were harvested by centrifugation at 4 C, washed in ice-cold water and lyophilized. Total RNA was purified using the Trizol reagent (Invitrogen), following the manufacturer’s recommendations. 2.4. RT-qPCR Purified RNA was treated with DNase I (Roche) to eliminate residual genomic DNA. Synthesis of cDNA was performed using the QuantiTect reverse transcription kit (Qiagen), following the manufacturer’s instructions (1 mg RNA per reaction). The expression level of EPA6 and EPA1 genes was determined by qPCR using 5 ml of the appropriate dilutions of cDNA and 0.32 mM of primers 27e28 and 29e30 respectively (Table 2). Amplification reactions were performed using a thermal cycler (Bio-Rad) and resulting amplicons labelled with fluorescent dye SYBR Green (Bio-Rad). Results were analyzed using iCycler IQ real-time detection software (BioRad). The Ct values obtained in triplicate were averaged (Ct values considered if variation <0.5 units) and normalized to that of the housekeeping gene ACT1 (primers 25e26, Table 2). The statistical significance of differences in EPA6 and EPA1 expression levels, expressed as a percentage of that of the BG2 strain, was determined by applying a paired t-test ( p < 0.001). A dissociation curve was generated for each sample in order to ascertain that the correct amplicon was obtained. All RT-qPCR data were from at least two independent experiments (a least two RNA preparations) and three measurements. 2.5. Biofilm assays Strains were grown in SC medium supplemented with 2% glucose for 24 h under shaking conditions. This step was repeated once in order to obtain synchronous cell populations. Cells were treated under the same conditions as previously described (Riera et al., 2012; Iraqui et al., 2005), except that the
Table 2 Primer list. Primer name
Primer sequence (50 -30 )
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
Snf2-50 5 Snf2-50 3 Snf2-30 5 Snf2-30 3 Mkrsnf2f Mkrsnf2r Snf2ex Snf2ex2 Snf6-50 5 Snf6-50 3 Snf6-30 5 Snf6-30 3 Mkrsnf6f Mkrsnf6r Snf6ex Snf6ex2 Cst6-50 5 Cst6-50 3 Cst6-30 5 Cst6-30 3 Mkrcst6f Mkrcst6r Cst6ex Cst ex2 rtACT1F rtACT1R rtEPA6F rtEPA6R rtEPA1F rtEPA1R
GTGTGAGGGTACGGAGTGAGATG GTCATAGCTGTTTCCTGCATTGGCAGCGTTCTTACCGTG TACAACGTCGTGACTGGGCTAACGAAAACACCCCTCAAGAC GAAAATCTATTCGAGCGGGGACGACC GTCTTGAGGGGTGTTTTCGTTAGCCCAGTCACGACGTTGTA CACGGTAAGAACGCTGCCAATGCAGGAAACAGCTATGAC GAACGTGTTGAGCTAGGAAAGAGC GCTGCACTCGAAGATAGCAGATTCAC CAGAGATGCCTAGAAGGACTTGC GTCATAGCTGTTTCCTGCAGTCCTATTCCTCTGGACACG TACAACGTCGTGACTGGGGAATACGAGGCCGAACCATTC GTACAGGAACGGAGGGATGTG GAATGGTTCGGCCTCGTATTCCCCAGTCACGACGTTGTA CGTGTCCAGAGGAATAGGACTGCAGGAAACAGCTATGAC GGCCCAGGTAAGAATAGTGTGC TTGGTACTGGTGCTTGAGAGAGG GAGGAGAAGGCAAACGGAAAG GTCATAGCTGTTTCCTGTTCAGCGCAGTGTATCGTCTAC TACAACGTCGTGACTGGGGTGTCTCGGCTGATGTGCTATT GGTACTATGCTGGCGTCAATG AATAGCACATCAGCCGAGACACCCCAGTCACGACGTTGTA GTAGACGATACACTGCGCTGAACAGGAAACAGCTATGA GAGTGGGATGAGATGCACAAAG CTAATTGACTGGGGCCTTGCT GGCTTTCGATTTCTCACC GTGGCAACGGTTTGATGC GAAATCAGGATCGAATCCATG GTGGTAATGTATCAAACAGCG GGGCTCAAAAACAGCTAAG TAACAGTTGTTTTCGTTTGAT
Strain name
Insertion site (position)
Locus
Homologues in S. cerevisiae
Function in S. cerevisiae
Biofilm phenotype
CG202, CG203
Intergenic (42412)
CAGL0C04367g/ CAGL0C04389g
YBL001c (ECM15)/ YDR224c (HTB1, HTB2)
Minus
CG204
Intergenic (345992)
CAGL0E03674g/ CAGL0E03718g
YLL028w (TPO1)/ YHL025w (SNF6)
CG207
Intergenic (541040)
CG124, CG201
Intergenic (898047, 897723)
CAGL0F05335g/ CAGL0F05357g CAGL0F09075g/ CAGL0F09097g
YDR208w MSS4/ YDR207c UME6 YHR205w SCH9/ YHR206w SKN7
CG205 CG208
Intragenic (292286) Intragenic (567716)
CAGL0A02816g CAGL0G05896g
YDR368w YPR1 YHR143w DSE2
ECM15: protein of unknown function/HTB1, 2:core histone proteins required for chromatin assembly and chromosome function TPO1:Polyamine transporter/SNF6:Subunit of the SWI/SNF chromatin remodelling complex involved in transcriptional regulation MSS4: kinase involved in actin cytoskeleton organization/UME6: Key transcriptional regulator SCH9 Protein kinase involved in transcriptional activation of osmostress-responsive genes/SKN7: Nuclear response regulator and transcription factor YPR1: 2- methylbutyraldehyde reductase Daughter cell-specific secreted protein with similarity to glucanases, degrades cell wall
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
Primer number
Minus
Minus Minus
minus Minus 299
(continued on next page)
300
Table 2 (continued ) Strain name
Insertion site (position)
Locus
Homologues in S. cerevisiae
Function in S. cerevisiae
Biofilm phenotype
CG200, CG123, CG126 CG206
Intragenic (476654, 472286, 473362) Intergenic (472487)
CAGL0B04895g
YLR176c RFX1
Minus
YGL253w HXK2
CG219-234, CG136 CG209
Intergenic (149947149931, 150101) Intergenic (375046)
CAGL0A04829g/ CAGLOA04851g CAGL0J01551r/ CAGL0J01595g CAGL0I04224g/ CAGL0I04246g
tRNA-Val (AAC)/ YPR015c YGL163c RAD54/ YGL162w SUT1
CG217, CG218
Intergenic (489948, 489296) Intergenic (845785)
CAGL0I05148g/ CAGL0I05170g CAGL0I08657r/ CAGL0I08679r CAGL0I10147g/ CAGL0I10200g
YDL174c DLD1/ YIL036w CST6 tRNA-Arg (ACG)/ tRNA-Ser (AGA) YAR050W FLO1/ YHR211W FLO5
