New species of Torque Teno miniviruses infecting gorillas and chimpanzees

Virology 487 (2016) 207–214

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

New species of Torque Teno miniviruses infecting gorillas and chimpanzees$ Kristýna Hrazdilová a,b,n, Eva Slaninková a,c, Kristýna Brožová a,c, David Modrý b,c,e, Roman Vodička d, Vladimír Celer a,b a Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republic b CEITEC – Central European Institute of Technology, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republic c Department of Pathology and Parasitology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republic d The Prague Zoological Garden, Prague 171 00, Czech Republic e Biology Centre, Institute of Parasitology, Czech Academy of Sciences, Branišovská 31, 37005 České Budějovice, Czech Republic

art ic l e i nf o

a b s t r a c t

Article history: Received 24 June 2015 Returned to author for revisions 12 October 2015 Accepted 15 October 2015

Anelloviridae family is comprised of small, non-enveloped viruses of various genome lengths, high sequence diversity, sharing the same genome organization. Infections and co-infections by different genotypes in humans are ubiquitous. Related viruses were described in number of mammalian hosts, but very limited data are available from the closest human relatives – great apes and non-human primates. Here we report the 100% prevalence determined by semi-nested PCR from fecal samples of 16 captive primate species. Only the Mandrillus sphinx, showed the prevalence only 8%. We describe three new species of gorillas' and four new species of chimpanzees' Betatorqueviruses and their co-infections in one individual. This study is also first report and analysis of nearly full length TTMV genomes infecting gorillas. Our attempts to sequence the complete genomes of anelloviruses from host feces invariably failed. Broader usage of blood /tissue material is necessary to understand the diversity and interspecies transmission of anelloviruses. & 2015 Elsevier Inc. All rights reserved.

Keywords: Anellovirus Torque Teno mini virus Great apes Non-human primates Genome sequence

Introduction Despite the 18 years from the first description of anellovirus in primate species – humans, very little is known about their origin and limited data are available from the closest human relatives – great apes and non-human primates. First member of new, currently unassigned family Anelloviridae was described in 1997 in Japanese patient with acute post transfusion hepatitis and was named human TTV (following the TT initials of index case patient, lately termed Torque Teno virus) (Nishizawa et al., 1997). TTV is a small, non-enveloped virus carrying negative, single-stranded DNA genome of approximate length of 3.8 kb (Mushahwar et al., ☆ The GenBank accession number for the Cpz1cl1 sequence is KT027935, for the Cpz1cl2 sequence is KT027936, for the Cpz2cl1 sequence is KT027937, for the Cpz2cl2 sequence is KT027938, for the GorF sequence is KT027939, for the GorMcl3 sequence is KT027940, and for the GorMcl4 sequence is KT027941. n Corresponding author at: Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno 612 42, Czech Republic. Tel.: þ 420 604 214 439. E-mail address: [email protected] (K. Hrazdilová).

http://dx.doi.org/10.1016/j.virol.2015.10.016 0042-6822/& 2015 Elsevier Inc. All rights reserved.

1999). Subsequently shorter analogs sharing the same genome organization were described in humans - TTV-like mini virus (TTMV) (Takahashi et al., 2000) with the genome length of about 2.9 kB and lately torque teno midi virus (TTMDV) with genome length of about 3.2 kb (Jones et al., 2005). All anelloviruses share the genomic organization with three overlapping open reading frames (ORF1 to 3) and short GC rich sequence in the most conserved untranslated region. The expression profile of anelloviruses is not fully characterized, but the work of Qiu et al. shows that following transfection of human 293 cells at least 6 TTV proteins were produced by alternative splicing of three different mRNAs (Qiu et al., 2005). Further molecular characterization of anelloviruses as gene expression and protein functions remains poorly understood. In humans, prevalence up to 100% and dual or triple infection by different species was published (Hussain et al., 2012; Ninomiya et al., 2008; Pinho‐Nascimento and Leite, 2011), however so far without apparent association with any disease. TTV analogues were first detected in farm animals, New World monkeys, macaques and chimpanzees (Cong et al., 2000; Leary et al., 1999; Okamoto et al., 2000a; Verschoor et al., 1999). Later authors

208

K. Hrazdilová et al. / Virology 487 (2016) 207–214

(Kapusinszky et al., 2015; Thom et al., 2003) confirmed the presence of anelloviruses in great apes other than chimpanzees (gorillas and orangutans) and Old World monkeys (drills, mandrills, mangabeys and African green monkeys). Beside complex work on Chlorocebus sabaeus (Kapusinszky et al., 2015), only short parts of genome (mostly from conserved untranslated region) from sera samples were detected and analyzed. The reported genome sizes in non-primate animals are in general smaller than for the human variants ranging from 2019 nt in cats to 2878 nt in pigs (Biagini et al., 2007; Inami et al., 2000; Ng et al., 2009b; Okamoto et al., 2002, 2001, 2000a, 2000b; Van den Brand et al., 2012). Besides humans, chimpanzees are so far the only reported hosts infected by anelloviruses of various genome lengths (assigned to genera Alphatorquevirus, Betatorquevirus and Gammatorquevirus). In this study, we examined presence and determined prevalence of TTV-like viruses in fecal samples of 17different African primate species in Czech and Slovak zoos. We also described almost full length genomes of two different species of TTMV coinfecting wild-born, captive living gorilla male and one captive born gorilla female and also coding sequences from two captive born chimpanzees. We reported TTV-like virus infection and prevalence in all 17 studied African primate species and first characterized gorilla's analogue of TTMV. The elucidation of host range and characterization of genome sequences of TTV-like viruses contribute to understanding of origin, evolution, and interspecies transmission potential of anelloviruses.

