- Email: [email protected]
Newly identified PcToll4 regulates antimicrobial peptide expression in intestine of red swamp crayfish Procambarus clarkii
Gene 610 (2017) 140–147
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Newly identified PcToll4 regulates antimicrobial peptide expression in intestine of red swamp crayfish Procambarus clarkii Ying Huang a, Tingting Li a, Min Jin c, Shaowu Yin a,b, Kai-Min Hui a,⁎, Qian Ren a,b,⁎ a b c
Jiangsu Key Laboratory for Biodiversity & Biotechnology, Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, Nanjing 210046, China Co-Innovation Center for Marine Bio-Industry Technology of Jiangsu Province, Lianyungang, Jiangsu 222005, China State Key Laboratory Breeding Base of Marine Genetic Resource, Third Institute of Oceanography, SOA, Xiamen 361005, China
a r t i c l e
i n f o
Article history: Received 29 December 2016 Received in revised form 22 January 2017 Accepted 13 February 2017 Available online 16 February 2017 Keywords: Procambarus clarkii WSSV Toll-like receptor Anti-lipopolysaccharide factor RNAi Overexpression
a b s t r a c t Tolls or Toll-like receptors (TLRs) have an essential role in initiating innate immune responses against pathogens. In this study, a novel Toll gene, PcToll4, was first identified from the intestinal transcriptome of the freshwater crayfish, Procambarus clarkii. The PcToll4 cDNA is 4849 bp long with a 3036 bp open reading frame that encodes a 1011-amino acid protein. PcToll4 contains a signal peptide, 13 LRR domains, 3 LRR TYP domains, 2 LRR CT domains, an LRR NT domain, a transmembrane region, and a TIR domain. Quantitative RT-PCR analysis revealed that PcToll4 mRNA was detected in all tested tissues, and the expression of PcToll4 in the intestine was significantly upregulated after white spot syndrome virus (WSSV) challenge. Overexpression of PcToll4 in Drosophila Schneider 2 (S2) cells activates the antimicrobial peptides (AMPs) of Drosophila, including metchnikowin, drosomycin, attacin A, and shrimp Penaeidin-4. Results of RNA interference by siRNA also showed that PcToll4 regulates the expressions of 5 anti-lipopolysaccharide factors (ALFs) in the intestine of crayfish. Our findings suggest that PcToll4 is important for the innate immune responses of P. clarkii because this gene regulates the expressions of AMPs against WSSV. © 2017 Published by Elsevier B.V.
1. Introduction The freshwater crayfish, Procambarus clarkii, is one of the most important commercial species extensively distributed in China (Liang et al., 2010). Similar to other invertebrates, crayfish lack an adaptive immune system and mainly rely on their innate immune responses to resist pathogen invasion (Soderhall and Thornqvist, 1997). The innate immune system is the first line of the host defense against invading pathogens, especially in invertebrates, and is conserved throughout evolution (Medzhitov and Janeway, 2000). Upon infection, the specific molecular motifs known as pathogen-associated molecular patterns Abbreviations: TLR, Toll-like receptor; LRR, leucine-rich repeat; LRR TYP, Leucine-rich repeats, typical (most populated) subfamily; LRR CT, Leucine rich repeat C-terminal; LRR NT, Leucine rich repeat N-terminal; WSSV, white spot syndrome virus; S2, Drosophila Schneider 2; AMP, antimicrobial peptide; LPS, lipopolysaccharides; PGN, peptidoglycan; dsRNA, double-stranded RNA; GLU, β-glucans; PRR, pattern recognition receptor; TM, transmembrane; TIR, intracellular Toll/interleukin-1 receptor; NF-κB, nuclear factor– kappa B; ALF, anti-lipopolysaccharide factor; EST, expressed sequence tag; PBS, phosphate buffer saline; RNAi, RNA interference; qRT-PCR, quantitative real-time PCR; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; S. E, standard error; SDM, serumfree medium; PEN4, Penaeidin-4; Mtk, metchnikowin; Drs, drosomycin; Atta, attacin A; UTR, untranslated region; aa, amino acids. ⁎ Corresponding authors at: College of Life Sciences, Nanjing Normal University, Nanjing 210046, China. E-mail addresses: [email protected] (K.-M. Hui), [email protected] (Q. Ren).
http://dx.doi.org/10.1016/j.gene.2017.02.018 0378-1119/© 2017 Published by Elsevier B.V.
(PAMPs), such as lipopolysaccharides (LPS), peptidoglycan (PGN), double-stranded RNA (dsRNA), and β-glucans (GLU) of microbes, are directly recognized by germ-line receptors called pattern recognition receptors (PRRs) (Janeway and Medzhitov, 2002). The recognition process activates multiple signaling pathways, thereby resulting in rapid and effective cellular and humoral defenses (Smale, 2012). Toll or Toll-like receptors (TLRs) are the most extensively studied PRRs, which play a fundamental role in pathogen recognition and activation of the innate immunity (Akira et al., 2006; Yang et al., 2008). Tolls/TLRs are type I integral membrane glycoproteins that are characterized by their domain organization. Tolls and TLRs contain an ectodomain, which encompasses leucine-rich repeats (LRRs), a transmembrane domain, and an intracellular Toll/interleukin-1 receptor (TIR) domain required for downstream signal transduction (Bowie and O′Neill, 2000). Toll, the founding member of TLRs, was originally identified in Drosophila melanogaster (called dToll) and was proven involved in the development of embryonic dorsoventral polarity in D. melanogaster (Anderson and Nüsslein-Volhard, 1983). The role of dToll in the antifungal and antibacterial responses of flies was later identified (Rutschmann et al., 2002). At present, a large number of Tolls/TLRs from vertebrates to invertebrates are widely investigated (Coscia et al., 2011). Multiple Tolls are also found in shrimp or crayfish, including 1 Toll receptor from Penaeus monodon (Arts et al., 2007), Marsupenaeus japonicus (Mekata et al., 2008), and Macrobrachium rosenbergii (Srisuk et al., 2014), 3 Tolls from Litopenaeus vannamei
Y. Huang et al. / Gene 610 (2017) 140–147
(Wang et al., 2012; Yang et al., 2007), and 1 Toll from Fenneropenaeus chinensis (Yang et al., 2008) and P. clarkii (Wang et al., 2015). Toll receptors of invertebrates induce their innate immune responses (Kawai and Akira, 2011). Signal pathway activation leads to the translocation of the nuclear factor–kappa B (NF-κB) into the nucleus, which finally induces the expression of immune effector molecules such as antimicrobial peptides (AMPs) (Lemaitre and Hoffmann, 2007). AMPs, one of the major components of the invertebrate immune system, function as the front line of host defenses against microbial infection and have a broad spectrum of antimicrobial activities against bacteria, fungi, parasites, and viruses (Hancock et al., 2006; Silva et al., 2013). The major crustacean AMPs are represented by three cationic peptide families: penaeidins, crustins, and anti-lipopolysaccharide factors (ALFs) (Tassanakajon et al., 2010). ALFs represent a family of basic proteins of around 100 amino acids, which bind and neutralize the activity of LPS (Morita et al., 1985). They mediate the degranulation of hemocytes and activate the intracellular coagulation cascade (Morita et al., 1985). The first ALF, LALF, was isolated from the hemocytes of the horseshoe crab Limulus polyphemus and has a strong antibacterial effect on gram-negative R-type bacteria (Tanaka et al., 1982; Warren et al., 1992). N 100 ALF sequences were reported in shrimps, lobsters, crayfish, and crabs (Supungul et al., 2004; Beale et al., 2008; Zhang et al., 2010; Sun et al., 2011). Although distinct ALF isoforms usually coexist in one species, their similarities are low (Li et al., 2013). These isoforms are regulated by different signal pathways and exhibit different expression patterns in response to bacterial or viral infection. However, the transcriptional levels of most identified ALFs in crustaceans are usually upregulated, thereby suggesting that ALFs have important roles in the defense against bacterial and viral pathogens (Li et al., 2014). In this study, a novel invertebrate Toll PcToll4 was identified from P. clarkii. Its transcription can be induced by white spot syndrome virus (WSSV) challenge, and the five ALF expressions were regulated by PcToll4. Our study reveals the role of PcToll4 in the innate immunity of the red swamp crayfish.
2. Materials and methods 2.1. Identification of PcToll4 and ALF genes and sequence analysis An expressed sequence tag (EST) in P. clarkii that is similar to the Toll gene and 11 ESTs that are similar to ALF genes were obtained from the intestinal transcriptome data (unpublished). The 5′ and 3′ cDNA were synthesized following the instructions of Clontech SMARTer RACE cDNA Amplification Kit from Takara (Dalian, China) using 5′-CDS primer A, SMARTer IIA oligo, and 3′-CDS primer A. The following gene-specific forward and reverse primers were designed based on the EST: PcToll4-F and PcToll4-R (Table 1). A Clontech Advantage 2 PCR Kit from Takara (Dalian, China) was used for gene cloning. PCR reaction was conducted using the following conditions: 5 cycles at 94 °C for 30 s and 72 °C for 2 min; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 2 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min. The corresponding amplified fragments were subcloned into T3 vectors prior to the sequencing by TransGen Biotech (Beijing, China). Genomic DNA from the intestine of P. clarkii was isolated using NucleoSpin Tissue (Clontech). The full length of PcToll4 was obtained by overlapping the EST sequences and the 5′ and 3′ fragments. Three pairs of gene-specific primers (i.e., gPcALF1-F1, gPcALF1-R1; gPcALF1F2, gPcALF1-R2; gPcALF3-F, gPcALF3-R; gPcALF4-F1, gPcALF4-R1; and gPcALF4-F2, gPcALF4-R2) were designed based on the obtained cDNA sequences of PcALF1, PcALF3, and PcALF4 to clone the genomic sequences of PcALF1, PcALF3, and PcALF4 (see primer sequence in Table 1). The BLASTP algorithm at NCBI (http://www.ncbi.nlm.gov/blast) was used to search the homology of the protein sequences. Translations of cDNAs and predictions of the deduced amino acid sequences were conducted using ExPASy (http://www.au.expasy.org/). MEGA 5.05 was
141
Table 1 Primer sequences used in this study. Primers name
Sequences (5′-3′)
PcToll4-F PcToll4-R UPM Long Short 5′-CDS Primer A SMARTer II A oligo 3′-CDS primer A gPcALF1-F1 gPcALF1-R1 gPcALF1-F2 gPcALF1-R2 gPcALF3-F gPcALF3-R gPcALF4-F1 gPcALF4-R1 gPcALF4-F2 gPcALF4-R2 PcToll4-RT-F PcToll4-RT-R PcALF1-RT-F PcALF1-RT-R PcALF2-RT-F PcALF2-RT-R PcALF3-RT-F PcALF3-RT-R PcALF4-RT-F PcALF4-RT-R PcALF5-RT-F PcALF5-RT-R PcALF6-RT-F PcALF6-RT-R PcALF7-RT-F PcALF7-RT-R PcALF8-RT-F PcALF8-RT-R PcALF9-RT-F PcALF9-RT-R PcALF10-RT-F PcALF10-RT-R PcALF11-RT-F PcALF11-RT-R PcGAPDH-RT-F PcGAPDH-RT-R PcToll4-pAc-F PcToll4-pAc-R
GCCGAACCATTGTGATACTGTCGTCCA TGAAGGGTTGAAGTTGGATGTGGGAATG CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN GGTCTCCCCGGAGCTCATCAATCTCA CTATTGCTTGAGCCAAGCTGCAGC AGAGCCTCAGGCGTGGCCAGGTG CCCACCCAGTTTGTTGATGATGAGATTG ATGAAGTGGTCGGTGTTGGTGG CTAATTCTTTATCCAAGCTGAAG ATGTCAGCAGCGCCGTCAGG TCATCAAAGCCACGCTGATGCCTC ACACTGACTTGAGAATGGTCCAG CGTTGTCAGCGACGGTGGAGATG AGGAACAAGACGCTGACAAG TCACGGTAATGGAGACACAC CGAGAGGCTGTAGAGGATGC CCCAGTTTGTTGATGATGAG CGTGGGAGTGTTTGTGGTGGT TTGGACTGTAACTGTAGCGGC AGGTGTTGAAGATGAAGTGGT GCTTGTTGATAATGAGGGTGA CCAGATCATCTCCACCGTCG GTAGCCTTGAGCTTTTCCCA ATGGGGAGGTGAGGCTACT CCTTCCTGCTCGGTGATGA ACAAATGAACACAAGCCACCC TGATAAACCTGTCCTCCCAAC CCAGCCATTGCGGAAAAAC GGGGCACCACATGCGACCC GCGGAACGGTGAGGTGGAG TGATGAGGCCGGCTTGGAA AGTGGCGTCATACAGGAAGGGG CCAAAGGATGGCGAGAAATAGT AGAGAAGATCGCTCAACGCC CACACTCGCCCAAACAGACG CACTCTCTCGGCTTCCATCC GCTCCACCTCACCGTTCTTC CAATGTTCGTCTGTGGAGTGA GGAAGATGGGATGATGTTCTG CCCGGATCGGGGTACCATGGCAAGTACACCAAACCTCACAG TTCGAACCGCGGGCCCTCCTTCTCCCAGAACTTGGGATCA
X = undisclosed base in the proprietary SMARTer oligo sequence. N = A, C, G, or T; V = A, G, or C.