RFX1 Major transcriptional repressor of DNAdamage-regulated genes Hexokinase isoenzyme 2 that catalyzes phosphorylation of glucose in the cytosol tRNA-Val (AAC)/YPR015c Transcription factor Zinc finger, C2H2 type YGL163c RAD54 DNA-dependent ATPase member of the Swi2/Snf2-like family/SUT1 hypoxic protein involved in sterol uptake" DLD1: D-lactate ferricytochrome C oxidoreductase/ CST6: ATF/CREB activator
CAGL0F00110g/ CAGL0F00187g CAGL0M00132g/ CAGL0M00154g
pseudogene/ YMR319c FET4 YIR019c STA1/ YNL268w LYP1
CG212
Intergenic (985028, 984957)
CG216
Intergenic(17038)
CG210
Intergenic (15400)
Plus Plus
Plus Plus
FLO1, FLO5: confer cellecell adhesion (flocculation) in S.cerevisae. In Candida glabrata (EPA genes) confer adhesion to mammalian host tissues Pseudogene/YMR319c FET4 Low-affinity Fe(II) transporter of the plasma membrane STA1: encodes an extracellular glucoamylase, activated by the Swi/Snf complex./LYP1:Lysine permease
Plus
Plus Plus
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
CG213-215
Minus
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
incubation time for the metabolic assay with XTT was increased to 1.5 h. Each experiment included 4e8 biological replicates. Cell adherence was expressed as a percentage of that of the wildtype strain. Differences between means of cell adherence were determined by the two-tailed paired t-test ( p < 0.001). 3. Results 3.1. Identification of biofilm mutants Using a library of insertional mutants of C. glabrata (Cormack et al., 1999), we had previously identified mutant strains with altered ability to form biofilms (Iraqui et al., 2005). These mutants were classified into two phenotypic groups named Biofilm and Biofilmþþ, determined by a decreased or an increased level of adherence, respectively. Using a subset of four mutant strains, we identified four genes (RIF1, SIR4, EPA6 and YAK1) involved in biofilm formation. Here we report the characterization of another subset of insertional mutant strains. The results obtained are presented in Table 3. A total of 43 Biofilm mutant strains were analyzed. For five strains, we were unable to recover any plasmid and consequently could not identify the insertion site. Eventually, we identified 15 different regions of insertion, 8 of them associated with a Biofilm phenotype and 7 associated with a Biofilmþþ phenotype. Twelve of these insertions were located in intergenic regions, whereas 3 were intragenic insertions (Table 3). Although C. glabrata does not produce true hyphae, we found that several of the Biofilm mutant strains had insertions close to genes related to hyphal development or virulence Table 3 List of the positions of the insertion sites obtained from biofilm mutant strains. Strain name
Insertion site (position)
Locus
CG202, CG203
Intergenic (42412)
CG204
Intergenic (345992)
CG207
Intergenic (541040)
CG124, CG201 CG205 CG208 CG200, CG123, CG126 CG206
Intergenic (898047, 897723) Intragenic (292286) Intragenic (567716) Intragenic (476654, 472286, 473362) Intergenic (472487)
CAGL0C04367g/ CAGL0C04389g CAGL0E03674g/ CAGL0E03718g CAGL0F05335g/ CAGL0F05357g CAGL0F09075g/ CAGL0F09097g CAGL0A02816g CAGL0G05896g CAGL0B04895g
CG219-234, CG136 CG209
Intergenic (149947149931, 150101) Intergenic (375046)
CG217, CG218
Intergenic (489948, 489296) Intergenic (845785)
CG212 CG213-215 CG216
Intergenic (985028, 984957) Intergenic (17038)
CAGL0A04829g/ CAGLOA04851g CAGL0J01551r/ CAGL0J01595g CAGL0I04224g/ CAGL0I04246g CAGL0I05148g/ CAGL0I05170g CAGL0I08657r/ CAGL0I08679r CAGL0I10147g/ CAGL0I10200g CAGL0F00110g/ CAGL0F00187g
301
in C. albicans. In three mutant strains (CG200, CG123 and CG126), the plasmid was inserted close to the CAGL0B04895g ORF that is orthologous to the C. albicans RFX2 gene regulating DNA-damage responses, morphogenesis, virulence and adherence (Hao et al., 2009). The CG124 and CG201 mutant strains contained an insertion upstream of the CAGL0F09075g ORF that encodes the Sch9p protein kinase also required for cell growth, filamentation and virulence in C. albicans (Liu et al., 2010). In addition, the insertion present in the CG207 strain was located near CAGL0F05357g, a locus that encodes a protein similar to Ume6p, a key transcriptional regulator involved in hyphal extension, virulence and biofilm dispersion in C. albicans (Banerjee et al., 2008; Uppuluri et al., 2010). Comparison of proteomic profiles of C. glabrata in the planktonic and biofilm modes of growth recently revealed that biofilm growth is associated with increased levels of stress response proteins and decreased amounts of glycolytic enzymes, which may potentially contribute to the high antifungal tolerance of C. glabrata biofilms (Seneviratne et al., 2010). Accordingly, some Biofilm mutant strains had insertions mapping close to or within a gene encoding a protein induced by osmotic or oxidative stress or glucose metabolism. CG205 had an insertion located within the CAGL0A02816g gene, similar to YPR1, a gene coding an aldo-ketoreductase that is rapidly induced by osmotic and oxidative stress in yeast (Ford and Ellis, 2002). CG206 had an insertion within the CAGL0A04829g gene that encodes a hexokinase isoenzyme that catalyzes phosphorylation of glucose in the cytosol. Two different insertion sites identified in Biofilmþþ mutants were located close to