Results To establish the prevalence of anelloviruses of captive African non-human primate species in 12 Czech and one Slovak zoos, fecal samples were collected. In total 153 samples from 17 different species were screened using semi-nested PCR for anellovirus detection from which 136 samples were positive. The prevalence rates range from 75 to 100% in all tested species (Table 1) with the only exception of Mandrillus sphinx where only single sample from 12 was positive (8.3%). Specificity of PCR reaction was confirmed by sequencing of 35 randomly chosen amplification products from representative primate species. Nucleotide sequence analysis showed high variability out of the primer binding sites and Table 1 Anellovirus prevalence in NHP species based on semi-nested PCR targeting the conserved UTR; species in which anelloviruses were described for the first time are in bold. +/all

%

Gorilla gorilla Pan troglodytes Thercopithecus gelada Mandrillus sphinx

10/10 25/25 5/5 1/12

100.0 100.0 100.0 8.3

Papio anubis Papio hamadryas

4/4 18/18

100.0 100.0

Chlorocebus sabaeus

13/13

100.0

Colobus guereza Colobus angolensis

10/12 6/6

83.3 100.0

Erythrocebus patas Lophocebus aterrimus

9/10 4/4

90.0 100.0

Cercopithecus Cercopithecus Cercopithecus Cercopithecus

4/4 8/9 6/8 2/2

100.0 88.9 75.0 100.0

5/5 6/6

100.0 100.0

campbelli diana neglectus mitis

Miopithecus ogouensis Macaca sylvanus

Prevalence at the genus level

100.0

88.9

87.0

confirmed common co-infection by several annellovirus species in one individual (Supplementary file 1). The DNA extracted from the whole blood/serum samples of fourteen NHPs was also used for the detection of anelloviruses by nested PCR. Except one guereza sample, all other tested DNAs were anellovirus positive. Using this DNA as template, the entire genomic sequence of anelloviruses from only 4 samples could be amplified by PCR with the further described inverted primers. The strongest PCR signal of anellovirus genome was found to be approx. 2.8–2.9 kb in size (in two gorillas’ and two chimpanzees’ samples), weaker signal was also detected in approx. size of 4 kb in some samples. Remaining nine blood/serum samples did not provide any PCR product in whole genome amplification. The 2.8– 2.9 kb PCR product for each sample was molecularly cloned and seven TTV clones (GorF; GorM-cl3 and cl4; CPZ1-cl1 and cl2; and CPZ2-cl1 and cl2) were sequenced over the entire coding part of the genome. Missing UTR part between primers was amplified and sequenced for both clones of GorM and one clone of GorF samples resulting in first almost complete gorilla infecting anellovirus genomes. According to the genome length and phylogenetic analysis ( Fig. 2, Supplementary file 2) all newly described anelloviruses infecting gorillas and chimpanzees were classified to the genus Betatorquevirus. Gorilla TTMV Anelloviruses infecting gorillas share the common genome length and structure including UTR as most conserved region, GC rich region and major ORF (so called ORF1 coding putative capsid protein) spanning 1992 nt, 1995 nt and 2025 nt respectively. The nearly full length gorillas' TTMV genomes were obtained due to difficulties to sequence the GC rich part of anellovirus' genomes. The length of obtained sequences was 2851 nt for GorM cl3, 2856 nt for GorM cl4 and 2568 nt for GorF, which corresponds to the length of anellovirus mini genomes wihout GC rich domain in humans and other primates. The three genomes displayed overall organization of anelloviruses, with main ORFs in the same orientation; nevertheless they differed in the number of these major ORFs. Transcribed region of the genomes encompassed TATA-box (TATAA) which was recognized 100–160 bp before the start codon of the first ORF and ended by polyadenylation signal (ATAAA) detected 110–120 nt following stop codon of ORF3 protein. The complete sequence of GC rich region was not obtained for technical reasons. Anyway 40 nt long fragment of GC rich stretch identified in GorM cl3 genome had the GC content of 84%. The largest ORF was 1992 nt, 2025 nt and 1995 nt long in GorM cl3, GorM cl4 and GorF respectively. Based on the similarity with other known anelloviruses, ORF1 is most likely coding putative nucleocapsid protein. The similarity of ORF1s is ranging from 53 to 65% at nucleotide and from 38 to 54% at amino acid level (Table 2). All of them also contained nuclear localization signals detected by both cNLS Mapper (Kosugi et al., 2009) and NLStradamus (Nguyen et al., 2009). Arginine rich region at the beginning of ORF1 gene was also found ranging from 22 to 25 arginine residues in first 50 amino acids. ORF2 partially overlapped the ORF1 and resulted in 348 nt (GorM cl3 and GorF), and 342 nt (GorM cl4) long reading frames. TTV/CAVcommon motif WX7HX3CXCX5H described previously (Jazaeri Farsani et al., 2013; Takahashi et al., 2000), was found in the ORF2 of the new gorilla TTMV described here (CX7HX3CXCX5H) at the amino acid positions 25–45 of GorM cl4, 19–39 of GorF and degenerated in one position to the sequence CX7HX3RXCX5H in positions 22–42 of GorM cl3. Finally, ORF3 overlapping with 3' terminus of ORF1 was found in GorM cl3 (495 nt) and GorF (504 nt) genomes only. In agreement with previously described sequences, in both cases the ORF3

K. Hrazdilová et al. / Virology 487 (2016) 207–214

71 |

209

160 |

TTV Human-1 Human-2 Human-3 Human-4 Human-5

CVOS TATA box 5’TRCACWKMCGAATGGCTGAGTTT GGGTCTACGTCCTC ATATAA GTAAG TACACTTCCGAATGGCTGAGTTT ........A....A ...... ....C .G..................... T.........G..G ...... AGCG. .G..................... T.TC..C.CA.TGA ...... .C..C AG.GG.GA.......TA...... T...T...A..... ...... C...C .G.....................