used to construct phylogenetic trees, and the neighbor-joining method was selected for phylogenetic analysis (Kumar et al., 2008). 2.2. Animal, virus, immune challenge, and tissue collection Adult P. clarkii (about 15 g each) were purchased from an aquatic product market in Nanjing, Jiangsu Province, China and were then cultured in fresh water in tanks at a temperature of 25 °C in a laboratory. PCR using WSSV-specific primers (5′-TATTGTCTCTCCTGACGTAC-3′ and 5′-CACATTCTTCACGAGTCTAC-3′) were conducted to ensure that the crayfish were WSSV-free prior to experimental infection. The WSSV inoculums used in this study were obtained from Zhejiang University. For the experimental group, WSSV (105 copies/mL, 100 μL/crayfish) was injected into the abdominal segment of the crayfish using a microliter syringe. For the control group, the crayfish were inoculated with 100 μl of PBS (0.14 M NaCl, 3 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4). At 0, 12, 24, 36, 48, 60, and 72 h post-injection, the intestine was randomly collected from the experimental and control groups. Hemolymph was collected from the crayfish ventral sinus by
142
Y. Huang et al. / Gene 610 (2017) 140–147
mixing with 1/10 volume of anticoagulant buffer (10% sodium citrate, pH 7.0), which contains 200 mM phenylthiourea as the melanization inhibitor. The mixture was immediately centrifuged at 800g at 4 °C for 10 min to isolate the hemocytes. Other tissues, such as heart, hepatopancreas, gills, stomach, and intestine, were also collected from the untreated crayfish for tissue distribution studies. 2.3. Synthesis of siRNAs The preparation of siRNA for PcToll4 was conducted following the procedure used in our previous study (Huang et al., 2014). Based on the sequence of PcToll4, the siRNA that specifically targets PcToll4 was synthesized in vitro using a commercial kit according to the manufacturer's instructions (Takara, Japan). The siRNAs used were the following: PcToll4-siRNA (5′-CCUGCUGACAGUACUCAAA-3′). The sequence of the siRNAs was scrambled to generate the following: control PcToll4-siRNA-scrambled (5′-CCGCAUCUGAACUAGUACA-3′). The formation of double-stranded RNAs was monitored by determining the size in agarose gel electrophoresis. The synthesized siRNAs were dissolved in siRNA buffer (50 mM Tris-HCl, 100 mM NaCl, pH 7.5) and quantified by spectrophotometry. 2.4. RNAi knock-down of PcToll4 in vivo followed by WSSV challenge RNA interference (RNAi) was performed to determine the involvement of the Toll pathway in regulating the expression of ALF genes. A syringe was used to inject 40 μg siRNA into the lateral area of the fourth abdominal segment of each P. clarkii. siRNA or siRNA-scrambled (20 μg) was injected into a volume of 100 μL per crayfish. At 16 h after injection, the siRNA or siRNA-scrambled (20 μg) and WSSV (105 copies/mL, 100 μL/crayfish) were co-injected into the same crayfish. WSSV (105 copies/mL, 100 μL/crayfish) alone was simultaneously included in the injections as a positive control. For each treatment, 20 crayfish were used. The intestine of the crayfish was collected at 24, 36, and 48 h after the last injection. 2.5. Total RNA isolation and cDNA synthesis The total RNA was isolated from the tissues using High-Purity Total RNA Rapid Extraction Kit (Spin-column; Bioteke, Beijing, China) following the protocol of the manufacturer. The RNA quality and total RNA concentration were determined by Nanodrop (Thermo). First-strand cDNA was synthesized for quantitative real-time PCR (qRT-PCR) analysis using PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) with Oligo dT Primer.
2.6. Real-time PCR analysis of mRNA expression PcToll4 and PcALF1–11 mRNA expressions were detected by SYBR Green fluorescent qRT-PCR to detect the RNAi efficiency. The gene-specific primers, PcToll4-RT-F and PcToll4-RT-R, were used to analyze the changes in the mRNA expression of PcToll4 at 24, 36, and 48 h post WSSV challenge in the intestine of P. clarkii after siRNA injection. Moreover, the mRNA expressions of PcALF1–11 from PcToll4 silencing P. clarkii were analyzed using 11 pairs of primers (i.e., PcALF1-RT-F and PcALF1-RT-R; PcALF2-RT-F and PcALF2-RT-R; PcALF3-RT-F and PcALF3-RT-R; PcALF4-RT-F and PcALF4-RT-R; PcALF5-RT-F and PcALF5-RT-R; PcALF6-RT-F and PcALF6-RT-R; PcALF7-RT-F and PcALF7-RT-R; PcALF8-RT-F and PcALF8-RT-R; PcALF9-RT-F and PcALF9-RT-R; PcALF10-RT-F and PcALF10-RT-R; and PcALF11-RT-F and PcALF11-RT-R). qRT-PCR was performed using SYBR Premix Ex TaqTM II (Tli RNaseH Plus) (Takara, Dalian, China) following the manufacturer's instructions. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control and was amplified with the specific primers PcGAPDH-RT-F and PcGAPDH-RT-R. qRTPCR analysis was repeated thrice for all the samples. 2− ΔΔCT methods were used to analyze the expression levels of PcToll4 and ALFs (Livak and Schmittgen, 2001). The bars indicate the mean ± standard error (S.E) in terms of relative mRNA expression. The unpaired sample ttest was performed as the statistical analysis, and the differences were considered significant when P b 0.05. The primers used are presented in Table 1.
2.7. Dual luciferase activity assay in S2 cells The expression vectors for full-length PcToll4 were constructed using pAc5.1/V5-His B (Invitrogen, USA), and the PCR products were amplified with primers PcToll4-pAc-F and PcToll4-pAc-R (Table 1). After double digestion with Kpn І/Apa І (Takara, Dalian, China), the PCR products were ligated into the expression vectors, and the positive clones were sequenced to ensure correct insertion. Considering the unavailability of a crayfish cell line, S2 cells were used to study the activation of AMP expression of PcToll4 protein. S2 cells were maintained at 27 °C in Drosophila SDM (serum-free medium; Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen). For DNA transfection, the cells were seeded overnight and the plasmids were transfected using Cellfectin II reagent (Invitrogen) according to the manufacturer's instructions. For dualluciferase reporter assays, S2 cells in 96-well plates (TPP, Switzerland) were transfected using 0.3 μg expression plasmids, 0.2 μg reporter gene plasmids, and 0.02 μg pRL-TK renilla luciferase plasmid (Promega, USA) as the internal controls. The reporter gene plasmids
Fig. 1. Schematic representation of domain topology of PcToll4.
Y. Huang et al. / Gene 610 (2017) 140–147
were constructed using the promoter sequences of the following genes: Penaeidin-4 (PEN4), metchnikowin (Mtk), drosomycin (Drs), and attacin A (Atta). All assays were performed with three independent transfections. At 36 h post-transfection, firefly and renilla luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega, USA).
143
3. Results 3.1. Identification of PcToll4 and ALFs in P. clarkii One Toll and 11 different forms of ALF genes were identified from P. clarkii. In the previous study, 3 Tolls were identified in the P. clarkii.
Fig. 2. Phylogenetic analysis of PcToll4 and other representative Toll proteins. Amyelois transitella Toll: Accession No. XP_013193694.1; Apis florea Toll: Accession No. XP_012343212.1; Anopheles gambiae Toll6: Accession No. AAL37902.1; Athalia rosae Toll: Accession No. XP_012267088.1; Bactrocera cucurbitae Toll: Accession No. XP_011180117.1; Bombus impatiens Toll: Accession No. XP_003489076.1; Bombus terrestris Toll: Accession No. XP_003398203.1; Bombyx mori Toll: Accession No. XP_012553339.1; Camponotus floridanus Toll: Accession No. XP_011258081.1; C. maenas Toll: Accession No. CDO91661.1; Cimex lectularius Toll: Accession No. XP_014260332.1; Culex quinquefasciatus Toll: Accession No. XP_001868788.1; Dendroctonus ponderosae Toll: Accession No. ENN73923.1; Diachasma alloeum Toll: Accession No. XP_015117268.1; Dinoponera quadriceps Toll: Accession No. XP_014488182.1; Drosophila busckii Toll: Accession No. ALC44674.1; D. melanogaster Toll: Accession No. NP_524757.1; E. sinensis Toll, Toll2: Accession No. AGK90305.1, AGT21374.1; F. chinensis Toll: Accession No. ABQ59330.1; Fopius arisanus Toll: Accession No. XP_011297545.1; Halyomorpha halys Toll: Accession No. XP_014271067.1; Ixodes scapularis Toll: Accession No. XP_002400628.1; Lasius niger Toll: Accession No. KMQ92053.1; L. vannamei Toll, Toll2, Toll3: Accession No. ABK58729.1, AEK86516.1, AEK86517.1; Lucilia cuprina Toll: Accession No. KNC30228.1; Macaca fascicularis Toll6: Accession No. EHH53614.1; M. rosenbergii Toll, Toll3: Accession No. AEI25533.1, AHL39102.1; M. japonicus Toll: Accession No. BAF99007.1; Megachile rotundata Toll: Accession No. XP_003706797.1; Melipona quadrifasciata Toll: Accession No. KOX77951.1; Microplitis demolitor Toll: Accession No. XP_008560218.1; Musca domestica Toll: Accession No. XP_005177269.2; Nasonia vitripennis Toll: Accession No. XP_001603014.1; Nilaparvata lugens Toll6: Accession No. AGK40935.1; Operophtera brumata Toll: Accession No. KOB67759.1; Papilio machaon Toll: Accession No. XP_014359363.1; Papilio polytes Toll: Accession No. XP_013138281.1; Papilio xuthus Toll: Accession No. KPI94120.1; Pediculus humanus corporis Toll: Accession No. XP_002424097.1; P. monodon Toll: Accession No. ADK55066.1; Plutella xylostella Toll: Accession No. XP_011555620.1; Polistes canadensis Toll: Accession No. XP_014604069.1; Pogonomyrmex barbatus Toll: Accession No. XP_011647219.1; Polistes dominula Toll: Accession No. XP_015173202.1; P. trituberculatus Toll1, Toll2: Accession No. AKV62617.1, AIZ66853.1; Scylla serrata Toll: Accession No. AGG55849.1; Solenopsis invicta Toll: Accession No. XP_011167002.1; Stomoxys calcitrans Toll: Accession No. XP_013102091.1; Tribolium castaneum Toll: Accession No. XP_971999.1; Vollenhovia emeryi Toll: Accession No. XP_011873165.1; Zootermopsis nevadensis Toll: Accession No. KDR21043.1.