tRNA genes. Interestingly, the insertion located downstream of CAGL0J01551r that encodes tRNA-Val (AAC) was found in 6 mutants (CG219 to CG224). Another insertion (CG212 strain) was located between tRNAArg (CAGL0I08657r) and tRNA-Ser (CAGL0I08679r). tRNA genes have been shown to be involved in blocking the spreading of silencing in the yeast S. cerevisiae (Donze et al., 1999). A tRNAThr gene located adjacent to the silenced HMR locus blocks the spreading of silencing, and deleting this gene leads to increased spreading of Sir-mediated silencing similar to the observations in S. pombe (Haldar and Kamakaka, 2006). Three Biofilmþþ mutants (CG213 to CG215) had insertion sites between the EPA-like genes CAGL0I10147g and CAGL0I10200g that are located in regions immediately adjacent to the telomeres, where they are normally transcriptionally silenced. Another important group of Biofilm mutant strains presented insertions within or close to genes encoding chromatin structure elements or potential regulators consistent with the role of chromatin structure in biofilm formation. Mutant strains CG202 and CG203 had an insertion site located close to the gene CAGL0C04389g encoding a core histone protein (HTB1, HTB2), required for chromatin assembly (Wallis et al., 1980). We focused our interest on two groups of mutants. The first group was represented by two mutant strains (CG217 and CG218) with plasmid insertions downstream of the 30 UTR
302
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
region of the CAGL0I05170g gene. This ORF encodes a protein similar to S. cerevisiae Cst6p, a basic leucine zipper (bZIP) transcription factor of the ATF/CREB family involved in chromosome stability and telomere maintenance (Ouspenski et al., 1999). The second group of mutants was represented by three strains (CG204, CG209 and CG210) with insertion sites close to genes encoding proteins with functions related to the chromatin remodelling Swi/Snf complex (SNF6, STA1 and RAD54). This highly conserved protein complex is involved in the remodelling of chromatin structure, thus regulating the expression of a large number of genes (Martens and Winston, 2003). 3.2. Cst6p regulates biofilm formation and modulates EPA6 gene expression independently of the Yak1p/Sir4p signalling pathway To assess whether CST6 regulates biofilm formation in C. glabrata, we constructed a cst6D deletion mutant by gene replacement and we tested its ability to form biofilms. As expected, the cst6D strain presented a 3- to 4-fold increased ability to form biofilms as compared to the wild-type strain (Fig. 1a). Nevertheless, biofilm formation by the cst6D strain remained lower than that of the previously isolated sir4D mutant (Fig. 1a; Iraqui et al., 2005). EPA6 has been shown to encode the main adhesin involved in biofilm development in C. glabrata and its transcription is altered in yak1-1 and sir4D biofilm mutants (Iraqui et al., 2005) Therefore, we tested whether EPA6 expression was also affected in the cst6D mutant. When the mutant strains were grown in the same medium as those used for biofilm production, a more than 2fold increase in EPA6 expression was observed in the cst6D mutant strain as compared to original strain (Fig. 1b). These results showed that Cst6p is a negative regulator of biofilm formation and EPA6 expression. In order to determine whether Cst6p acts in a Yak1pdependent or independent pathway, we constructed two independent cst6D yak1-1 double mutant strains. We then assessed their biofilm phenotypes. As shown in Fig. 1c, the cst6D yak11 double mutants presented a strong Biofilm phenotype. Consistently, we were unable to detect EPA6 expression by using semi-quantitative RT-PCR in the cst6D yak1-1 mutants (data not shown). The sir4D yak1-1 mutant displayed a Biofilmþþ phenotype associated with a strong EPA6 expression level, suggesting that Yak1p regulation of biofilm formation was dependent on Sir4p and on the integrity of the subtelomeric silencing machinery (Iraqui et al., 2005). The present results suggest that Yak1p and Cst6p control EPA6 expression, and consequently biofilm formation, independently in C. glabrata. 3.3. The Swi/Snf complex regulates biofilm formation in C. glabrata As previously mentioned, three strains presented insertion sites close to genes encoding proteins with a function related to the chromatin remodelling Swi/Snf complex. We were thus
Fig. 1. CST6 affects biofilm formation in C. glabrata. (a) Biofilm formation was measured using a XTT reduction assay in wild-type BG2, sir4D and cst6D strains. 100% activity corresponds to the amount of XTT reduced by the original strain (BG2). The reported values are the means SD of three independent experiments. (b) Transcription of EPA6 assessed by RT-qPCR in wild-type BG2, sir4D and cst6D strains. Values were normalized according to the ACT1 gene and EPA6 expression in wild-type BG2 was normalized to 1.00. (c) Biofilm formation was measured by XTT reduction assay in wild-type BG2, yak1-1, cst6D and cst6D yak1-1 strains. 100% Ac correspond to the amount of XTT reduced by the parent strain (BG2). The reported values are the means SD of three independent experiments.