CPZ-1 CPZ-3 Macaque

..A...T.CCGGC. ...... C..GC .G..................... -ATGC.............AC.GAG--------GAGG..CT.CCGC-CGA.CG T...T..T.AAACT ...... C.G.C .G..................... -ATGC................GAGC.T----TGA.GG.A.CCC.A-CGG.CG ...AAA.G.G-.CA ...... .CCG. AG..................... -.T.C.C.GA.-A.....GC.A.G.CG--AACCG.G.A.CCT.GTGAG.G..

TTMDV Human Human CPZ

.A.A..TTTA.ACT ...... C.... .GT...GA............... -A..C...TA.-A..GT..A.A..CCGGATCGAG.G.A.C.--.GGAGGTCT .A..TAC.AAA.CT ...... ....C ......GA............... -A..C...TA.-A..GT..A.G..CCGGATCGAG.G.A.C.--.GGAGGTC. .A..T.CAC.TTCT ...... C...C AG..................... T..GC...TT.-A..GT....A.C.C--AACGAG...A.C.--.GGAGAG..

TTMV Human Human CPZ

.A.A.ACAC.A-CT ...A.. C.... ......GA............... -AT......A.-A..G..AC------------GG..ACACCAC.G-TGG..G .TTCTACACAA-GT .....G C.... ....................... -ATGC....A.-A..A..GA------------AG..TCACTTT.G-TGA.TG .A.C.A.TCAT-CT .....T TC..C .G..................... -ATGC...TA.-A..G..A.------------AAG.TA.TC.C.G-AC.A..

3’ -TCCACGCCCGTCCGCAGCGGTGAAG-------CCACGGAGGGA--GATCAC -...............G...AGA.CA-------..........G--AG..CG -.T.................AGATC.-------.G...C...AG--CGATCG -.TTC...............AG..C.------CGAG..C..C..G-CGG.CG -...............G.A.AG..G--------......CA.CG--....CG

GorillaM3 T..CT.TTACTTCT ...... C...C ......GA............... -ATGC....A.-A..G...T.AA..C--AACTAG.G.A.C.T-.GGCGGACT GorillaM4 CAAC.A.ACC--CT ...... C...C .......A............... -ATGC...TA.-A..G..A.------------AA...A.CA.C.G--C.GCG 161 |

CVOA 5’ 3’TCAGWTCCCCGTTAAGCCCGA TTTACACACCGA- AGTCAAGGGGCAATTCGGGCT ............- ....................A ...........C- ..................... ...........C- ..................... ............- .....................

254 |

TTV Human-1 Human-2 Human-3 Human-4 Human-5

CVIA 3’CCCGCCCWCGGCYTCCAC-TC CGCG---TCCCGA GGGCGGGTGCCGAAGGTG-AG ....---.....T ..................-.. A...---...... ............G.....-.. A...---A....T .......A..........-.. AA..---...T.. ............G.....-..

CPZ-1 CPZ-3 Macaque

....TCG...... ........A..CG.....-.. ............- G..T................. .............-.................T AC..-CG...... ........A..CG.....-.. ............- G..T................. .............-.................T .T..GCCG....T ...............CG.G.. G..TAC.C...CG ....................A A.-.G.G.T.TC.G.GACC.............

TTMDV Human Human CPZ

.CG.-CTG...AT .......A...CG.....-.. .GA.AC......- G...T................ A.-.G.A.T.TA.C.GA.C.......AAA..T .CG.-CTG...A. .......A...CG.....-.. .GA.AC......- G...T................ A.-.G.A.T.TA.C.GA.C.......AAA..T TC..-CAG.AGCT .......A....G.....-.. .GA.AC.....T- ....T...............G GC-TG.A.T.TA.C.GA.C.......AAA..T

TTMV Human Human CPZ

.CG.-CTGAT.TT .......A..........-.. .GA.AC......- ....T................ A.-AT.A.T.T..C.GACC.......AAA..T .AGA-CTGAT.TT .......A..........-.. .GA.AC.....T- ....T................ A.-AT.A.T.T..C.GA.C.......AAA..T TT..-CTGT..CT ..................-.. .GA.AC......- ..................... G.-...A.T.TA.C.GA.C.......AAA..T

5’ CGGGACTGGCCGG-GCTATGGGCAAGGCTCTG ..........T..-.................T .............-.................T .............-............A....T .A...........-...T.............T

GorillaM3 TCA.-CTGAG.CT ..........T.T.....-.. .GA.AC......- ....T................ G.-CGAA.T.T..A.GA.C.......AAA..T GorillaM4 TT..-CTG..AC. ........A...-.....-.. .GA.AC.....-- ..................... GA-.G.A.T.TA.C.GA.C.......AAA..T Fig. 1. Sequence alignment showing highly conserved UTR region of anelloviruses of humans (TTVs: AF351132, AF261761, AY823988, AB064599, AJ620228, TTMDVs: AB303561, AB303555; TTMVs: AB038628, AB038629) and nonhuman primates (TTV chimpanzee: AB041957, AB049607, macaque: AB041959; TTMDV chimpanzee: AB449064; TTMV chimpanzee AB041963). Conserved regions and primers locations are indicated in boxes. Dot: sequence identity with prototype TTV sequence; dash: gap introduced.

starts by alternative start codon GTG coding valine instead of standard ATG coding methionine. The carboxy-terminus of this putative protein contains a serine-rich tract (15, respective 14 Ser from last 18 amino acids) preceded by a cluster of basic amino acids (R and K) capable of generating different phosphorylation sites (Asabe et al., 2001; Takahashi et al., 2000). Corresponding coding region in GorM cl4 sequence spans only 180 nucleotides coding for 60 aminoacids. Chimpanzee TTMV Coding part of the chimpanzee anellovirus genomes was sequenced in total of four strains originating from two animals. The length of sequenced regions was 2487–2577 nt and three major open reading frames were identified in all of them. The longest ORF, designated as ORF1, corresponds by the length (1773–2007 nt) and relative position to putative nucleocapsid protein gene identified in anelloviruses with the only exception of CPZ2 cl2 sample where the premature stop codon forms the 1350 nt long ORF thus lacking the C-terminus of coded protein. The similarity of chimpanzees' ORF1s is ranging from 53 to 68% at nucleotide level and from 39 to 60% at amino acid level (Table 2).