144
Y. Huang et al. / Gene 610 (2017) 140–147
Fig. 3. qRT-PCR analysis of PcToll4 in the hemocytes, heart, hepatopancreas, gills, stomach, and intestine of crayfish (left). Time-course analysis of PcToll4 expression pattern in the intestine of WSSV challenged crayfish from 0 (unchallenged) to 72 h by qRT-PCR (right). Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with that of the control. Each bar represents the mean value from five determinations with standard deviation.
Thus, the identified Toll in this study was designated as PcToll4 (KU680805). The 11 ALF genes were designated as PcALF1 (KU680792), PcALF2 (KU680793), PcALF3 (KU680794), PcALF4 (KU680795), PcALF5 (KU680796), PcALF6 (KU680797), PcALF7 (KU680798), PcALF8 (KU680799), PcALF9 (KU680800), PcALF10 (KU680801), and PcALF11 (KU680802). The complete cDNA sequence of PcToll4 is 4849 bp long, including a 3036 bp open reading frame that encodes a 1011 amino acid protein, a 324 bp 5′-untranslated region (UTR), and a 1489 bp 3′-UTR with a poly (A) tail. The nucleotide and deduced amino acid sequences of PcToll4 are presented in Fig. S1. SMART analysis shows that the PcToll4 protein contains a signal peptide of 20 amino acids (aa), 13 LRR domains with an aa length of 20 to 27, three 24 aa LRR TYP domains, 2 LRR CT domains of 62 and 48 aa, one 38 aa LRR NT domain, one 23 aa transmembrane domain, and one 139 aa TIR domain (Fig. 1). The molecular weight and isoelectric point of PcToll4 are 115.9 kDa and 5.84, respectively. The complete cDNA sequences of the 11 PcALFs were 1271, 687, 1178, 1370, 827, 1545, 552, 1258, 735, 1248, and 1396 bp, respectively. These 11 PcALFs have encoded proteins of 122, 123, 122, 130, 118, 123, 122, 122, 123, 242, and 123 amino acids, respectively. 3.2. Phylogenetic analysis
of PcALF1, PcALF3, and PcALF4 were determined by aligning the genomic DNA sequences with the corresponding cDNA genes. The genomic structure of PcALF1 was similar to that of PcALF4; both contain four exons interrupted by three introns. By contrast, PcALF3 contains three exons interrupted by two introns. The genomic sequence of the PcALF1 gene is 3502 bp long, including four exons with lengths of 376, 152, 134, and 116 bp and three introns with lengths of 317, 775, and 1632 bp. The four exons of PcALF4 have lengths of 622, 162, 137, and 116 bp, and the three introns have lengths of 370, 626, and 1405 bp. The PcALF3 gene is 1563 bp long, including three exons with lengths of 119, 134, and 116 bp, and two introns with lengths of 101 and 1093 bp. The exon-intron boundaries of the genomic sequences of PcALF1, PcALF3, and PcALF4 are GT at 5′ splice sites and AG at 3′ splice sites. 3.4. Tissue distribution and expression profiles of PcToll4 qRT-PCR analysis showed that PcToll4 was expressed in all detected tissues. PcToll4 was mainly expressed in the intestine, and was also detected in gills, hepatopancreas, heart, hemocytes, and stomach (Fig. 3). The expression profiles of PcToll4 in the intestine were further examined after the WSSV challenge (Fig. 3). PcToll4 mRNA increased at 24 h, and the highest expression level of PcToll4 was observed at 36 h upon
To explore the evolutionary dynamics of PcToll4, 60 Toll amino acid sequences were used to construct a phylogenetic tree. PcToll4 was clustered with the crustacean Tolls from Eriocheir sinensis, Carcinus maenas, Portunus trituberculatus, Scylla serrate, L. vannamei, and M. japonicas (Fig. 2) and not with the previously reported Tolls from P. clarkii. A total of 70 ALFs from crustaceans, including shrimp, freshwater crayfish, crayfish, and crab, were used in the phylogenetic analysis (Fig. S2A). In the phylogenetic tree, 11 PcALFs were clustered into different groups. PcALF1, PcALF2, PcALF3, and Pacifastacus leniusculus ALF belong to one cluster. PcALF4, ALF5 from P. trituberculatus, and ALF3 from Scylla paramamosain belong to one group. PcALF5, PcALF8, PcALF11, and ALF1 from F. chinensis and L. vannamei belong to one clade. PcALF6, ALF from L. stylirostris, and ALF6 from F. chinensis are clustered into one group. PcALF7, ALF6 from P. monodon, and ALF2 from F. chinensis belong to one cluster. PcALF10 and ALF3 from M. rosenbergii belong to one group. 3.3. Genomic organization of PcALF1, PcALF3, and PcALF4 Although 11 different ALF genes were found in the crayfish, the genomic sequences of only 3 ALFs were obtained. The genomic sequences of PcALF1, PcALF3, and PcALF4 were amplified to identify their corresponding genomic structures (Fig. S2B). The intron-exon boundaries
Fig. 4. Activation of Drosophila (Mtk, Drs, Atta,) and shrimp (Pen4) AMPs by overexpression of PcToll4 in Drosophila S2 cells. All data are representative of three independent experiments. The bars indicate the mean ± SD of the luciferase activities (n = 3). The statistical significance was calculated by an unpaired sample t-test (*P b 0.05, **P b 0.01).
Y. Huang et al. / Gene 610 (2017) 140–147
WSSV challenge. Thereafter, its expression gradually decreased from 48 to 72 h. No significant changes were observed in the PBS-treated group. 3.5. Overexpression of PcToll4 in Drosophila S2 cells The present study reveals that PcToll4 significantly activates the promoters of Drosophila or L. vannamei AMP genes (Fig. 4). PcToll4 induces the promoter activities of the AMP Pen4 (8.1-fold), Mtk (7.1-fold), Drs (4.1-fold), and Atta (6.7-fold). 3.6. Silencing efficiency of siRNA The expression of PcToll4 in the siRNA interference group was significantly suppressed in the intestine of P. clarkii at 24, 36, and 48 h when compared with that of the WSSV group (i.e., the control group was only injected with WSSV). By contrast, the control siRNA-scrambled has no effect on the gene expression, showing that the effect of siRNA to PcToll4 is highly specific.
145
3.7. PcToll4 controlled ALFs transcription During the knockdown of the expression of the PcToll4 gene in the intestine of crayfish, the ALF expression levels were detected using qRT-PCR. As shown in Fig. 5, five ALFs (PcALF1, PcALF2, PcALF4, PcALF7, and PcALF10) were significantly upregulated after the WSSV challenge. When the expression of PcToll4 was knocked down by siRNA, the transcription levels of these five ALFs were downregulated. However, the expressions of other ALFs did not change significantly (data not shown). Silencing PcToll4 may downregulate different PcALFs transcriptions; thus, we predict that PcToll4 has important roles in regulating the induction of PcALFs in freshwater crayfish challenged with WSSV. 4. Discussion The Toll pathway is one of the most important signaling pathways of the innate immune response of invertebrates. In this study, a novel Toll gene PcToll4 was first identified from the intestinal transcriptome of P. clarkii. The intestine is the largest compartment of the immune system
Fig. 5. Expression analysis of ALFs at 24, 36, and 48 h WSSV challenge in the intestine of P. clarkii (PcToll4 knockdown). The sequence-specific PcToll4-siRNA was injected into shrimp to knock down the expression of PcToll4. The mRNA expressions of PcALF1–11 from PcToll4 silencing P. clarkii were analyzed using quantitative real-time PCR. PcToll4-siRNA-scrambled was included in the injections as a control. WSSV alone was used as a positive control. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with the control.
146
Y. Huang et al. / Gene 610 (2017) 140–147
and is continuously bombarded by an enormous variety of microbes, including pathogens. As a result, a complex array of immune effector mechanisms is present in the gut, many of which are distinct from their counterparts in other parts of the body (Mowat, 2011). The highest level of PcToll4 mRNA was detected in the intestine, which might be closely related to its biological functions in the innate immune response of crayfish. The expression profiles of PcToll4 in response to WSSV were investigated in the intestine of freshwater crayfish to better understand the response and role of PcToll4 in host defense against WSSV. The results reveal that PcToll4 is involved in anti-viral immune response. After WSSV challenge, three different Tolls (LvToll1, LvToll2, and LvToll3) identified in L. vannamei were also upregulated (Wang et al., 2012). In P. trituberculatus, WSSV induces the expression of PtToll2 but suppresses the transcription of PtToll3 (Zhou et al., 2015). The insect Toll pathway exhibits anti-bacterial, anti-fungal, and antiviral functions by regulating the expression of immune-related genes, including AMPs (Lemaitre and Hoffmann, 2007). ALF is a kind of AMPs and a total of 11 ALF genes were found in P. clarkii. Seven ALF isoforms (PtALF1–7) were isolated from P. trituberculatus and showed different expression profiles (Liu et al., 2011; Liu et al., 2012a; Liu et al., 2012b; Liu et al., 2013a; Liu et al., 2013b). These different isoforms are either encoded by distinct genes or generated by alternative mRNA splicing (Tharntada et al., 2008). In order to reveal the relationship between PcToll4 and 11 ALF genes, RNAi experiments were performed. RNAi results show that PcToll4 regulates 5 ALF expressions in intestine of P. clarkii during WSSV infection. In most of the previous research, ALFs were reported to have a vital role in the immune defense against bacterial infections. The recombinant PtALF5 protein from P. trituberculatus reveals an antimicrobial activity against gram-negative bacteria V. alginolyticus and Pseudomonas aeruginosa (Liu et al., 2012b), and SpALF4 is a potent immune effector that provides multiple protective functions against invading bacteria or fungus in S. paramamosain (Zhu et al., 2014). The synthetic peptides corresponding to the LPS-binding domain (LBD) of SpALF1 from S. paramamosain and ALF55–76 of the giant tiger shrimp P. monodon inhibits the growth of gram-negative and gram-positive bacteria (Imjongjirak et al., 2007; Pan et al., 2007). In L. vannamei, an ALF gene protected the shrimp from both bacterial (Vibrio penaeicida) and fungal (Fusarium oxysporum) infections (Vega et al., 2008). Although most research focused on the anti-bacteria function of crustaceans ALFs, ALFs were also reported to participate in anti-viral immune defense. Silencing the ALF gene enhanced the expression of VP28 gene, the WSSV envelope protein gene, in cultured hematopoietic tissue (Hpt) cells of P. leniusculus (Liu et al., 2006). In the red claw crayfish Cherax quadricarinatus, pre-incubation of WSSV with recombinant CqALF protein resulted in both a significant reduction in WSSV replication in Hpt cell cultures and an increased survival rate of animals (Lin et al., 2016). Different isoforms of ALF from F. chinensis played a key role in inhibiting WSSV replication, and might function as potential therapeutic drugs against WSSV (Li et al., 2015). P. monodon ALFPm3 displayed direct effect on the viral structural proteins and finally resulted in breaking up of WSSV virions (Methatham et al., 2017). So, multiple ALF genes from crustaceans showed anti-viral functions. In our research, the results showed that at least 5 ALF genes regulated by PcToll4 participated in crayfish anti-viral processes. Overexpression experiments were conducted on Drosophila S2 cells to further confirm the roles of PcToll4 in AMP genes expression. The overexpression of PcToll4 in S2 cells activated the expression of Drosophila AMPs, including Mtk, Drs, Atta, and shrimp Pen4. In L. vannamei, LvToll2 could activate the promoters of the NF-κB-pathway-controlled AMP genes in Drosophila S2 cells (Wang et al., 2012). Overexpression of HcTIR1 or HcTIR2 (TIR: intracellular Toll/interleukin-1 receptor) of HcToll2 from H. cumingii could both induced expression of AMP genes in S2 cells (Ren et al., 2014). Penaeidins are a unique family of AMPs that is found only in penaeid shrimp (de Lorgeril et al., 2008, Han-Ching Wang et al., 2010). So, it could reveal that PcToll4 had important roles in regulating the AMP genes expression from both RNAi and overexpression experiments.