interested in determining the role of the Swi/Snf complex in biofilm development. The Swi/Snf nucleosome-remodelling complex activates transcription by remodelling nucleosomes. It was first identified in the yeast S. cerevisiae and is a large complex that contains at least 11 distinct polypeptides (Cairns et al., 1994). Cross-linking of the Swi/Snf complex to DNA occurs mostly via the Snf2p and Snf6p subunits. These two components are critical for the direct interaction of the Swi/ Snf complex with the nucleosome (Sengupta et al., 2001). We thus constructed SNF6 and SNF2 disruption mutants and analyzed them for their ability to form biofilms and to express the adhesin-encoding gene EPA6. As shown in Fig. 2a, biofilm
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
303
presented a growth defect (data not shown). Consistently, the snf6D sir4D and the snf6D yak1-1 double mutants grew less well than the sir4D and the yak1D strains, respectively (data not shown). In synthetic complete medium (SC), the snf2D (doubling time ¼ 2.35 h) and snf6D (doubling time ¼ 2.2 h) mutants displayed a 2-fold reduction in growth rate compared to the parent strain (doubling time ¼ 1 h) (Fig. 2c). We thus questioned whether the stage of the cells during planktonic growth could influence biofilm formation in microtiter plates. snf6D Cells were recovered at different stages of the growth curve and tested for their ability to form biofilms. In contrast to what has been published for the wild-type strain (Iraqui et al., 2005), the ability of the snf6D strain to form biofilms decreased as this strain was progressing through the stationary phase of growth (Fig. 3a). However, biofilm formation by the snf6D strain was always reduced relative to the wild-type strain. Consistently, EPA6 transcription was reduced by 94 0.7% in the snf6D mutant at all times except at 10 h of growth, when EPA6 expression peaked at 42 3.5% of the wild-type (Fig. 3b). In contrast, the snf2D mutant showed an average reduction of 90 2% compared to the wild-type strain and this level remained stable from 8 to 24 h of growth (Fig. 3b).
Fig. 2. SNF2 and SNF6 are required for biofilm formation in C. glabrata. (a) Biofilm formation was measured using a XTT reduction assay in wild-type BG2, snf2D and snf6D strains. 100% activity corresponds to the amount of XTT reduced by the parent strain (BG2). The reported values are the means SD of three independent experiments. (b) Transcription of EPA6 assessed by RT-qPCR in wild-type BG2, snf2D and snf6D strains. (c) Growth defect of C. glabrata strains associated with SNF2 and SNF6 disruptions. Cells were grown on liquid SC þ Ura þ 0.2% glucose.- BG2; :snf6D; C snf2D.
production of the snf2D and snf6D mutant strains was 3e5% and 20e25% of that of the wild-type strain, respectively. EPA6 expression in the snf2D and snf6D deletion mutants was determined by RT-qPCR on RNA extracted from cells grown in the same medium as that used for biofilm production. The snf2D and the snf6D strains exhibited a 90%e95% reduction, respectively, in EPA6 expression compared to the wild-type strain (Fig. 2b). The low levels of EPA6 transcription observed in the snf mutant strains correlated with their reduced ability to develop a biofilm. Planktonic growth of mutants affected in the Yak1/Sir pathway or in the Swi/Snf function was compared. After 48 h of growth on solid rich medium (YPD), the sir4D and yak1-1 mutants exhibited growth similar to that of the wild-type strain, whereas both snf2D and snf6D mutant strains
Fig. 3. Impact of the growth stage on biofilm formation and EPA6 transcription. (a) Biofilm formation by the snf6D mutant according to the stage of growth. Cells were recovered by centrifugation at different stages of growth along the growth curve. Cell concentration was adjusted to 0D600 ¼ 1 in fresh medium and cells were tested for biofilm formation as described in Materials and methods. Results were compared to those obtained with the wild-type strain after 24 h of growth (100%). (b) EPA6 expression according to the stage of growth in snf2D (grey) and snf6D (white) mutant strains as compared to strain BG2 (black).
304
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
3.4. The Swi/Snf complex modulates EPA6 expression in a Sir4p-dependent manner Transcription of the adhesin-encoding gene EPA6 has been reported to be regulated via the Yak1/Sir signalling pathway (Iraqui et al., 2005). We next wanted to investigate whether the Swi/Snf complex acts in the same pathway as SIR3 and SIR4 or functions independently. For this purpose, we constructed two independent sir4D snf6D double deletion mutants. We assessed their biofilm phenotypes and determined EPA6 expression levels in the cells grown under biofilm growth conditions. Both mutants showed increased cell adherence relative to the wildtype strain despite reduced ability to form biofilm relative to a sir4D strain (Fig. 4a). Concordantly, the expression of EPA6 was similar in the sir4D and sir4D snf6D strains (Fig. 4b). We also constructed two independent snf6D yak1-1 double mutant strains. These strains showed a biofilm defect similar to that of the snf6D and yak1-1 strains (Fig. 4b), although assays to measure the very low expression of EPA6 in this background were unsuccessful, with results being too poorly reproducible (data not shown). Overall, these results suggest that the Swi/Snf complex contributes to the process of biofilm formation in a manner dependent on the integrity of the Sir complex. 3.5. The Swi/Snf complex does not regulate expression of EPA1 in the same way as EPA6 The EPA6 gene belongs to a large family of genes almost all of which are located close to or within subtelomeric
Fig. 4. The Swi/Snf complex modulates EPA6 expression in a Sir4p-dependent manner. (a) Biofilm formation was measured using a XTT reduction assay in wild-type BG2, snf6D, sir4D, sir4D snf6D, yak1-1, and snf6D yak1-1 strains. 100% activity corresponds to the amount of XTT reduced by the parent strain (BG2). Reported values are the means SD of three independent experiments. (b) Transcription of EPA6 assessed by RT-qPCR in wild-type BG2, sir4D and cst6D strains. Values were normalized according to the ACT1 gene.