The arginine rich region was also recognized in three of four isolates in expected extent (22–25R/50 amino acids), CPZ1 cl2 lacks the first 79 codons (237 nt) compared to cl1 isolated from the same animal. ORF2, partially overlapping 5'end of the ORF1, was detected in all four isolates in length ranging from 309 to 345 nt. The conserved motif WX7HX3CXCX5H was found in three isolates (missing in CPZ1 cl2) also in conserved position from 19 to 39 amino acid. ORF3 in chimpanzee isolates is in general shorter (ranging from 321 to 393 nt) than in above described gorillas' anelloviruses. Alternative start codon GTG is found in the only isolate CPZ1 cl1, other uses the standard ATG. Serine-rich region preceded by basic amino acids is coded in three chimpanzee isolates, its absence in the CPZ2 cl1 might be caused by shortening of ORF1 of this clone.

Discussion The anelloviruses in Old World primates (incl. man) are further divided into 3 well defined monophyletic genera (Alphatorquevirus, Betatorquevirus and Gammatorquevirus, Fig. 2) clearly separated from the anelloviruses from other host species; our newly described

210

K. Hrazdilová et al. / Virology 487 (2016) 207–214

Fig. 2. Phylogenetic tree constructed by maximum likelihood method, based on nucleotide sequence of ORF1 coding region. Left part displays overall topology of Anelloviridae family, human gyrovirus sequences were used as an outgroup; full tree view is included in Supplementary file 2. Right part shows detail of Betatorquevirus genus clade; sequences are labeled by their ncbi accession numbers; those of non-human origin are marked by prefix (CPZ–Pan troglodytes). Newly described TTMVs of gorilla and chimpanzee origin are highlighted in red. Proportion of bootstrap values from 1000 replicates is shown.

Table 2 ORF1 sequence similarities (reverse p-distance) on nucleotide (bold) and amino acid level of newly described gorilla and chimpanzee species and their closest relatives (human TTMVs: AB038629, AB038630; chimpanzee TTMV: AB041963). GorM cl3 GorM cl3 GorM cl4 GorF CPZ1 cl1 CPZ1 cl2 CPZ2 cl1 CPZ2 cl2 AB038629 AB038630 AB041963

52.9 64.7 51.1 53.8 51.4 49.6 52.3 52.0 51.4

GorM cl4

GorF

CPZ1 cl1

CPZ1 cl2

CPZ2 cl1

CPZ2 cl2

AB038629

AB038630

AB041963

38.1

54.1 38.8

32.4 43.5 34.7

32.8 39.6 35.4 59.6

36.0 48.9 36.8 41.2 38.7

37.4 47.0 35.9 42.7 39.0 48.5

34.5 43.4 35.6 37.6 38.6 42.5 39.2

38.2 42.8 36.8 38.0 35.0 42.1 40.2 42.9

35.6 42.4 35.6 42.5 39.3 41.3 47.2 38.6 37.7

55.6 60.2 60.3 55.8 56.1 57.9 58.8 56.9

53.5 52.2 53.4 53.0 53.2 55.0 50.2

60.0 55.8 53.7 54.7 59.5 58.3

55.3 52.9 54.1 56.8 59.7

anelloviruses infecting gorillas and chimpanzees were classified to the genus Betatorquevirus. TTVs have been detected from a broad range of biological materials (serum or blood, feces, urine, saliva, semen, tears, and milk (Catroxo et al., 2008; Goto et al., 2000; Chan et al., 2001; Inami et al., 2000; Osiowy and Sauder, 2000; Saback et al., 1999), but invasive sampling of primates represents a challenge for safety and ethical reasons. In most cases, the feces are the only samples available. We collected 153 fecal samples from different simian species kept in Czech and Slovak zoos. Further 14 blood/ serum samples were obtained in the course of anesthesia for different reasons (transportation, routine health check, wound treatment etc.) of several animals nonrelated with sampling for virus detection. Our data represent the first report about prevalence of anelloviruses in 13 primate species (Table 1) and short sequences of UTR from 11 of these species (Supplementary file 1). The prevalence of anelloviruses in feces in most examined primate species reached

67.6 55.0 53.5 58.0

53.7 54.9 53.7

59.9 54.7

56.1

almost 100%, reflecting close contacts between captive animals combined with supposed oro-fecal route of virus transmission (Okamoto et al., 1998). The vertical transmission of anelloviruses among primates is improbable, given the negative results of Ninomiya et al. (2008). Interestingly, low (8%) prevalence was recorded in M. sphinx. Almost ubiquitous occurrence of studied viruses in blood/sera of captive primates examined in our study is comparable to published data reaching 80% in chimpanzees, 100% in orangutans, 63% in gibbons, 100% in mandrills and 100% in mangabeys (Thom et al., 2003). We identified TT viruses in fecal samples based on amplification of highly conserved UTR part of the virus genome and confirmed the results by sequencing. Several negative samples were re-assigned as positive after repeated DNA isolation/virus detection suggesting the 100% prevalence in all examined primate species with the exception of mandrills. Our attempts to classify

K. Hrazdilová et al. / Virology 487 (2016) 207–214

211

Fig. 3. Conserved motif WX7HX3CXCX5H in (A) anellovirus ORF2 sequences (for accession numbers see the Fig. 1 legend); (B) Chicken anemia virus and human gyroviruses; (C) herpesviruses of primate origin (ncbi accession numbers: human HV5 AY446894, panine HV2 AF480884, macacine HV3 NC_006150, macaque cytomegalovirus JN227533, cercopithecine HV5 NC_012783); residues of described conserved motif are shadowed and mark by star, additional conserved residues are in red.