In summary, this study first reported the presence of another Toll gene (PcToll4) and a total of 11 ALF genes in P. clarkii. RNAi analysis and overexpression assay both revealed the role of PcToll4 in regulating the expressions of AMP genes. Our results also suggested that PcToll4 participated in innate immune defense against WSSV through regulating the expressions of ALF genes in intestine of the crayfish.
Acknowledgements This study was supported by the National Natural Science Foundation of China (Grant No. 31572647), the Natural Science Fund of Colleges and universities in Jiangsu Province (16KJD240001, 14KJA240002), the Graduate Students Research and Innovation Program of Jiangsu Province (KYZZ15_0214), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (RAPD).
Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2017.02.018.
References Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Anderson, K.V., Nüsslein-Volhard, C., 1983. Information for the dorsal-ventral pattern of the Drosophila embryo is stored as maternal mRNA. Nature 311, 223–227. Arts, J.A., Cornelissen, F.H., Cijsouw, T., Hermsen, T., Savelkoul, H.F., Stet, R.J., 2007. Molecular cloning and expression of a toll receptor in the giant tiger shrimp, Penaeus monodon. Fish Shellfish Immunol. 23, 504–513. Beale, K.M., Towle, D.W., Jayasundara, N., Smith, C.M., Shields, J.D., Small, H.J., 2008. Antilipopolysaccharide factors in the American lobster Homarus americanus: molecular characterization and transcriptional response to Vibrio fluvialis challenge. Comp. Biochem. Physiol. Part D Genomics Proteomics 3, 263–269. Bowie, A., O'Neill, L.A., 2000. The interleukin-1 receptor/toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products. J. Leukoc. Biol. 67, 508–514. Coscia, M.R., Giacomelli, S., Oreste, U., 2011. Toll-like receptors: an overview from invertebrates to vertebrates. Invertebr. Surviv. J. 8, 210–226. de Lorgeril, J., Gueguen, Y., Goarant, C., Goyard, E., Mugnier, C., Fievet, J., 2008. A relationship between antimicrobial peptide gene expression and capacity of a selected shrimp line to survive a Vibrio infection. Mol. Immunol. 45, 3438–3445. Hancock, R.E., Brown, K.L., Mookherjee, N., 2006. Host defence peptides from invertebrates-emerging antimicrobial strategies. Immunobiology 211, 315–322. Han-Ching Wang, K., Tseng, C.W., Lin, H.Y., Chen, I.T., Chen, Y.H., Chen, Y.M., 2010. RNAi knock-down of the Litopenaeus vannamei toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev. Comp. Immunol. 34, 49–58. Huang, Y., Chen, Y.H., Wang, Z., Wang, W., Ren, Q., 2014. Novel myeloid differentiation factor 88, EsMyD88, exhibits EsTube-binding activity in Chinese mitten crab Eriocheir sinensis. Dev. Comp. Immunol. 47, 298–308. Imjongjirak, C., Amparyup, P., Tassanakajon, A., Sittipraneed, S., 2007. Anti-lipopolysaccharide factor (ALF) of mud crab Scylla paramamosain: molecular cloning, genomic organization and the antimicrobial activity of its synthetic LPS binding domain. Mol. Immunol. 44, 3195–3203. Janeway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Kawai, T., Akira, S., 2011. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 34, 637–650. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Li, S., Guo, S., Li, F., Xiang, J., 2014. Characterization and function analysis of an anti-lipopolysaccharide factor (ALF) from the Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 46, 349–355. Li, S., Guo, S., Li, F., Xiang, J., 2015. Functional diversity of anti-lipopolysaccharide factor isoforms in shrimp and their characters related to antiviral activity. Mar. Drugs 13 (5), 2602–2616. Li, S.H., Zhang, X.J., Sun, Z., Li, F.H., Xiang, J.H., 2013. Transcriptome analysis on Chinese shrimp Fenneropenaeus chinensis during WSSV acute infection. PLoS One 8, e58627. Liang, T., Ji, H., Lian, L., Wu, T., Gu, W., Wang, W., 2010. A rapid assay for simultaneous detection of Spiroplasma eriocheiris and white spot syndrome virus in Procambarus clarkii by multiplex PCR. Lett. Appl. Microbiol. 51, 532–538. Lin, F.Y., Gao, Y., Wang, H., Zhang, Q.X., Zeng, C.L., Liu, H.P., 2016. Identification of an antilipopolysacchride factor possessing both antiviral and antibacterial activity from the red claw crayfish Cherax quadricarinatus. Fish Shellfish Immunol. 57, 213–221.
Y. Huang et al. / Gene 610 (2017) 140–147 Liu, H.P., Jiravanichpaisal, P., Söderhäll, I., Cerenius, L., Söderhäll, K., 2006. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J. Virol. 80, 10365–10371. Liu, Y., Cui, Z., Li, X., Song, C., Li, Q., Wang, S., 2012a. A new anti-lipopolysaccharide factor isoform (PtALF4) from the swimming crab Portunus trituberculatus exhibited structural and functional diversity of ALFs. Fish Shellfish Immunol. 32, 724–731. Liu, Y., Cui, Z., Li, X., Song, C., Li, Q., Wang, S., 2012b. Molecular cloning, expression pattern and antimicrobial activity of a new isoform of anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 33, 85–91. Liu, Y., Cui, Z., Li, X., Song, C., Shi, G., 2013a. A newly identified anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus with broad spectrum antimicrobial activity. Fish Shellfish Immunol. 34, 463–470. Liu, Y., Cui, Z., Li, X., Song, C., Shi, G., Wang, C., 2013b. Molecular cloning, genomic structure and antimicrobial activity of PtALF7, a unique isoform of anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 34, 652–659. Liu, Y., Cui, Z., Luan, W., Song, C., Nie, Q., Wang, S., 2011. Three isoforms of anti-lipopolysaccharide factor identified from eyestalk cDNA library of swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 30, 583–591. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−ΔΔC(T)) method. Methods 25, 402–408. Medzhitov, R., Janeway Jr., C.A., 2000. Innate immunity. N. Engl. J. Med. 343, 338–344. Mekata, T., Kono, T., Yoshida, T., Sakai, M., Itami, T., 2008. Identification of cDNA encoding toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicas. Fish Shellfish Immunol. 24, 122–133. Methatham, T., Boonchuen, P., Jaree, P., Tassanakajon, A., Somboonwiwat, K., 2017. Antiviral action of the antimicrobial peptide ALFPm3 from Penaeus monodon against white spot syndrome virus. Dev. Comp. Immunol. 69, 23–32. Morita, T., Ohtsubo, S., Nakamura, T., Tanaka, S., Iwanaga, S., Ohashi, K., 1985. Isolation and biological activities of limulus anticoagulant (anti-LPS factor) which interacts with lipopolysaccharide (LPS). J. Biochem. 97, 1611–1620. Mowat, A., 2011. Innate immunity in the intestine. J. Innate Immun. 3, 541–542. Pan, C.Y., Chao, T.T., Chen, J.C., Chen, J.Y., Liu, W.C., Lin, C.H., 2007. Shrimp (Penaeus monodon) anti-lipopolysaccharide factor reduces the lethality of Pseudomonas aeruginosa sepsis in mice. Int. Immunopharmacol. 7, 687–700. Ren, Q., Lan, J.F., Zhong, X., Song, X.J., Ma, F., Hui, K.M., 2014. A novel toll like receptor with two TIR domains (HcToll-2) is involved in regulation of antimicrobial peptide gene expression of Hyriopsis cumingii. Dev. Comp. Immunol. 45, 198–208. Rutschmann, S., Kilinc, A., Ferrandon, D., 2002. Cutting edge: the toll pathway is required for resistance to gram-positive bacterial infections in Drosophila. J. Immunol. 168, 1542–1546. Silva, N.C., Sarmento, B., Pintado, M., 2013. The importance of antimicrobial peptides and their potential for therapeutic use in ophthalmology. Int. J. Antimicrob. Agents 41, 5–10. Smale, S.T., 2012. Transcriptional regulation in the innate immune system. Curr. Opin. Immunol. 24, 51–57. Soderhall, K., Thornqvist, P.O., 1997. Crustacean immunity short review. Dev. Biol. Stand. 90, 45–51.
147
Srisuk, C., Longyant, S., Senapin, S., Sithigorngul, P., Chaivisuthangkura, P., 2014. Molecular cloning and characterization of a toll receptor gene from Macrobrachium rosenbergii. Fish Shellfish Immunol. 36, 552–562. Sun, C., Xu, W.T., Zhang, H.W., Dong, L.P., Zhang, T., Zhao, X.F., 2011. An antilipopolysaccharide factor from red swamp crayfish, Procambarus clarkii, exhibited antimicrobial activities in vitro and in vivo. Fish Shellfish Immunol. 30, 295–303. Supungul, P., Klinbunga, S., Pichyangkura, R., Hirono, I., Aoki, T., Tassanakajon, A., 2004. Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach. Dis. Aquat. Org. 61, 123–135. Tanaka, S., Nakamura, T., Morita, T., Iwanaga, S., 1982. Anti-LPS factor: an anticoagulant which inhibits the endotoxin-mediated activation of coagulation system. Biochem. Biophys. Res. Commun. 105, 717–723. Tassanakajon, A., Amparyup, P., Somboonwiwat, K., Supungul, P., 2010. Cationic antimicrobial peptides in penaeid shrimp. Mar. Biotechnol. (NY). 12, 487–505. Tharntada, S., Somboonwiwat, K., Rimphanitchayakit, V., Tassanakajon, A., 2008. Anti-lipopolysaccharide factors from the black tiger shrimp, Penaeus monodon, are encoded by two genomic loci. Fish Shellfish Immunol. 24, 46–54. Vega, E., Leary, N.A., Shockey, J.E., Robalino, J., Payne, C., Browdy, C.L., 2008. Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad spectrum antimicrobial peptide essential for shrimp immunity against bacterial and fungal infection. Mol. Immunol. 45, 1916–1925. Wang, P.H., Liang, J.P., Gu, Z.H., Wan, D.H., Weng, S.P., Yu, X.Q., 2012. Molecular cloning, characterization and expression analysis of two novel tolls (LvToll2 and LvToll3) and three putative Spätzle-like toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev. Comp. Immunol. 36, 359–371. Wang, Z., Chen, Y.H., Dai, Y.J., Tan, J.M., Huang, Y., Lan, J.F., 2015. A novel vertebrates tolllike receptor counterpart regulating the anti-microbial peptides expression in the freshwater crayfish, Procambarus clarkii. Fish Shellfish Immunol. 43, 219–229. Warren, H.S., Glennon, M.L., Wainwright, N., Amato, S.F., Black, K.M., Kirsch, S.J., 1992. Binding and neutralization of endotoxin by limulus antilipopolysaccharide factor. Infect. Immun. 60, 2506–2513. Yang, C., Zhang, J., Li, F., Ma, H., Zhang, Q., Jose Priya, T.A., 2008. A toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection. Fish Shellfish Immunol. 24, 564–574. Yang, L.S., Yin, Z.X., Liao, J.X., Huang, X.D., Guo, C.J., Weng, S.P., 2007. A toll receptor in shrimp. Mol. Immunol. 44, 1999–2008. Zhang, Y., Wang, L., Wang, L., Yang, J., Gai, Y., Qiu, L., 2010. The second antilipopolysaccharide factor (EsALF-2) with antimicrobial activity from Eriocheir sinensis. Dev. Comp. Immunol. 34, 945–952. Zhou, S.M., Yuan, X.M., Liu, S., Li, M., Tao, Z., Wang, G.L., 2015. Three novel toll genes (PtToll1-3) identified from a marine crab, Portunus trituberculatus: Different tissue expression and response to pathogens. Fish Shellfish Immunol. 46, 737–744. Zhu, L., Lan, J., Huang, Y., Zhang, C., Zhou, J., Fang, W., 2014. SpALF4: a newly identified anti-lipopolysaccharide factor from the mud crab Scylla paramamosain with broad spectrum antimicrobial activity. Fish Shellfish Immunol. 36, 172–180.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Newly identified PcToll4 regulates antimicrobial peptide expression in intestine of red swamp crayfish Procambarus clarkii Ying Huang a, Tingting Li a, Min Jin c, Shaowu Yin a,b, Kai-Min Hui a,⁎, Qian Ren a,b,⁎ a b c
Jiangsu Key Laboratory for Biodiversity & Biotechnology, Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, Nanjing 210046, China Co-Innovation Center for Marine Bio-Industry Technology of Jiangsu Province, Lianyungang, Jiangsu 222005, China State Key Laboratory Breeding Base of Marine Genetic Resource, Third Institute of Oceanography, SOA, Xiamen 361005, China
a r t i c l e
i n f o
Article history: Received 29 December 2016 Received in revised form 22 January 2017 Accepted 13 February 2017 Available online 16 February 2017 Keywords: Procambarus clarkii WSSV Toll-like receptor Anti-lipopolysaccharide factor RNAi Overexpression
a b s t r a c t Tolls or Toll-like receptors (TLRs) have an essential role in initiating innate immune responses against pathogens. In this study, a novel Toll gene, PcToll4, was first identified from the intestinal transcriptome of the freshwater crayfish, Procambarus clarkii. The PcToll4 cDNA is 4849 bp long with a 3036 bp open reading frame that encodes a 1011-amino acid protein. PcToll4 contains a signal peptide, 13 LRR domains, 3 LRR TYP domains, 2 LRR CT domains, an LRR NT domain, a transmembrane region, and a TIR domain. Quantitative RT-PCR analysis revealed that PcToll4 mRNA was detected in all tested tissues, and the expression of PcToll4 in the intestine was significantly upregulated after white spot syndrome virus (WSSV) challenge. Overexpression of PcToll4 in Drosophila Schneider 2 (S2) cells activates the antimicrobial peptides (AMPs) of Drosophila, including metchnikowin, drosomycin, attacin A, and shrimp Penaeidin-4. Results of RNA interference by siRNA also showed that PcToll4 regulates the expressions of 5 anti-lipopolysaccharide factors (ALFs) in the intestine of crayfish. Our findings suggest that PcToll4 is important for the innate immune responses of P. clarkii because this gene regulates the expressions of AMPs against WSSV. © 2017 Published by Elsevier B.V.