regions. Historically, the first member identified in this family was named EPA1 and encodes a protein involved in adhesion to host cells (Cormack et al., 1999). We analyzed the expression of EPA1 in the snf2D and snf6D mutant strains at different stages of growth. In the BG2 wild-type strain, as anticipated, we observed EPA1 expression only at the earliest times of growth (1 h and 3 h, Fig. 5) (Cormack et al., 1999). Surprisingly, at that stage, expression of EPA1 was stronger in the snf2D and snf6D mutant strains. After 6 h of growth, EPA1 expression became barely detectable in the mutant strains, and could not be detected in the wild-type strain. This pattern of expression contrasted with that observed for EPA6 (Fig. 3b) suggesting that Swi/Snf regulation of the EPA genes is genespecific in C. glabrata. 4. Discussion We had previously demonstrated that Epa6p is required for biofilm formation in C. glabrata (Iraqui et al., 2005). We also showed that the Yak1p kinase regulates the expression of EPA6 and that this regulation is dependent on the presence of the intact subtelomeric silencing machinery. Here we have identified new C. glabrata genes for which an insertional mutation in the coding region or in its vicinity results in a defect in biofilm formation. Further to this, we have extended our study to investigate the role of the Cst6p transcription factor and the Swi/Snf complex in biofilm formation by C. glabrata. First, we have shown that a protein similar to S. cerevisiae Cst6p, a basic leucine zipper (bZIP) transcription factor of the ATF/CREB family involved in chromosome stability and telomere maintenance (Ouspenski et al., 1999), is involved in the control of biofilm formation by C. glabrata. Our results demonstrated that deletion of CST6 in C. glabrata affects biofilm formation. We showed that the transcription factor is a negative regulator of the adhesin-encoding gene EPA6. Moreover, phenotypic analysis of the cst6D yak1-1 double mutant suggested that Cst6p regulates EPA6 expression and consequently biofilm formation independently of the Yak1p/
Fig. 5. Expression of EPA1 in Swi/Snf mutant strains. EPA1 expression was measured in wild-type strain BG2 (black), snf2D mutant strain (grey) and snf6D mutant strain (white) according to growth stage. (:) BG2; (-) snf2D, () snf6D.
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
Sir4p signalling pathway. Although we have no information thus far regarding the pathway(s) in which Cst6p may be involved in regulating biofilm formation in C. glabrata, this protein was recently identified as a heat-responsive transcription factor in S. cerevisiae (Wu and Li, 2008). Interestingly, heat shock response proteins show elevated levels in C. glabrata biofilms (Seneviratne et al., 2010), suggesting possible overlap between these two types of regulatory modules in which Cst6p could act. We also identified three mutant strains with insertions close to genes encoding proteins with functions related to the Swi/ Snf chromatin remodelling complex, namely SNF6 that encodes a subunit of the Swi/Snf chromatin remodelling complex, RAD54 that encodes a DNA-dependent ATPase member of the Swi2/Snf2-like family and STA1 that encodes a glucoamylase and is activated by the Swi/Snf complex. Here we demonstrate that the Swi/Snf complex is involved in biofilm formation in C. glabrata. Indeed, snf2D and snf6D mutants presented a reduction in their growth rates, a decreased level of EPA6 expression compared to the wildtype strain and consequently decreased ability to form biofilm. Although the exact biochemical roles of all Swi/Snf components is not known, it has been shown that the conserved Swi1 and Snf5 proteins bind transcriptional activators in S. cerevisiae (Neely et al., 2002). Moreover, microarray studies have shown that the Swi/Snf complex regulates ca. 6% of all S. cerevisiae genes. As these genes are distributed throughout the genome, remodelling of the chromatin structure by the Swi/Snf complex appears to be sequenceindependent (Holstege et al., 1998; Sudarsanam et al., 2000). This complex can be targeted to promoters via its recruitment by transcription activators or repressors (Dimova et al., 1999; Peterson and Workman, 2000; Prochasson et al., 2003; Yudkovsky et al., 1999). Moreover, using reporter genes, it has been shown that the complex mediates silencing of genes located at telomeres (Dror and Winston, 2004). Therefore, in two phylogenetically related organisms such as S. cerevisiae and C. glabrata, the Swi/Snf complex can trigger transcriptional activation or repression at telomeres depending on the recruiting transcription factors. In our study, analysis of sir4D snf6D and snf6D yak1-1 double mutants suggested that the Swi/Snf complex modulates EPA6 expression in a Sir4pdependent manner. While we do not know whether this regulation is direct or indirect in C. glabrata, it has been recently shown that the Swi/Snf complex antagonizes Sir3p binding to minichromosomes in S. cerevisiae (Sinha et al., 2009). Although Sir3p clearly plays a role in the expression level of EPA6 (Castano et al., 2005; Iraqui et al., 2005), regulation of Sir3p binding to subtelomeric regions by the Swi/Snf complex in C. glabrata remains to be demonstrated. Similarly, in C. albicans the Swi/Snf complex is required for hyphal development and pathogenicity (Mao et al., 2006), but the direct target(s) of this complex are still unknown. Swi/Snf regulation of EPA6 appears specific, since the Swi/ Snf complex does not regulate expression of EPA1 in the same way as EPA6. Differential regulation of EPA genes by the different proteins of the subtelomeric silencing machinery has
305