212

K. Hrazdilová et al. / Virology 487 (2016) 207–214

detected viruses based on obtained UTRs failed, as the Blast analysis revealed range of hits with low scores, apparently caused by limited length of sequences and their high variability. Inconclusive results from UTRs sequence analysis and difficulties to amplify the whole virus genomes from fecal samples apparently prohibit further investigation of anelloviruses in fecal material. To amplify the whole virus genomes in blood/serum samples from gorillas and chimpanzees we used primers complementary to those for diagnostic purposes and obtained nearly full virus genomes excluding GC rich region. Similar strategy was used by Okamoto et al. also on non-human primate samples (Okamoto et al., 2000a). Blast analysis, ORF arrangement pattern and phylogenetic analysis proved that the identified sequences belong to anelloviruses and in fact are the first identified in gorillas. Estimated full size of these genomes (2700–3000 nt for gorillas' and 2500–2600 nt for chimpanzees' isolates) and phylogenetic analysis suggest their classification to Betatorquevirus genus, among so called TT mini viruses (Biagini et al., 2001; Takahashi et al., 2000). Following the International Committee on Taxonomy of Viruses (ICTV) guidelines (ICTV, 2013), setting up the parameters of new species to be 20–55% divergence in nucleotide sequence of ORF1, we assign all seven described viruses from gorillas and chimpanzees as new species (Table 2). In humans, co-infection of one individual by several different species of anelloviruses was described (Ninomiya et al., 2008; Pinho‐Nascimento and Leite, 2011) and seems to be common. Coinfection with at least two species was described also in pigs (Jarosova et al., 2011). Similarly, the co-infection seems to be common in great apes as we describe co-infections with two different species of anellovirus in gorillas and chimpanzees based on sequencing separate clones. For GorM individual four clones of long range PCR products were sequenced and two different species were detected (each twice) suggesting their equal presence in the sample. Analogous situation was with both chimpanzee samples tested. The longest ORF identified in gorillas and chimpanzees TTMV genomes share general characteristics of nucleoproteins of many ssDNA viruses, like size, nuclear localization signal and basic – arginine-rich region present at the N-terminal part of the protein. Our results support the data of Okamoto et al. (Okamoto et al., 2000a) describing the shorter arginine-rich region of ORF1 in shorter anelloviruses. In TTVs this region span is about 100 amino acids from N-terminus while in TTMVs just about half of this size. Two smaller ORFs (ORF2 and ORF3) are partially overlapping ORF1. In six of seven genomes of great apes' anellovirus described in this work, ORF2 coding sequence contains a previously described conserved motif WX7HX3CXCX5H (Andreoli et al., 2006; Takahashi et al., 2000). Using ScanProsite online search (De Castro et al., 2006) the same motif was recognized in all known types of anelloviruses (TTVs, TTMDVs and TTMVs) from all known host species (humans, pigs, cats, dogs, tamarins, douroucoulis, pine marten, tupaias, seals etc.) and also in recently described, distantly related sea turtle tornovirus ORF2 (Ng et al., 2009a) (Fig. 3A). Besides anelloviruses, this motif was already described in VP2 proteins of chicken anemia virus and human gyrovirus (Gia Phan et al., 2013; Phan et al., 2012) (Fig. 3B). The same motif was also recognized in two copies in proteins coded by genes US1, US31 and US32 of human herpesvirus 5, macacine herpesvirus 3cynomolgus macaque cytomegalovirus, panine herpesvirus 2 and cercopithecine herpesvirus 5 (Fig. 3C). In non-viral sequences the motif was recognized in two PAS domain containing bacterial proteins and in Drosophila TIL domain containing protein (Marchler-Bauer et al., 2014). None of these findings give us a clue about possible function of the motif because it does not overlap with functional residues/parts of above mentioned proteins or their function is not known so far. Detailed analysis of the motif in different ORFs

shows a different degree of conservation especially of the first tryptophan residue in humans' anelloviruses regardless their genome length. In chimpanzees and gorillas isolates we found several other conserved positions in and around the described motif (Fig. 3A), but due to limited number of available sequences we can specify only one more residue in a motif to WX7H(A/D) X2CXCX5H for human and great apes anelloviruses. The shortening of ORF3 in one of the gorillas TT virus genomes and the absence of standard ATG start codon was already observed in several human TTMV isolates and indicate that this virus gene might be nonfunctional (Biagini et al., 2001). Our attempts to sequence the complete genomes of anelloviruses from host feces invariably failed. On the contrary, the examination of limited set of blood/sera from captive great apes revealed the presence of 7 new TTMV species. Eighteen years after the description of first human anellovirus, our knowledge on diversity of these viruses in primates is extremely limited, which contrasts with almost ubiquitous presence as revealed by detection in feces. Blood samples are routinely collected (and stored) from captive primates as part of health monitoring and disease diagnostics and also the free ranging primates are occassionally sampled. Broader usage of available blood or tissue material offers a unique opportunity to study the diversity and interspecies transmission of anelloviruses, as well as their zoonotic potential.