1. Introduction The freshwater crayfish, Procambarus clarkii, is one of the most important commercial species extensively distributed in China (Liang et al., 2010). Similar to other invertebrates, crayfish lack an adaptive immune system and mainly rely on their innate immune responses to resist pathogen invasion (Soderhall and Thornqvist, 1997). The innate immune system is the first line of the host defense against invading pathogens, especially in invertebrates, and is conserved throughout evolution (Medzhitov and Janeway, 2000). Upon infection, the specific molecular motifs known as pathogen-associated molecular patterns Abbreviations: TLR, Toll-like receptor; LRR, leucine-rich repeat; LRR TYP, Leucine-rich repeats, typical (most populated) subfamily; LRR CT, Leucine rich repeat C-terminal; LRR NT, Leucine rich repeat N-terminal; WSSV, white spot syndrome virus; S2, Drosophila Schneider 2; AMP, antimicrobial peptide; LPS, lipopolysaccharides; PGN, peptidoglycan; dsRNA, double-stranded RNA; GLU, β-glucans; PRR, pattern recognition receptor; TM, transmembrane; TIR, intracellular Toll/interleukin-1 receptor; NF-κB, nuclear factor– kappa B; ALF, anti-lipopolysaccharide factor; EST, expressed sequence tag; PBS, phosphate buffer saline; RNAi, RNA interference; qRT-PCR, quantitative real-time PCR; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; S. E, standard error; SDM, serumfree medium; PEN4, Penaeidin-4; Mtk, metchnikowin; Drs, drosomycin; Atta, attacin A; UTR, untranslated region; aa, amino acids. ⁎ Corresponding authors at: College of Life Sciences, Nanjing Normal University, Nanjing 210046, China. E-mail addresses: [email protected] (K.-M. Hui), [email protected] (Q. Ren).
http://dx.doi.org/10.1016/j.gene.2017.02.018 0378-1119/© 2017 Published by Elsevier B.V.
(PAMPs), such as lipopolysaccharides (LPS), peptidoglycan (PGN), double-stranded RNA (dsRNA), and β-glucans (GLU) of microbes, are directly recognized by germ-line receptors called pattern recognition receptors (PRRs) (Janeway and Medzhitov, 2002). The recognition process activates multiple signaling pathways, thereby resulting in rapid and effective cellular and humoral defenses (Smale, 2012). Toll or Toll-like receptors (TLRs) are the most extensively studied PRRs, which play a fundamental role in pathogen recognition and activation of the innate immunity (Akira et al., 2006; Yang et al., 2008). Tolls/TLRs are type I integral membrane glycoproteins that are characterized by their domain organization. Tolls and TLRs contain an ectodomain, which encompasses leucine-rich repeats (LRRs), a transmembrane domain, and an intracellular Toll/interleukin-1 receptor (TIR) domain required for downstream signal transduction (Bowie and O′Neill, 2000). Toll, the founding member of TLRs, was originally identified in Drosophila melanogaster (called dToll) and was proven involved in the development of embryonic dorsoventral polarity in D. melanogaster (Anderson and Nüsslein-Volhard, 1983). The role of dToll in the antifungal and antibacterial responses of flies was later identified (Rutschmann et al., 2002). At present, a large number of Tolls/TLRs from vertebrates to invertebrates are widely investigated (Coscia et al., 2011). Multiple Tolls are also found in shrimp or crayfish, including 1 Toll receptor from Penaeus monodon (Arts et al., 2007), Marsupenaeus japonicus (Mekata et al., 2008), and Macrobrachium rosenbergii (Srisuk et al., 2014), 3 Tolls from Litopenaeus vannamei
Y. Huang et al. / Gene 610 (2017) 140–147
(Wang et al., 2012; Yang et al., 2007), and 1 Toll from Fenneropenaeus chinensis (Yang et al., 2008) and P. clarkii (Wang et al., 2015). Toll receptors of invertebrates induce their innate immune responses (Kawai and Akira, 2011). Signal pathway activation leads to the translocation of the nuclear factor–kappa B (NF-κB) into the nucleus, which finally induces the expression of immune effector molecules such as antimicrobial peptides (AMPs) (Lemaitre and Hoffmann, 2007). AMPs, one of the major components of the invertebrate immune system, function as the front line of host defenses against microbial infection and have a broad spectrum of antimicrobial activities against bacteria, fungi, parasites, and viruses (Hancock et al., 2006; Silva et al., 2013). The major crustacean AMPs are represented by three cationic peptide families: penaeidins, crustins, and anti-lipopolysaccharide factors (ALFs) (Tassanakajon et al., 2010). ALFs represent a family of basic proteins of around 100 amino acids, which bind and neutralize the activity of LPS (Morita et al., 1985). They mediate the degranulation of hemocytes and activate the intracellular coagulation cascade (Morita et al., 1985). The first ALF, LALF, was isolated from the hemocytes of the horseshoe crab Limulus polyphemus and has a strong antibacterial effect on gram-negative R-type bacteria (Tanaka et al., 1982; Warren et al., 1992). N 100 ALF sequences were reported in shrimps, lobsters, crayfish, and crabs (Supungul et al., 2004; Beale et al., 2008; Zhang et al., 2010; Sun et al., 2011). Although distinct ALF isoforms usually coexist in one species, their similarities are low (Li et al., 2013). These isoforms are regulated by different signal pathways and exhibit different expression patterns in response to bacterial or viral infection. However, the transcriptional levels of most identified ALFs in crustaceans are usually upregulated, thereby suggesting that ALFs have important roles in the defense against bacterial and viral pathogens (Li et al., 2014). In this study, a novel invertebrate Toll PcToll4 was identified from P. clarkii. Its transcription can be induced by white spot syndrome virus (WSSV) challenge, and the five ALF expressions were regulated by PcToll4. Our study reveals the role of PcToll4 in the innate immunity of the red swamp crayfish.
2. Materials and methods 2.1. Identification of PcToll4 and ALF genes and sequence analysis An expressed sequence tag (EST) in P. clarkii that is similar to the Toll gene and 11 ESTs that are similar to ALF genes were obtained from the intestinal transcriptome data (unpublished). The 5′ and 3′ cDNA were synthesized following the instructions of Clontech SMARTer RACE cDNA Amplification Kit from Takara (Dalian, China) using 5′-CDS primer A, SMARTer IIA oligo, and 3′-CDS primer A. The following gene-specific forward and reverse primers were designed based on the EST: PcToll4-F and PcToll4-R (Table 1). A Clontech Advantage 2 PCR Kit from Takara (Dalian, China) was used for gene cloning. PCR reaction was conducted using the following conditions: 5 cycles at 94 °C for 30 s and 72 °C for 2 min; 5 cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 2 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2 min. The corresponding amplified fragments were subcloned into T3 vectors prior to the sequencing by TransGen Biotech (Beijing, China). Genomic DNA from the intestine of P. clarkii was isolated using NucleoSpin Tissue (Clontech). The full length of PcToll4 was obtained by overlapping the EST sequences and the 5′ and 3′ fragments. Three pairs of gene-specific primers (i.e., gPcALF1-F1, gPcALF1-R1; gPcALF1F2, gPcALF1-R2; gPcALF3-F, gPcALF3-R; gPcALF4-F1, gPcALF4-R1; and gPcALF4-F2, gPcALF4-R2) were designed based on the obtained cDNA sequences of PcALF1, PcALF3, and PcALF4 to clone the genomic sequences of PcALF1, PcALF3, and PcALF4 (see primer sequence in Table 1). The BLASTP algorithm at NCBI (http://www.ncbi.nlm.gov/blast) was used to search the homology of the protein sequences. Translations of cDNAs and predictions of the deduced amino acid sequences were conducted using ExPASy (http://www.au.expasy.org/). MEGA 5.05 was
141
Table 1 Primer sequences used in this study. Primers name
Sequences (5′-3′)
PcToll4-F PcToll4-R UPM Long Short 5′-CDS Primer A SMARTer II A oligo 3′-CDS primer A gPcALF1-F1 gPcALF1-R1 gPcALF1-F2 gPcALF1-R2 gPcALF3-F gPcALF3-R gPcALF4-F1 gPcALF4-R1 gPcALF4-F2 gPcALF4-R2 PcToll4-RT-F PcToll4-RT-R PcALF1-RT-F PcALF1-RT-R PcALF2-RT-F PcALF2-RT-R PcALF3-RT-F PcALF3-RT-R PcALF4-RT-F PcALF4-RT-R PcALF5-RT-F PcALF5-RT-R PcALF6-RT-F PcALF6-RT-R PcALF7-RT-F PcALF7-RT-R PcALF8-RT-F PcALF8-RT-R PcALF9-RT-F PcALF9-RT-R PcALF10-RT-F PcALF10-RT-R PcALF11-RT-F PcALF11-RT-R PcGAPDH-RT-F PcGAPDH-RT-R PcToll4-pAc-F PcToll4-pAc-R
GCCGAACCATTGTGATACTGTCGTCCA TGAAGGGTTGAAGTTGGATGTGGGAATG CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC T25VN AAGCAGTGGTATCAACGCAGAGTACXXXXX AAGCAGTGGTATCAACGCAGAGTAC(T)30VN GGTCTCCCCGGAGCTCATCAATCTCA CTATTGCTTGAGCCAAGCTGCAGC AGAGCCTCAGGCGTGGCCAGGTG CCCACCCAGTTTGTTGATGATGAGATTG ATGAAGTGGTCGGTGTTGGTGG CTAATTCTTTATCCAAGCTGAAG ATGTCAGCAGCGCCGTCAGG TCATCAAAGCCACGCTGATGCCTC ACACTGACTTGAGAATGGTCCAG CGTTGTCAGCGACGGTGGAGATG AGGAACAAGACGCTGACAAG TCACGGTAATGGAGACACAC CGAGAGGCTGTAGAGGATGC CCCAGTTTGTTGATGATGAG CGTGGGAGTGTTTGTGGTGGT TTGGACTGTAACTGTAGCGGC AGGTGTTGAAGATGAAGTGGT GCTTGTTGATAATGAGGGTGA CCAGATCATCTCCACCGTCG GTAGCCTTGAGCTTTTCCCA ATGGGGAGGTGAGGCTACT CCTTCCTGCTCGGTGATGA ACAAATGAACACAAGCCACCC TGATAAACCTGTCCTCCCAAC CCAGCCATTGCGGAAAAAC GGGGCACCACATGCGACCC GCGGAACGGTGAGGTGGAG TGATGAGGCCGGCTTGGAA AGTGGCGTCATACAGGAAGGGG CCAAAGGATGGCGAGAAATAGT AGAGAAGATCGCTCAACGCC CACACTCGCCCAAACAGACG CACTCTCTCGGCTTCCATCC GCTCCACCTCACCGTTCTTC CAATGTTCGTCTGTGGAGTGA GGAAGATGGGATGATGTTCTG CCCGGATCGGGGTACCATGGCAAGTACACCAAACCTCACAG TTCGAACCGCGGGCCCTCCTTCTCCCAGAACTTGGGATCA
X = undisclosed base in the proprietary SMARTer oligo sequence. N = A, C, G, or T; V = A, G, or C.