already been reported. Indeed, it has been shown that most EPA genes located in subtelomeric regions are subject to negative regulation by Rap1 and the Sir proteins (Castano et al., 2005; De Las Penas et al., 2003; Iraqui et al., 2005). Nevertheless, whereas deletion of SIR4 results in overexpression of 37 genes, including subtelomerically located EPA genes (Ma et al., 2009), the absence of the yKu70/yKu80 heterodimer and of Rif1p has differential consequences on regulation of subtelomeric silencing at the different C. glabrata chromosomes (Rosas-Hernandez et al., 2008; Ramı´rezZavaleta et al., 2010). Therefore, although similar in structure, each subtelomeric region appears to be individually transcriptionally regulated. It was already known that the Swi/ Snf complex could modulate the structure of the chromatin to activate or repress transcription in eukaryotes. In C. glabrata, its action in remodelling repressive and active chromatin states at the EPA loci remains to be understood. The new regulators identified in the present work (Cst6p and the Swi/Snf complex) are in addition to a number of previously identified factors influencing the expression of EPA genes. Indeed, regulation of adhesion genes in C. glabrata appears very complex and different external signals have been demonstrated to alter EPA gene expression (Fig. 6). For instance, EPA6 is expressed during murine urinary tract infection, but remains silent in a systemic infection. Domergue et al. demonstrated that expression in the urinary tract is the result of nicotinic acid limitation in this host niche (Domergue et al., 2005). Those authors hypothesized that poor accessibility in nicotinic acid would result in a reduction of NADþ necessary for the activity of the Sir2p histone deacetylase (Domergue et al., 2005). More recently, it was demonstrated that EPA6 and EPA1, but not EPA7, are activated in the presence of two widely used preservatives (paraben and sorbic acid) (Mundy and Cormack, 2009). Those same authors also showed that hypoxic conditions induced EPA6 expression (Domergue et al., 2005; Mundy and Cormack, 2009). Finally, it was shown that biofilm conditions and high cell density were inducers of EPA6, whereas EPA1 was expressed mostly in the lag phase (De Las Penas et al., 2003; Iraqui et al., 2005). This complex regulation of adhesin genes in C. glabrata is
Fig. 6. Model for EPA6 regulation in C. glabrata.
306
M. Riera et al. / Research in Microbiology 163 (2012) 297e307
reminiscent of the highly complex regulation of S. cerevisiae FLO genes. Indeed, FLO11 is one of the genes regulated by the Swi/Snf complex. This gene is also regulated by transcription factors Flo8 and Mss11 and the cAMP signalling pathway (van Dyk et al., 2005). Similarly, in S. cerevisiae, regulation of FLO11 expression appears to be dependent on several factors acting directly or indirectly at the level of transcription (Octavio et al., 2009). An understanding of the regulation of expression of EPA genes will represent a major challenge in the future, as their adhesin gene products represent key elements in the regulation of C. glabrata interactions with the host. Acknowledgements We are very grateful to Brendan P. Cormack (John Hopkins University School of Medecine, Baltimore) for providing the insertional mutant library. This work was supported by a grant from the Institut Pasteur (PTR173). References Banerjee, M., Thompson, D.S., Lazzell, A., Carlisle, P.L., Pierce, C., Monteagudo, C., Lo´pez-Ribot, J.L., Kadosh, D., 2008. UME6, a novel filament-specific regulator of Candida albicans hyphal extension and virulence. Mol. Biol. Cell. 19, 1354e1365. Cairns, B.R., Kim, Y.-J., Sayre, M.H., Laurent, B.C., Kornberg, R.D., 1994. A multisubunit complex containing the SWI/ADR6, SWI2/SNF2, SWI3, SNF5, and SNF6 gene products isolated from yeast. Proc. Natl. Acad. Sci. U S A 91, 1950e1954. Castano, I., Pan, S.J., Zupancic, M., Hennequin, C., Dujon, B., Cormack, B.P., 2005. Telomere length control and transcriptional regulation of subtelomericadhesins in Candida glabrata. Mol. Microbiol. 55, 1246e1258. Chen, S.C., Tong, Z.S., Lee, O.C., Halliday, C., Playford, E.G., Widmer, F., Kong, F.R., Wu, C., Sorrell, T.C., 2008. Clinician response to Candida organisms in the urine of patients attending hospital. Eur. J. Clin. Microbiol. Infect. Dis. 27, 201e208. Coco, B.J., Bagg, J., Cross, L.J., Jose, A., Cross, J., Ramage, G., 2008. Mixed Candida albicans and Candida glabrata populations associated with the pathogenesis of denture stomatitis. Oral Microbiol. Immunol. 23, 377e383. Cormack, B.P., Ghori, N., Falkow, S., 1999. An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 285, 578e582. de Groot, P.W., Kraneveld, E.A., Yin, Q.Y., Dekker, H.L., Gross, U., Crielaard, W., de Koster, C.G., Bader, O., Klis, F.M., Weig, M., 2008. The cell wall of the human pathogen Candida glabrata: differential incorporation of novel adhesin-like wall proteins. Eukaryot. Cell 7, 1951e1964. De Las Penas, A., Pan, S.J., Castano, I., Alder, J., Cregg, R., Cormack, B.P., 2003. Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata are encoded in subtelomeric clusters and subject to RAP1- and SIR-dependent transcriptional silencing. Genes Dev. 17, 2245e2258. d’Enfert, C., 2009. Hidden killers: persistence of opportunistic fungal pathogens in the human host. Curr. Opin. Microbiol. 12, 358e364. Dimova, D., Nackerdien, Z., Furgeson, S., Eguchi, S., Osley, M.A., 1999. A role for transcriptional repressors in targeting the yeast Swi/Snf complex. Mol. Cell 4, 75e83. Domergue, R., Castan˜o, I., De Las Pen˜as, A., Zupancic, M., Lockatell, V., Hebel, J.R., Johnson, D., Cormack, B.P., 2005. Nicotinic acid limitation regulates silencing of Candida adhesins during UTI. Science 308, 866e870.