Materials and methods Samples A total of 153 fecal samples from 17 different species (Table 1) of African primates from Czech and Slovak zoos were collected during 2012 and stored in RNAlaters at  20 °C. Two samples of whole, frozen blood of Cercopithecus campbelli and one sample of whole, frozen blood of G. gorilla from Czech zoos were available. Stated gorilla individual is a male, wild born in 1972 in Cameroon living from approx. the age of one year in captivity in different zoos in Europe, mainly in Czech Republic (Sample GorM). Eleven samples of frozen serum samples obtained during routine examination of animals from different ZOOs were available from three different gorillas (including sample GorF), two chimpanzees (samples labeled CPZ1 and CPZ2), three samples of Colobus guereza, one sample of Macaca sylvanus and two samples from orangutans. Nucleic acid extraction DNA from feces samples was extracted from solid fraction of 1.5 ml feces suspension in RNAlaters by PSPs Spin Stool DNA Kit (Stratec Molecular, Germany) according to manufacturer's instructions, eluted by total volume of 150 ml of elution buffer. DNA from blood/serum samples was extracted from 100 ml of blood/ serum diluted by 100 ml of PBS buffer using NucleoSpins Blood kit (Macherey-Nagel, Germany) following manufacturer's instructions, eluted by 2  50 ml of elution buffer. Anellovirus DNA detection Primers (CVOS, CVOA, CVIA) as well as PCR conditions for seminested PCR co-amplifying 95 nt long fragments from UTR of TTVs and/or TTMVs (Fig. 1) were adopted from study of distribution of these viruses in humans and nonhuman primates (Thom et al., 2003). The universality of primers was tested based on currently available sequences of primate TTVs, TTMDVs and TTMVs in database as shown in Fig. 1. Amplification was done by Combi PPP Master Mix (Top-Bio, Czech Republic). PCR products were

K. Hrazdilová et al. / Virology 487 (2016) 207–214

visualized on a 2% agarose gel stained with GelRedTM (Biotium, Hayward, CA). In order to confirm specificity of PCR reaction, randomly chosen amplification products from representative host species were sequenced.

213

Czech Republic [Grant numbers CZ.1.07/2.3.00/20.0300 and CZ.1.07/2.3.00/30.0014].

Acknowledgments Whole genome amplification To determine the full-length nucleotide sequence of anellovirus genomes, inverted primers to those used for detection were designed. Amplification was done using LA DNA polymerases mix (Top-Bio, Czech Republic). In the first round of the PCR (in total volume of 25 ml), 1 ml of blood extracted DNA was amplified using primers CVOSrc and CVIArc (CVOSrc 5ʹ-AAACTCAGCCATTCGKMWGTGYA-3ʹ, CVIArc 5ʹGGGCGGGWGCCGRAGGTGAG-3ʹ). One microliter of this reaction was carried over to a second round and amplified using primers CVOSrc and CVOArc (CVOArc 5ʹ-AGTCWAGGGGCAATTCGGGCT-3ʹ). Amplification conditions were 94 °C/20 s, 52 °C/30 s, and 68 °C/5 min for 30 cycles, with an additional 10 min extension at 68 °C. To amplify missing sequence in between CVOSrc and CVOArc, specific primers for each isolate were designed, and used for the first round of the PCR, the second round was performed using CVOS and CVOA primers. Amplification was done by Combi PPP Master Mix (Top-Bio, Czech Republic) under conditions 95 °C/30 s, 50 °C/20, 72 °C/45 s for 30 cycles, with additional 5 min extension at 72 °C. PCR products were visualized on a 1% agarose gel stained by GelRedTM. Molecular cloning and sequencing of TTV and TTMV DNA PCR products chosen for sequencing were cut out of the gel, purified using QIAquick Gel Extraction Kit (Qiagen, Germany), ligated into pGEM-T Easy Vector (Promega Corp., Madison, WI) and cloned according to manufacturer´s instructions. Plasmid DNA was purified by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich, St.Louis, MO). Cloned DNA was sequenced by Macrogen capillary sequencing services (Macrogen Europe, The Netherlands) using primers specific to T7promoter and/or SP6 promoter vector sequences. For sequencing of the whole genome of gorilla TTMV, internal primers for sequencing were designed using primer walking approach. Analysis of nucleotide and amino acid sequences Sequence analysis was performed by CLC Sequence viewer (Qiagen, Germany). Multiple sequence alignment of UTRs was performed by Clustal W (Larkin et al., 2007). Multiple sequence alignments of ORF1 were generated by Clustal Omega (McWilliam et al., 2013), p-distances were computed using PAUP software version 4b.10 (Swofford, 2003). Best evolution model was chosen based on Akaike information criterion computed by R software (R Development Core Team, 2008) and phylogenetic trees were constructed by the maximum likelihood method (Felsenstein, 1981) using GTR model considering a fraction of nucleotides to be invariable (þ I), and assigning each site a probability to belong to given rate categories (þ G) by PhyML 3.0 software (Guindon et al., 2010). The reliability of the phylogenetic results was assessed using 1000 bootstrap replicates (Felsenstein, 1985).

Funding This work was supported by project of Internal Grant Agency of University of Veterinary and Pharmaceutical Sciences Brno [Grant number IGA VFU 42/2013/FVL]; by the project "CEITEC – Central European Institute of Technology" [Grant number CZ.1.05/1.100/ 02.0068] from European Regional Development Fund and further co-financed from European Social Fund and State Budget of the

This work could not arise without kind cooperation of all 12 Czech and one Slovak ZOOs, namely ZOO Brno, Děčín, Dvůr Králové, Hodonín, Jihlava, Košice, Lešná, Liberec, Olomouc, Ostrava, Plzeň, Praha, and Ústí nad Labem graciously coordinated by Dr. Klára J. Petrželková.

Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.virol.2015.10.016.