used to construct phylogenetic trees, and the neighbor-joining method was selected for phylogenetic analysis (Kumar et al., 2008). 2.2. Animal, virus, immune challenge, and tissue collection Adult P. clarkii (about 15 g each) were purchased from an aquatic product market in Nanjing, Jiangsu Province, China and were then cultured in fresh water in tanks at a temperature of 25 °C in a laboratory. PCR using WSSV-specific primers (5′-TATTGTCTCTCCTGACGTAC-3′ and 5′-CACATTCTTCACGAGTCTAC-3′) were conducted to ensure that the crayfish were WSSV-free prior to experimental infection. The WSSV inoculums used in this study were obtained from Zhejiang University. For the experimental group, WSSV (105 copies/mL, 100 μL/crayfish) was injected into the abdominal segment of the crayfish using a microliter syringe. For the control group, the crayfish were inoculated with 100 μl of PBS (0.14 M NaCl, 3 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4). At 0, 12, 24, 36, 48, 60, and 72 h post-injection, the intestine was randomly collected from the experimental and control groups. Hemolymph was collected from the crayfish ventral sinus by
142
Y. Huang et al. / Gene 610 (2017) 140–147
mixing with 1/10 volume of anticoagulant buffer (10% sodium citrate, pH 7.0), which contains 200 mM phenylthiourea as the melanization inhibitor. The mixture was immediately centrifuged at 800g at 4 °C for 10 min to isolate the hemocytes. Other tissues, such as heart, hepatopancreas, gills, stomach, and intestine, were also collected from the untreated crayfish for tissue distribution studies. 2.3. Synthesis of siRNAs The preparation of siRNA for PcToll4 was conducted following the procedure used in our previous study (Huang et al., 2014). Based on the sequence of PcToll4, the siRNA that specifically targets PcToll4 was synthesized in vitro using a commercial kit according to the manufacturer's instructions (Takara, Japan). The siRNAs used were the following: PcToll4-siRNA (5′-CCUGCUGACAGUACUCAAA-3′). The sequence of the siRNAs was scrambled to generate the following: control PcToll4-siRNA-scrambled (5′-CCGCAUCUGAACUAGUACA-3′). The formation of double-stranded RNAs was monitored by determining the size in agarose gel electrophoresis. The synthesized siRNAs were dissolved in siRNA buffer (50 mM Tris-HCl, 100 mM NaCl, pH 7.5) and quantified by spectrophotometry. 2.4. RNAi knock-down of PcToll4 in vivo followed by WSSV challenge RNA interference (RNAi) was performed to determine the involvement of the Toll pathway in regulating the expression of ALF genes. A syringe was used to inject 40 μg siRNA into the lateral area of the fourth abdominal segment of each P. clarkii. siRNA or siRNA-scrambled (20 μg) was injected into a volume of 100 μL per crayfish. At 16 h after injection, the siRNA or siRNA-scrambled (20 μg) and WSSV (105 copies/mL, 100 μL/crayfish) were co-injected into the same crayfish. WSSV (105 copies/mL, 100 μL/crayfish) alone was simultaneously included in the injections as a positive control. For each treatment, 20 crayfish were used. The intestine of the crayfish was collected at 24, 36, and 48 h after the last injection. 2.5. Total RNA isolation and cDNA synthesis The total RNA was isolated from the tissues using High-Purity Total RNA Rapid Extraction Kit (Spin-column; Bioteke, Beijing, China) following the protocol of the manufacturer. The RNA quality and total RNA concentration were determined by Nanodrop (Thermo). First-strand cDNA was synthesized for quantitative real-time PCR (qRT-PCR) analysis using PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Dalian, China) with Oligo dT Primer.
2.6. Real-time PCR analysis of mRNA expression PcToll4 and PcALF1–11 mRNA expressions were detected by SYBR Green fluorescent qRT-PCR to detect the RNAi efficiency. The gene-specific primers, PcToll4-RT-F and PcToll4-RT-R, were used to analyze the changes in the mRNA expression of PcToll4 at 24, 36, and 48 h post WSSV challenge in the intestine of P. clarkii after siRNA injection. Moreover, the mRNA expressions of PcALF1–11 from PcToll4 silencing P. clarkii were analyzed using 11 pairs of primers (i.e., PcALF1-RT-F and PcALF1-RT-R; PcALF2-RT-F and PcALF2-RT-R; PcALF3-RT-F and PcALF3-RT-R; PcALF4-RT-F and PcALF4-RT-R; PcALF5-RT-F and PcALF5-RT-R; PcALF6-RT-F and PcALF6-RT-R; PcALF7-RT-F and PcALF7-RT-R; PcALF8-RT-F and PcALF8-RT-R; PcALF9-RT-F and PcALF9-RT-R; PcALF10-RT-F and PcALF10-RT-R; and PcALF11-RT-F and PcALF11-RT-R). qRT-PCR was performed using SYBR Premix Ex TaqTM II (Tli RNaseH Plus) (Takara, Dalian, China) following the manufacturer's instructions. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control and was amplified with the specific primers PcGAPDH-RT-F and PcGAPDH-RT-R. qRTPCR analysis was repeated thrice for all the samples. 2− ΔΔCT methods were used to analyze the expression levels of PcToll4 and ALFs (Livak and Schmittgen, 2001). The bars indicate the mean ± standard error (S.E) in terms of relative mRNA expression. The unpaired sample ttest was performed as the statistical analysis, and the differences were considered significant when P b 0.05. The primers used are presented in Table 1.
2.7. Dual luciferase activity assay in S2 cells The expression vectors for full-length PcToll4 were constructed using pAc5.1/V5-His B (Invitrogen, USA), and the PCR products were amplified with primers PcToll4-pAc-F and PcToll4-pAc-R (Table 1). After double digestion with Kpn І/Apa І (Takara, Dalian, China), the PCR products were ligated into the expression vectors, and the positive clones were sequenced to ensure correct insertion. Considering the unavailability of a crayfish cell line, S2 cells were used to study the activation of AMP expression of PcToll4 protein. S2 cells were maintained at 27 °C in Drosophila SDM (serum-free medium; Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen). For DNA transfection, the cells were seeded overnight and the plasmids were transfected using Cellfectin II reagent (Invitrogen) according to the manufacturer's instructions. For dualluciferase reporter assays, S2 cells in 96-well plates (TPP, Switzerland) were transfected using 0.3 μg expression plasmids, 0.2 μg reporter gene plasmids, and 0.02 μg pRL-TK renilla luciferase plasmid (Promega, USA) as the internal controls. The reporter gene plasmids
Fig. 1. Schematic representation of domain topology of PcToll4.
Y. Huang et al. / Gene 610 (2017) 140–147
were constructed using the promoter sequences of the following genes: Penaeidin-4 (PEN4), metchnikowin (Mtk), drosomycin (Drs), and attacin A (Atta). All assays were performed with three independent transfections. At 36 h post-transfection, firefly and renilla luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega, USA).
143
3. Results 3.1. Identification of PcToll4 and ALFs in P. clarkii One Toll and 11 different forms of ALF genes were identified from P. clarkii. In the previous study, 3 Tolls were identified in the P. clarkii.
Fig. 2. Phylogenetic analysis of PcToll4 and other representative Toll proteins. Amyelois transitella Toll: Accession No. XP_013193694.1; Apis florea Toll: Accession No. XP_012343212.1; Anopheles gambiae Toll6: Accession No. AAL37902.1; Athalia rosae Toll: Accession No. XP_012267088.1; Bactrocera cucurbitae Toll: Accession No. XP_011180117.1; Bombus impatiens Toll: Accession No. XP_003489076.1; Bombus terrestris Toll: Accession No. XP_003398203.1; Bombyx mori Toll: Accession No. XP_012553339.1; Camponotus floridanus Toll: Accession No. XP_011258081.1; C. maenas Toll: Accession No. CDO91661.1; Cimex lectularius Toll: Accession No. XP_014260332.1; Culex quinquefasciatus Toll: Accession No. XP_001868788.1; Dendroctonus ponderosae Toll: Accession No. ENN73923.1; Diachasma alloeum Toll: Accession No. XP_015117268.1; Dinoponera quadriceps Toll: Accession No. XP_014488182.1; Drosophila busckii Toll: Accession No. ALC44674.1; D. melanogaster Toll: Accession No. NP_524757.1; E. sinensis Toll, Toll2: Accession No. AGK90305.1, AGT21374.1; F. chinensis Toll: Accession No. ABQ59330.1; Fopius arisanus Toll: Accession No. XP_011297545.1; Halyomorpha halys Toll: Accession No. XP_014271067.1; Ixodes scapularis Toll: Accession No. XP_002400628.1; Lasius niger Toll: Accession No. KMQ92053.1; L. vannamei Toll, Toll2, Toll3: Accession No. ABK58729.1, AEK86516.1, AEK86517.1; Lucilia cuprina Toll: Accession No. KNC30228.1; Macaca fascicularis Toll6: Accession No. EHH53614.1; M. rosenbergii Toll, Toll3: Accession No. AEI25533.1, AHL39102.1; M. japonicus Toll: Accession No. BAF99007.1; Megachile rotundata Toll: Accession No. XP_003706797.1; Melipona quadrifasciata Toll: Accession No. KOX77951.1; Microplitis demolitor Toll: Accession No. XP_008560218.1; Musca domestica Toll: Accession No. XP_005177269.2; Nasonia vitripennis Toll: Accession No. XP_001603014.1; Nilaparvata lugens Toll6: Accession No. AGK40935.1; Operophtera brumata Toll: Accession No. KOB67759.1; Papilio machaon Toll: Accession No. XP_014359363.1; Papilio polytes Toll: Accession No. XP_013138281.1; Papilio xuthus Toll: Accession No. KPI94120.1; Pediculus humanus corporis Toll: Accession No. XP_002424097.1; P. monodon Toll: Accession No. ADK55066.1; Plutella xylostella Toll: Accession No. XP_011555620.1; Polistes canadensis Toll: Accession No. XP_014604069.1; Pogonomyrmex barbatus Toll: Accession No. XP_011647219.1; Polistes dominula Toll: Accession No. XP_015173202.1; P. trituberculatus Toll1, Toll2: Accession No. AKV62617.1, AIZ66853.1; Scylla serrata Toll: Accession No. AGG55849.1; Solenopsis invicta Toll: Accession No. XP_011167002.1; Stomoxys calcitrans Toll: Accession No. XP_013102091.1; Tribolium castaneum Toll: Accession No. XP_971999.1; Vollenhovia emeryi Toll: Accession No. XP_011873165.1; Zootermopsis nevadensis Toll: Accession No. KDR21043.1.