Donlan, R.M., Costerton, J.W., 2002. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin. Microbiol. Rev. 15, 167e193. Donze, D., Adams, C.R., Rine, J., Kamakaka, R.T., 1999. The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev. 13, 698e708. Dror, V., Winston, F., 2004. The Swi/Snf chromatin remodeling complex is required for ribosomal DNA and telomeric silencing in Saccharomyces cerevisiae. Mol. Cell. Biol. 24, 8227e8235. Fidel Jr., P.L., Cutright, J.L., Tait, L., Sobel, J.D., 1996. A murine model of Candida glabrata vaginitis. J. Infect. Dis. 173, 425e431. Fidel Jr., P.L., Vazquez, J.A., Sobel, J.D., 1999. Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans. Clin. Microbiol. Rev. 12, 80e96. Ford, G., Ellis, E.M., 2002. Characterization of Ypr1p from Saccharomyces cerevisiae as a 2-methylbutyraldehyde reductase. Yeast 19, 1087e1096. Frieman, M.B., McCaffery, J.M., Cormack, B.P., 2002. Modular domain structure in the Candida glabrata adhesin Epa1p, a beta1, 6glucan-crosslinked cell wall protein. Mol. Microbiol. 46, 479e492. Hao, B., Clancy, C.J., Cheng, S., Raman, S.B., Iczkowski, K.A., Nugyen, M.H., 2009. Candida albicans RFX2 encodes a DNA binding protein involved in DNA damage responses, morphogenesis, and virulence. Eukaryot. Cell 8, 627e639. Hajjeh, R.A., Sofair, A.N., Harrison, L.H., Lyon, G.M., ArthingtonSkaggs, B.A., Mirza, S.A., Phelan, M., Morgan, J., Lee-Yang, W., Ciblak, M.A., Benjamin, L.E., Sanza, L.T., Huie, S., Yeo, S.F., Brandt, M.E., Warnock, D.W., 2004. Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates collected from 1998 to 2000 in a population-based active surveillance program. J. Clin. Microbiol. 42, 1519e1527. Haldar, D., Kamakaka, R.T., 2006. tRNA genes as chromatin barriers. Nat. Struct. Mol. Biol. 13, 192e193. Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.I., Hengartner, C.J., Green, M.R., Golub, T.R., Lander, E.S., Young, R.A., 1998. Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95, 717e728. Iraqui, I., Garcia-Sanchez, S., Aubert, S., Dromer, F., Ghigo, J.M., d’Enfert, C., Janbon, G., 2005. The Yak1p kinase controls expression of adhesins and biofilm formation in Candida glabrata in a Sir4p-dependent pathway. Mol. Microbiol. 55, 1259e1271. Kauffman, C.A., Vazquez, J.A., Sobel, J.D., Gallis, H.A., McKinsey, D.S., Karchmer, A.W., Sugar, A.M., Sharkey, P.K., Wise, G.J., Mangi, R., Mosher, A., Lee, J.Y., Dismukes, W.E., 2000. Prospective multicenter surveillance study of funguria in hospitalized patients. The National Institute for Allergy and Infectious Diseases (NIAID) Mycoses study group. Clin. Infect. Dis. 30, 14e18. Kaur, R., Domergue, R., Zupancic, M.L., Cormack, B.P., 2005. A yeast by any other name: Candida glabrata and its interaction with the host. Curr. Opin. Microbiol. 8, 378e384. Kaur, R., Ma, B., Cormack, B.P., 2007. A family of glycosylphosphatidylinositol-linked aspartyl proteases is required for virulence of Candida glabrata. Proc. Natl. Acad. Sci. U S A 104, 7628e7633. Kraneveld, E.A., de Soet, J.J., Deng, D.M., Dekker, H.L., de Koster, C.G., Klis, F.M., Crielaard, W., de Groot, P.W., 2011. Identification and differential gene expression of adhesin-like wall proteins in Candida glabrata biofilms. Mycopathologia 172, 415e427. Kuwayama, H., Obara, S., Morio, T., Katoh, M., Urushihara, H., Tanaka, Y., 2002. PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Res. 30, E2. Liu, W., Zhao, J., Li, X., Li, Y., Jiang, L., 2010. The protein kinase CaSch9p is required for the cell growth, filamentation and virulence in the human fungal pathogen Candida albicans. FEMS Yeast Res. 10, 462e470. Malani, P.N., Bradley, S.F., Little, R.S., Kauffman, C.A., 2001. Trends in species causing fungaemia in a tertiary care medical centre over 12 years. Mycoses 44, 446e449. Ma, B., Pan, S.J., Domergue, R., Rigby, T., Whiteway, M., Johnson, D., Cormack, B.P., 2009. High-affinity transporters for NADþ precursors in Candida glabrata are regulated by Hst1 and induced in response to niacin limitation. Mol. Cell. Biol. 29, 4067e4079.