References Andreoli, E., Maggi, F., Pistello, M., Meschi, S., Vatteroni, M., Nelli, L.C., Bendinelli, M., 2006. Small Anellovirus in hepatitis C patients and healthy controls. Emerg. Infect. Dis. 12, 1175–1176. http://dx.doi.org/10.3201/eid1207.060234. Asabe, S., Nishizawa, T., Iwanari, H., Okamoto, H., 2001. Phosphorylation of serinerich protein encoded by open reading frame 3 of the TT virus genome. Biochem. Biophys. Res. Commun. 286, 298–304. http://dx.doi.org/10.1006/ bbrc.2001.5385. Biagini, P., Gallian, P., Attoui, H., Touinssi, M., Cantaloube, J., de Micco, P., de Lamballerie, X., 2001. Genetic analysis of full-length genomes and subgenomic sequences of TT virus-like mini virus human isolates. J. Gen. Virol. 82, 379–383. Biagini, P., Uch, R., Belhouchet, M., Attoui, H., Cantaloube, J.-F., Brisbarre, N., de Micco, P., 2007. Circular genomes related to anelloviruses identified in human and animal samples by using combined rolling-circle amplification/sequenceindependent single primer approach. J. Gen. Virol. 88, 3–4. http://dx.doi.org/ 10.1099/vir.0.83071-0. Catroxo, M.H.B., Nishiya, a, Sabino, E., Teixeira, P.S., Petrella, S., Milanelo, L., Vieira, J. C., Diaz, R.S., 2008. Research of Torque teno virus (TTV) in serum and total blood of Brazilian non-human primates and in chicken plasma (Gallus gallus domesticus) by the PCR N22 region. Int. J. Morphol. 26, 377–384. http://dx.doi. org/10.4067/S0717-95022008000200020. Cong, M.E., Nichols, B., Dou, X.G., Spelbring, J.E., Krawczynski, K., Fields, H. a, Khudyakov, Y.E., 2000. Related TT viruses in chimpanzees. Virology 274, 343–355. http://dx.doi.org/10.1006/viro.2000.0471. De Castro, E., Sigrist, C.J. a, Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucl. Acids Res. 34, 362–365. http://dx.doi.org/10.1093/nar/gkl124. Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17, 368–376. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution (N.Y.) 39, 783–791. Gia Phan, T., Phung Vo, N., Sdiri-Loulizi, K., Aouni, M., Pothier, P., Ambert-Balay, K., Deng, X., Delwart, E., 2013. Divergent gyroviruses in the feces of Tunisian children. Virology 446, 346–348. http://dx.doi.org/10.1016/j.virol.2013.08.020. Goto, K., Sugiyama, K., Ando, T., Mizutani, F., Terabe, K., Tanaka, K., Nishiyama, M., Wada, Y., 2000. Detection rates of TT virus DNA in serum of umbilical cord blood, breast milk and saliva. Tohoku J. Exp. Med. 191, 203–207. Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. http://dx.doi. org/10.1093/sysbio/syq010. Hussain, T., Manzoor, S., Waheed, Y., Tariq, H., Hanif, K., 2012. Phylogenetic analysis of Torque Teno virus genome from Pakistani isolate and incidence of coinfection among HBV/HCV infected patients. Virol. J. 9, 1. http://dx.doi.org/ 10.1186/1743-422X-9-320. Chan, P.K., Tam, W.H., Yeo, W., Cheung, J.L., Zhong, S., Cheng, A.F., 2001. High carriage rate of TT virus in the cervices of pregnant women. Clin. Infect. Dis. 32, 1376–1377. http://dx.doi.org/10.1097/00006454-200109000-00023. ICTV [WWW Document], 2013. URL 〈http://ictvonline.org/virusTaxonomy.asp〉. Inami, T., Obara, T., Moriyama, M., Arakawa, Y., Abe, K., 2000. Full-length nucleotide sequence of a simian TT virus isolate obtained from a chimpanzee: evidence for a new TT virus-like species. Virology 277, 330–335. http://dx.doi.org/10.1006/ viro.2000.0621. Jarosova, V., Pogranichniy, R., Celer, V., 2011. Prevalence and age distribution of porcine torque teno sus virus (TTSuV) in the Czech Republic. Folia Microbiol. (Praha) 56, 90–94. http://dx.doi.org/10.1007/s12223-011-0030-4. Jazaeri Farsani, S.M., Jebbink, M.F., Deijs, M., Canuti, M., van Dort, K.A., Bakker, M., Grady, B.P.X., Prins, M., van Hemert, F.J., Kootstra, N.A, van der Hoek, L., 2013.

214

K. Hrazdilová et al. / Virology 487 (2016) 207–214

Identification of a new genotype of Torque Teno mini virus. Virol. J. 10, 323. http://dx.doi.org/10.1186/1743-422X-10-323. Jones, M., Kapoor, A., Lukashov, V.V., Simmonds, P., Hecht, F., Delwart, E., 2005. New DNA viruses identified in patients with acute viral infection syndrome. J. Virol. 79, 8230–8236. http://dx.doi.org/10.1128/JVI.79.13.8230. Kapusinszky, B., Mulvaney, U., Jasinska, A.J., Deng, X., Freimer, N., Delwart, E., 2015. Local virus extinctions following a host population bottleneck. J. Virol. 89, 8152–8161. http://dx.doi.org/10.1128/JVI.00671-15. Kosugi, S., Hasebe, M., Tomita, M., Yanagawa, H., 2009. Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc. Natl. Acad. Sci. USA 106, 10171–10176. http://dx.doi. org/10.1073/pnas.0900604106. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and clustal X version 2.0. Bioinformatics, 23; , pp. 2947–2948. http://dx.doi.org/10.1093/bioinformatics/btm404. Leary, T.P., Erker, J.C., Chalmers, M.L., Desai, S.M., Mushahwar, I.K., 1999. Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals. J. Gen. Virol. 80 (Pt. 8), 2115–2120. Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., Bryant, S.H., 2014. CDD: NCBI’s conserved domain database. Nucl. Acids Res. 43, D222–D226. http://dx.doi.org/10.1093/nar/gku1221. McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Buso, N., Cowley, A.P., Lopez, R., 2013. Analysis tool web services from the EMBL-EBI. Nucl. Acids Res. 41, 597–600. http://dx.doi.org/10.1093/nar/gkt376. Mushahwar, I.K., Erker, J.C., Muerhoff, A.S., Leary, T.P., Simons, J.N., Birkenmeyer, L. G., Chalmers, M.L., Pilot-Matias, T.J., Dexai, S.M., 1999. Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proc. Natl. Acad. Sci. USA 96, 3177–3182. Ng, T.F.F., Manire, C., Borrowman, K., Langer, T., Ehrhart, L., Breitbart, M., 2009a. Discovery of a novel single-stranded DNA virus from a sea turtle fibropapilloma by using viral metagenomics. J. Virol. 83, 2500–2509. http://dx.doi.org/10.1128/ JVI.01946-08. Ng, T.F.F., Suedmeyer, W.K., Wheeler, E., Gulland, F., Breitbart, M., 2009b. Novel anellovirus discovered from a mortality event of captive California sea lions. J. Gen. Virol. 90, 1256–1261. http://dx.doi.org/10.1099/vir.0.008987-0. Nguyen Ba, A.N., Pogoutse, A., Provart, N., Moses, A.M., 2009. NLStradamus: a simple hidden Markov model for nuclear localization signal prediction. BMC Bioinf. 10, 202. http://dx.doi.org/10.1186/1471-2105-10-202. Ninomiya, M., Takahashi, M., Nishizawa, T., Shimosegawa, T., Okamoto, H., 2008. Development of PCR assays with nested primers specific for differential detection of three human anelloviruses and early acquisition of dual or triple infection during infancy. J. Clin. Microbiol. 46, 507–514. http://dx.doi.org/ 10.1128/JCM.01703-07. Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y., Mayumi, M., 1997. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem. Biophys. Res. Commun. 241, 92–97. http://dx.doi.org/10.1006/bbrc.1997.7765.