144
Y. Huang et al. / Gene 610 (2017) 140–147
Fig. 3. qRT-PCR analysis of PcToll4 in the hemocytes, heart, hepatopancreas, gills, stomach, and intestine of crayfish (left). Time-course analysis of PcToll4 expression pattern in the intestine of WSSV challenged crayfish from 0 (unchallenged) to 72 h by qRT-PCR (right). Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with that of the control. Each bar represents the mean value from five determinations with standard deviation.
Thus, the identified Toll in this study was designated as PcToll4 (KU680805). The 11 ALF genes were designated as PcALF1 (KU680792), PcALF2 (KU680793), PcALF3 (KU680794), PcALF4 (KU680795), PcALF5 (KU680796), PcALF6 (KU680797), PcALF7 (KU680798), PcALF8 (KU680799), PcALF9 (KU680800), PcALF10 (KU680801), and PcALF11 (KU680802). The complete cDNA sequence of PcToll4 is 4849 bp long, including a 3036 bp open reading frame that encodes a 1011 amino acid protein, a 324 bp 5′-untranslated region (UTR), and a 1489 bp 3′-UTR with a poly (A) tail. The nucleotide and deduced amino acid sequences of PcToll4 are presented in Fig. S1. SMART analysis shows that the PcToll4 protein contains a signal peptide of 20 amino acids (aa), 13 LRR domains with an aa length of 20 to 27, three 24 aa LRR TYP domains, 2 LRR CT domains of 62 and 48 aa, one 38 aa LRR NT domain, one 23 aa transmembrane domain, and one 139 aa TIR domain (Fig. 1). The molecular weight and isoelectric point of PcToll4 are 115.9 kDa and 5.84, respectively. The complete cDNA sequences of the 11 PcALFs were 1271, 687, 1178, 1370, 827, 1545, 552, 1258, 735, 1248, and 1396 bp, respectively. These 11 PcALFs have encoded proteins of 122, 123, 122, 130, 118, 123, 122, 122, 123, 242, and 123 amino acids, respectively. 3.2. Phylogenetic analysis
of PcALF1, PcALF3, and PcALF4 were determined by aligning the genomic DNA sequences with the corresponding cDNA genes. The genomic structure of PcALF1 was similar to that of PcALF4; both contain four exons interrupted by three introns. By contrast, PcALF3 contains three exons interrupted by two introns. The genomic sequence of the PcALF1 gene is 3502 bp long, including four exons with lengths of 376, 152, 134, and 116 bp and three introns with lengths of 317, 775, and 1632 bp. The four exons of PcALF4 have lengths of 622, 162, 137, and 116 bp, and the three introns have lengths of 370, 626, and 1405 bp. The PcALF3 gene is 1563 bp long, including three exons with lengths of 119, 134, and 116 bp, and two introns with lengths of 101 and 1093 bp. The exon-intron boundaries of the genomic sequences of PcALF1, PcALF3, and PcALF4 are GT at 5′ splice sites and AG at 3′ splice sites. 3.4. Tissue distribution and expression profiles of PcToll4 qRT-PCR analysis showed that PcToll4 was expressed in all detected tissues. PcToll4 was mainly expressed in the intestine, and was also detected in gills, hepatopancreas, heart, hemocytes, and stomach (Fig. 3). The expression profiles of PcToll4 in the intestine were further examined after the WSSV challenge (Fig. 3). PcToll4 mRNA increased at 24 h, and the highest expression level of PcToll4 was observed at 36 h upon
To explore the evolutionary dynamics of PcToll4, 60 Toll amino acid sequences were used to construct a phylogenetic tree. PcToll4 was clustered with the crustacean Tolls from Eriocheir sinensis, Carcinus maenas, Portunus trituberculatus, Scylla serrate, L. vannamei, and M. japonicas (Fig. 2) and not with the previously reported Tolls from P. clarkii. A total of 70 ALFs from crustaceans, including shrimp, freshwater crayfish, crayfish, and crab, were used in the phylogenetic analysis (Fig. S2A). In the phylogenetic tree, 11 PcALFs were clustered into different groups. PcALF1, PcALF2, PcALF3, and Pacifastacus leniusculus ALF belong to one cluster. PcALF4, ALF5 from P. trituberculatus, and ALF3 from Scylla paramamosain belong to one group. PcALF5, PcALF8, PcALF11, and ALF1 from F. chinensis and L. vannamei belong to one clade. PcALF6, ALF from L. stylirostris, and ALF6 from F. chinensis are clustered into one group. PcALF7, ALF6 from P. monodon, and ALF2 from F. chinensis belong to one cluster. PcALF10 and ALF3 from M. rosenbergii belong to one group. 3.3. Genomic organization of PcALF1, PcALF3, and PcALF4 Although 11 different ALF genes were found in the crayfish, the genomic sequences of only 3 ALFs were obtained. The genomic sequences of PcALF1, PcALF3, and PcALF4 were amplified to identify their corresponding genomic structures (Fig. S2B). The intron-exon boundaries
Fig. 4. Activation of Drosophila (Mtk, Drs, Atta,) and shrimp (Pen4) AMPs by overexpression of PcToll4 in Drosophila S2 cells. All data are representative of three independent experiments. The bars indicate the mean ± SD of the luciferase activities (n = 3). The statistical significance was calculated by an unpaired sample t-test (*P b 0.05, **P b 0.01).
Y. Huang et al. / Gene 610 (2017) 140–147
WSSV challenge. Thereafter, its expression gradually decreased from 48 to 72 h. No significant changes were observed in the PBS-treated group. 3.5. Overexpression of PcToll4 in Drosophila S2 cells The present study reveals that PcToll4 significantly activates the promoters of Drosophila or L. vannamei AMP genes (Fig. 4). PcToll4 induces the promoter activities of the AMP Pen4 (8.1-fold), Mtk (7.1-fold), Drs (4.1-fold), and Atta (6.7-fold). 3.6. Silencing efficiency of siRNA The expression of PcToll4 in the siRNA interference group was significantly suppressed in the intestine of P. clarkii at 24, 36, and 48 h when compared with that of the WSSV group (i.e., the control group was only injected with WSSV). By contrast, the control siRNA-scrambled has no effect on the gene expression, showing that the effect of siRNA to PcToll4 is highly specific.
145
3.7. PcToll4 controlled ALFs transcription During the knockdown of the expression of the PcToll4 gene in the intestine of crayfish, the ALF expression levels were detected using qRT-PCR. As shown in Fig. 5, five ALFs (PcALF1, PcALF2, PcALF4, PcALF7, and PcALF10) were significantly upregulated after the WSSV challenge. When the expression of PcToll4 was knocked down by siRNA, the transcription levels of these five ALFs were downregulated. However, the expressions of other ALFs did not change significantly (data not shown). Silencing PcToll4 may downregulate different PcALFs transcriptions; thus, we predict that PcToll4 has important roles in regulating the induction of PcALFs in freshwater crayfish challenged with WSSV. 4. Discussion The Toll pathway is one of the most important signaling pathways of the innate immune response of invertebrates. In this study, a novel Toll gene PcToll4 was first identified from the intestinal transcriptome of P. clarkii. The intestine is the largest compartment of the immune system
Fig. 5. Expression analysis of ALFs at 24, 36, and 48 h WSSV challenge in the intestine of P. clarkii (PcToll4 knockdown). The sequence-specific PcToll4-siRNA was injected into shrimp to knock down the expression of PcToll4. The mRNA expressions of PcALF1–11 from PcToll4 silencing P. clarkii were analyzed using quantitative real-time PCR. PcToll4-siRNA-scrambled was included in the injections as a control. WSSV alone was used as a positive control. Asterisks indicate significant differences (*P b 0.05, **P b 0.01, ***P b 0.001) compared with the control.
146
Y. Huang et al. / Gene 610 (2017) 140–147
and is continuously bombarded by an enormous variety of microbes, including pathogens. As a result, a complex array of immune effector mechanisms is present in the gut, many of which are distinct from their counterparts in other parts of the body (Mowat, 2011). The highest level of PcToll4 mRNA was detected in the intestine, which might be closely related to its biological functions in the innate immune response of crayfish. The expression profiles of PcToll4 in response to WSSV were investigated in the intestine of freshwater crayfish to better understand the response and role of PcToll4 in host defense against WSSV. The results reveal that PcToll4 is involved in anti-viral immune response. After WSSV challenge, three different Tolls (LvToll1, LvToll2, and LvToll3) identified in L. vannamei were also upregulated (Wang et al., 2012). In P. trituberculatus, WSSV induces the expression of PtToll2 but suppresses the transcription of PtToll3 (Zhou et al., 2015). The insect Toll pathway exhibits anti-bacterial, anti-fungal, and antiviral functions by regulating the expression of immune-related genes, including AMPs (Lemaitre and Hoffmann, 2007). ALF is a kind of AMPs and a total of 11 ALF genes were found in P. clarkii. Seven ALF isoforms (PtALF1–7) were isolated from P. trituberculatus and showed different expression profiles (Liu et al., 2011; Liu et al., 2012a; Liu et al., 2012b; Liu et al., 2013a; Liu et al., 2013b). These different isoforms are either encoded by distinct genes or generated by alternative mRNA splicing (Tharntada et al., 2008). In order to reveal the relationship between PcToll4 and 11 ALF genes, RNAi experiments were performed. RNAi results show that PcToll4 regulates 5 ALF expressions in intestine of P. clarkii during WSSV infection. In most of the previous research, ALFs were reported to have a vital role in the immune defense against bacterial infections. The recombinant PtALF5 protein from P. trituberculatus reveals an antimicrobial activity against gram-negative bacteria V. alginolyticus and Pseudomonas aeruginosa (Liu et al., 2012b), and SpALF4 is a potent immune effector that provides multiple protective functions against invading bacteria or fungus in S. paramamosain (Zhu et al., 2014). The synthetic peptides corresponding to the LPS-binding domain (LBD) of SpALF1 from S. paramamosain and ALF55–76 of the giant tiger shrimp P. monodon inhibits the growth of gram-negative and gram-positive bacteria (Imjongjirak et al., 2007; Pan et al., 2007). In L. vannamei, an ALF gene protected the shrimp from both bacterial (Vibrio penaeicida) and fungal (Fusarium oxysporum) infections (Vega et al., 2008). Although most research focused on the anti-bacteria function of crustaceans ALFs, ALFs were also reported to participate in anti-viral immune defense. Silencing the ALF gene enhanced the expression of VP28 gene, the WSSV envelope protein gene, in cultured hematopoietic tissue (Hpt) cells of P. leniusculus (Liu et al., 2006). In the red claw crayfish Cherax quadricarinatus, pre-incubation of WSSV with recombinant CqALF protein resulted in both a significant reduction in WSSV replication in Hpt cell cultures and an increased survival rate of animals (Lin et al., 2016). Different isoforms of ALF from F. chinensis played a key role in inhibiting WSSV replication, and might function as potential therapeutic drugs against WSSV (Li et al., 2015). P. monodon ALFPm3 displayed direct effect on the viral structural proteins and finally resulted in breaking up of WSSV virions (Methatham et al., 2017). So, multiple ALF genes from crustaceans showed anti-viral functions. In our research, the results showed that at least 5 ALF genes regulated by PcToll4 participated in crayfish anti-viral processes. Overexpression experiments were conducted on Drosophila S2 cells to further confirm the roles of PcToll4 in AMP genes expression. The overexpression of PcToll4 in S2 cells activated the expression of Drosophila AMPs, including Mtk, Drs, Atta, and shrimp Pen4. In L. vannamei, LvToll2 could activate the promoters of the NF-κB-pathway-controlled AMP genes in Drosophila S2 cells (Wang et al., 2012). Overexpression of HcTIR1 or HcTIR2 (TIR: intracellular Toll/interleukin-1 receptor) of HcToll2 from H. cumingii could both induced expression of AMP genes in S2 cells (Ren et al., 2014). Penaeidins are a unique family of AMPs that is found only in penaeid shrimp (de Lorgeril et al., 2008, Han-Ching Wang et al., 2010). So, it could reveal that PcToll4 had important roles in regulating the AMP genes expression from both RNAi and overexpression experiments.