M. Riera et al. / Research in Microbiology 163 (2012) 297e307 Mao, X., Cao, F., Nie, X., Liu, H., Chen, J., 2006. The Swi/Snf chromatin remodeling complex is essential for hyphal development in Candida albicans. FEBS Lett. 580, 2615e2622. Martens, J.A., Winston, F., 2003. Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Curr. Opin. Genet. Dev. 2, 13136e13142. Mundy, R.D., Cormack, B., 2009. Expression of Candida glabrata adhesins after exposure to chemical preservatives. J. Infect. Dis. 199, 1891e1898. Neely, K.E., Hassan, A.H., Brown, C.E., Howe, L., Workman, J.L., 2002. Transcription activator interactions with multiple SWI/SNF subunits. Mol. Cell. Biol. 22, 1615e1625. Octavio, L.M., Gedeon, K., Maheshri, N., 2009. Epigenetic and conventional regulation is distributed among activators of FLO11 allowing tuning of population-level heterogeneity in its expression. PLoS Genet. 5, e1000673. Ouspenski, I.I., Elledge, S.J., Brinkley, B.R., 1999. New yeast genes important for chromosome integrity and segregation identified by dosage effects on genome stability. Nucleic Acids Res. 27, 3001e3008. Peterson, C.L., Workman, J.L., 2000. Promoter targeting and chromatin remodeling by the SWI/SNF complex. Curr. Opin. Genet. Dev. 10, 187e192. Prochasson, P., Neely, K.E., Hassan, A.H., Li, B., Workman, J.L., 2003. Targeting activity is required for SWI/SNF function in vivo and is accomplished through two partially redundant activator-interaction domains. Mol. Cell 12, 983e990. Ramage, G., Martinez, J.P., Lopez-Ribot, J.L., 2006. Candida biofilms on implanted biomaterials: a clinically significant problem. FEMS Yeast Res. 6, 979e986. Ramı´rez-Zavaleta, C.Y., Salas-Delgado, G.E., De Las Pen˜as, A., Castan˜o, I., 2010. Subtelomeric silencing of the MTL3 locus of Candida glabrata requires yKu70, yKu80, and Rif1 proteins. Eukaryot. Cell 9, 1602e1611. Riera, M., Moreno-Ruiz, E., Goyard, S., d’Enfert, C., Janbon, G., 2012. Biofilm formation studies in microtiter plate format. In: Brand, A.C., MacCallum, D.M. (Eds.), Host-Fungus Interactions. Humana Press Inc. Methods in Molecular Biology. Roetzer, A., Gabaldo´n, T., Schu¨ller, C., 2011. From Saccharomyces cerevisiae to Candida glabrata in a few easy steps: important adaptations for an opportunistic pathogen. FEMS Microbiol. Lett. 14, 1e9. Rosas-Hernandez, L.L., Juarez-Reyes, A., Arroyo-Helguera, O.E., De Las Penas, A., Pan, S.J., Cormack, B.P., Castano, I., 2008. yKu70/yKu80 and
307
Rif1 regulate silencing differentially at telomeres in Candida glabrata. Eukaryot. Cell 7, 2168e2178. Seneviratne, C.J., Wang, Y., Jin, L., Abiko, Y., Samaranayake, L.P., 2010. Proteomics of drug resistance in Candida glabrata biofilms. Proteomics 10, 1444e1454. Sengupta, S.M., VanKanegan, M., Persinger, J., Logie, C., Cairns, B.R., Peterson, C.L., Bartholomew, B., 2001. The interactions of yeast SWI/SNF and RSC with the nucleosome before and after chromatin remodeling. J. Biol. Chem. 276, 12636e12644. Sherman, F., 1992. Getting started with yeast. In: Guthrie, c., Fink, G.R. (Eds.), 1992. Guide to Yeast Genetics and Molecular Biology, vol. 194. Academic Press, San Diego, CA, pp. 3e21. Sinha, M., Watanabe, S., Johnson, A., Moazed, D., Peterson, C.L., 2009. Recombinational repair within heterochromatin requires ATP-dependent chromatin remodeling. Cell 138, 1109e1121. Silva, S., Negri, M., Henriques, M., Oliveira, R., Williams, D.W., Azeredo, J., 2011. Adherence and biofilm formation of non-Candida albicans Candida species. Trends Microbiol. 19, 241e247. Sudarsanam, P., Iyer, V.R., Brown, P.O., Winston, F., 2000. Whole-genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U S A 97, 3364e3369. Uppuluri, P., Chaturvedi, A.K., Srinivasan, A., Banerjee, M., Ramasubramaniam, A.K., Ko¨hler, J.R., Kadosh, D., Lopez-Ribot, J.L., 2010. Dispersion as an important step in the Candida albicans biofilm developmental cycle. PLoS Pathog. 6, e1000828. van Dyk, D., Pretorius, I.S., Bauer, F.F., 2005. Mss11p is a central element of the regulatory network that controls FLO11 expression and invasive growth in Saccharomyces cerevisiae. Genetics 169, 91e106. Wallis, J.W., Hereford, L., Grunstein, M., 1980. Histone H2B genes of yeast encode two different proteins. Cell 3, 799e805. Weig, M., Jansch, L., Gross, U., De Koster, C.G., Klis, F.M., De Groot, P.W., 2004. Systematic identification in silico of covalently bound cell wall proteins and analysis of protein-polysaccharide linkages of the human pathogen Candida glabrata. Microbiology 150, 3129e3144. Wu, W.S., Li, W.H., 2008. Identifying gene regulatory modules of heat shock response in yeast. BMC Genomics 9, 439. Yudkovsky, N., Logie, C., Hahn, S., Peterson, C.L., 1999. Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators. Genes Dev. 13, 2369e2374.