Okamoto, H., Akahane, Y., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y., Mayumi, M., 1998. Fecal excretion of a nonenveloped DNA virus (TTV) associated with posttransfusion non-A-G hepatitis. J. Med. Virol. 56, 128–132. Okamoto, H., Fukuda, M., Tawara, a, Nishizawa, T., Itoh, Y., Hayasaka, I., Tsuda, F., Tanaka, T., Miyakawa, Y., Mayumi, M., 2000a. Species-specific TT viruses and cross-species infection in nonhuman primates. J. Virol. 74, 1132–1139. Okamoto, H., Nishizawa, T., Takahashi, M., Tawara, A., Peng, Y., Kishimoto, J., Wang, Y., 2001. Genomic and evolutionary characterization of TT virus (TTV) in tupaias and comparison with species-specific TTVs in humans and non-human primates. J. Gen. Virol. 82, 2041–2050. Okamoto, H., Nishizawa, T., Tawara, a, Peng, Y., Takahashi, M., Kishimoto, J., Tanaka, T., Miyakawa, Y., Mayumi, M., 2000b. Species-specific TT viruses in humans and nonhuman primates and their phylogenetic relatedness. Virology 277, 368–378. http://dx.doi.org/10.1006/viro.2000.0588. Okamoto, H., Takahashi, M., Nishizawa, T., Tawara, A., Fukai, K., Muramatsu, U., Naito, Y., Yoshikawa, A., 2002. Genomic characterization of TT viruses (TTVs) in pigs, cats and dogs and their relatedness with species-specific TTVs in primates and tupaias. J. Gen. Virol. 83, 1291–1297. Osiowy, C., Sauder, C., 2000. Detection of TT virus in human hair and skin. Hepatol. Res. 16, 155–162. Phan, T.G., Li, L., O’Ryan, M.G., Cortes, H., Mamani, N., Bonkoungou, I.J.O., Wang, C., Leutenegger, C.M., Delwart, E., 2012. A third gyrovirus species in human faeces. J. Gen. Virol. 93, 1356–1361. http://dx.doi.org/10.1099/vir.0.041731-0. Pinho‐Nascimento, C., Leite, J., 2011. Torque teno virus in fecal samples of patients with gastroenteritis: prevalence, genogroups distribution, and viral load. J. Med. Virol. 1111, 1107–1111. http://dx.doi.org/10.1002/jmv. Qiu, J., Kakkola, L., Cheng, F., 2005. Human circovirus TT virus genotype 6 expresses six proteins following transfection of a full-length clone. J. Virol. 79, 6505–6510. http://dx.doi.org/10.1128/JVI.79.10.6505. Saback, F.L., Gomes, S. a, De Paula, V.S., Da Silva, R.R.S., Lewis-Ximenez, L.L., Niel, C., 1999. Age-specific prevalence and transmission of TT virus. J. Med. Virol. 59, 318–322. http://dx.doi.org/10.1002/(SICI)1096-9071(199911)59:3 o 318:: AID-JMV104 3.0.CO;2-Q. Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods) Version 4. Takahashi, K., Iwasa, Y., Hijikata, M., Mishiro, S., 2000. Identification of a new human DNA virus (TTV-like mini virus, TLMV) intermediately related to TT virus and chicken anemia virus. Arch. Virol. 145, 979–993. Thom, K., Morrison, C., Lewis, J.C., Simmonds, P., 2003. Distribution of TT virus (TTV), TTV-like minivirus, and related viruses in humans and nonhuman primates. Virology 306, 324–333. http://dx.doi.org/10.1016/S0042-6822(02) 00049-1. Van den Brand, J.M.A., van Leeuwen, M., Schapendonk, C.M., Simon, J.H., Haagmans, B.L., Osterhaus, A.D.M.E., Smits, S.L., 2012. Metagenomic analysis of the viral flora of pine marten and European badger feces. J. Virol. 86, 2360–2365. http: //dx.doi.org/10.1128/JVI.06373-11. Verschoor, E.J., Langenhuijzen, S., Heeney, J.L., 1999. TT viruses (TTV) of non-human primates and their relationship to the human TTV genotypes. J. Gen. Virol. 80 (Pt. 9), 2491–2499.