In summary, this study first reported the presence of another Toll gene (PcToll4) and a total of 11 ALF genes in P. clarkii. RNAi analysis and overexpression assay both revealed the role of PcToll4 in regulating the expressions of AMP genes. Our results also suggested that PcToll4 participated in innate immune defense against WSSV through regulating the expressions of ALF genes in intestine of the crayfish.
Acknowledgements This study was supported by the National Natural Science Foundation of China (Grant No. 31572647), the Natural Science Fund of Colleges and universities in Jiangsu Province (16KJD240001, 14KJA240002), the Graduate Students Research and Innovation Program of Jiangsu Province (KYZZ15_0214), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (RAPD).
Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2017.02.018.
References Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Anderson, K.V., Nüsslein-Volhard, C., 1983. Information for the dorsal-ventral pattern of the Drosophila embryo is stored as maternal mRNA. Nature 311, 223–227. Arts, J.A., Cornelissen, F.H., Cijsouw, T., Hermsen, T., Savelkoul, H.F., Stet, R.J., 2007. Molecular cloning and expression of a toll receptor in the giant tiger shrimp, Penaeus monodon. Fish Shellfish Immunol. 23, 504–513. Beale, K.M., Towle, D.W., Jayasundara, N., Smith, C.M., Shields, J.D., Small, H.J., 2008. Antilipopolysaccharide factors in the American lobster Homarus americanus: molecular characterization and transcriptional response to Vibrio fluvialis challenge. Comp. Biochem. Physiol. Part D Genomics Proteomics 3, 263–269. Bowie, A., O'Neill, L.A., 2000. The interleukin-1 receptor/toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products. J. Leukoc. Biol. 67, 508–514. Coscia, M.R., Giacomelli, S., Oreste, U., 2011. Toll-like receptors: an overview from invertebrates to vertebrates. Invertebr. Surviv. J. 8, 210–226. de Lorgeril, J., Gueguen, Y., Goarant, C., Goyard, E., Mugnier, C., Fievet, J., 2008. A relationship between antimicrobial peptide gene expression and capacity of a selected shrimp line to survive a Vibrio infection. Mol. Immunol. 45, 3438–3445. Hancock, R.E., Brown, K.L., Mookherjee, N., 2006. Host defence peptides from invertebrates-emerging antimicrobial strategies. Immunobiology 211, 315–322. Han-Ching Wang, K., Tseng, C.W., Lin, H.Y., Chen, I.T., Chen, Y.H., Chen, Y.M., 2010. RNAi knock-down of the Litopenaeus vannamei toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev. Comp. Immunol. 34, 49–58. Huang, Y., Chen, Y.H., Wang, Z., Wang, W., Ren, Q., 2014. Novel myeloid differentiation factor 88, EsMyD88, exhibits EsTube-binding activity in Chinese mitten crab Eriocheir sinensis. Dev. Comp. Immunol. 47, 298–308. Imjongjirak, C., Amparyup, P., Tassanakajon, A., Sittipraneed, S., 2007. Anti-lipopolysaccharide factor (ALF) of mud crab Scylla paramamosain: molecular cloning, genomic organization and the antimicrobial activity of its synthetic LPS binding domain. Mol. Immunol. 44, 3195–3203. Janeway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Kawai, T., Akira, S., 2011. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 34, 637–650. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Li, S., Guo, S., Li, F., Xiang, J., 2014. Characterization and function analysis of an anti-lipopolysaccharide factor (ALF) from the Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 46, 349–355. Li, S., Guo, S., Li, F., Xiang, J., 2015. Functional diversity of anti-lipopolysaccharide factor isoforms in shrimp and their characters related to antiviral activity. Mar. Drugs 13 (5), 2602–2616. Li, S.H., Zhang, X.J., Sun, Z., Li, F.H., Xiang, J.H., 2013. Transcriptome analysis on Chinese shrimp Fenneropenaeus chinensis during WSSV acute infection. PLoS One 8, e58627. Liang, T., Ji, H., Lian, L., Wu, T., Gu, W., Wang, W., 2010. A rapid assay for simultaneous detection of Spiroplasma eriocheiris and white spot syndrome virus in Procambarus clarkii by multiplex PCR. Lett. Appl. Microbiol. 51, 532–538. Lin, F.Y., Gao, Y., Wang, H., Zhang, Q.X., Zeng, C.L., Liu, H.P., 2016. Identification of an antilipopolysacchride factor possessing both antiviral and antibacterial activity from the red claw crayfish Cherax quadricarinatus. Fish Shellfish Immunol. 57, 213–221.
Y. Huang et al. / Gene 610 (2017) 140–147 Liu, H.P., Jiravanichpaisal, P., Söderhäll, I., Cerenius, L., Söderhäll, K., 2006. Antilipopolysaccharide factor interferes with white spot syndrome virus replication in vitro and in vivo in the crayfish Pacifastacus leniusculus. J. Virol. 80, 10365–10371. Liu, Y., Cui, Z., Li, X., Song, C., Li, Q., Wang, S., 2012a. A new anti-lipopolysaccharide factor isoform (PtALF4) from the swimming crab Portunus trituberculatus exhibited structural and functional diversity of ALFs. Fish Shellfish Immunol. 32, 724–731. Liu, Y., Cui, Z., Li, X., Song, C., Li, Q., Wang, S., 2012b. Molecular cloning, expression pattern and antimicrobial activity of a new isoform of anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 33, 85–91. Liu, Y., Cui, Z., Li, X., Song, C., Shi, G., 2013a. A newly identified anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus with broad spectrum antimicrobial activity. Fish Shellfish Immunol. 34, 463–470. Liu, Y., Cui, Z., Li, X., Song, C., Shi, G., Wang, C., 2013b. Molecular cloning, genomic structure and antimicrobial activity of PtALF7, a unique isoform of anti-lipopolysaccharide factor from the swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 34, 652–659. Liu, Y., Cui, Z., Luan, W., Song, C., Nie, Q., Wang, S., 2011. Three isoforms of anti-lipopolysaccharide factor identified from eyestalk cDNA library of swimming crab Portunus trituberculatus. Fish Shellfish Immunol. 30, 583–591. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−ΔΔC(T)) method. Methods 25, 402–408. Medzhitov, R., Janeway Jr., C.A., 2000. Innate immunity. N. Engl. J. Med. 343, 338–344. Mekata, T., Kono, T., Yoshida, T., Sakai, M., Itami, T., 2008. Identification of cDNA encoding toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicas. Fish Shellfish Immunol. 24, 122–133. Methatham, T., Boonchuen, P., Jaree, P., Tassanakajon, A., Somboonwiwat, K., 2017. Antiviral action of the antimicrobial peptide ALFPm3 from Penaeus monodon against white spot syndrome virus. Dev. Comp. Immunol. 69, 23–32. Morita, T., Ohtsubo, S., Nakamura, T., Tanaka, S., Iwanaga, S., Ohashi, K., 1985. Isolation and biological activities of limulus anticoagulant (anti-LPS factor) which interacts with lipopolysaccharide (LPS). J. Biochem. 97, 1611–1620. Mowat, A., 2011. Innate immunity in the intestine. J. Innate Immun. 3, 541–542. Pan, C.Y., Chao, T.T., Chen, J.C., Chen, J.Y., Liu, W.C., Lin, C.H., 2007. Shrimp (Penaeus monodon) anti-lipopolysaccharide factor reduces the lethality of Pseudomonas aeruginosa sepsis in mice. Int. Immunopharmacol. 7, 687–700. Ren, Q., Lan, J.F., Zhong, X., Song, X.J., Ma, F., Hui, K.M., 2014. A novel toll like receptor with two TIR domains (HcToll-2) is involved in regulation of antimicrobial peptide gene expression of Hyriopsis cumingii. Dev. Comp. Immunol. 45, 198–208. Rutschmann, S., Kilinc, A., Ferrandon, D., 2002. Cutting edge: the toll pathway is required for resistance to gram-positive bacterial infections in Drosophila. J. Immunol. 168, 1542–1546. Silva, N.C., Sarmento, B., Pintado, M., 2013. The importance of antimicrobial peptides and their potential for therapeutic use in ophthalmology. Int. J. Antimicrob. Agents 41, 5–10. Smale, S.T., 2012. Transcriptional regulation in the innate immune system. Curr. Opin. Immunol. 24, 51–57. Soderhall, K., Thornqvist, P.O., 1997. Crustacean immunity short review. Dev. Biol. Stand. 90, 45–51.
147
Srisuk, C., Longyant, S., Senapin, S., Sithigorngul, P., Chaivisuthangkura, P., 2014. Molecular cloning and characterization of a toll receptor gene from Macrobrachium rosenbergii. Fish Shellfish Immunol. 36, 552–562. Sun, C., Xu, W.T., Zhang, H.W., Dong, L.P., Zhang, T., Zhao, X.F., 2011. An antilipopolysaccharide factor from red swamp crayfish, Procambarus clarkii, exhibited antimicrobial activities in vitro and in vivo. Fish Shellfish Immunol. 30, 295–303. Supungul, P., Klinbunga, S., Pichyangkura, R., Hirono, I., Aoki, T., Tassanakajon, A., 2004. Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach. Dis. Aquat. Org. 61, 123–135. Tanaka, S., Nakamura, T., Morita, T., Iwanaga, S., 1982. Anti-LPS factor: an anticoagulant which inhibits the endotoxin-mediated activation of coagulation system. Biochem. Biophys. Res. Commun. 105, 717–723. Tassanakajon, A., Amparyup, P., Somboonwiwat, K., Supungul, P., 2010. Cationic antimicrobial peptides in penaeid shrimp. Mar. Biotechnol. (NY). 12, 487–505. Tharntada, S., Somboonwiwat, K., Rimphanitchayakit, V., Tassanakajon, A., 2008. Anti-lipopolysaccharide factors from the black tiger shrimp, Penaeus monodon, are encoded by two genomic loci. Fish Shellfish Immunol. 24, 46–54. Vega, E., Leary, N.A., Shockey, J.E., Robalino, J., Payne, C., Browdy, C.L., 2008. Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad spectrum antimicrobial peptide essential for shrimp immunity against bacterial and fungal infection. Mol. Immunol. 45, 1916–1925. Wang, P.H., Liang, J.P., Gu, Z.H., Wan, D.H., Weng, S.P., Yu, X.Q., 2012. Molecular cloning, characterization and expression analysis of two novel tolls (LvToll2 and LvToll3) and three putative Spätzle-like toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev. Comp. Immunol. 36, 359–371. Wang, Z., Chen, Y.H., Dai, Y.J., Tan, J.M., Huang, Y., Lan, J.F., 2015. A novel vertebrates tolllike receptor counterpart regulating the anti-microbial peptides expression in the freshwater crayfish, Procambarus clarkii. Fish Shellfish Immunol. 43, 219–229. Warren, H.S., Glennon, M.L., Wainwright, N., Amato, S.F., Black, K.M., Kirsch, S.J., 1992. Binding and neutralization of endotoxin by limulus antilipopolysaccharide factor. Infect. Immun. 60, 2506–2513. Yang, C., Zhang, J., Li, F., Ma, H., Zhang, Q., Jose Priya, T.A., 2008. A toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection. Fish Shellfish Immunol. 24, 564–574. Yang, L.S., Yin, Z.X., Liao, J.X., Huang, X.D., Guo, C.J., Weng, S.P., 2007. A toll receptor in shrimp. Mol. Immunol. 44, 1999–2008. Zhang, Y., Wang, L., Wang, L., Yang, J., Gai, Y., Qiu, L., 2010. The second antilipopolysaccharide factor (EsALF-2) with antimicrobial activity from Eriocheir sinensis. Dev. Comp. Immunol. 34, 945–952. Zhou, S.M., Yuan, X.M., Liu, S., Li, M., Tao, Z., Wang, G.L., 2015. Three novel toll genes (PtToll1-3) identified from a marine crab, Portunus trituberculatus: Different tissue expression and response to pathogens. Fish Shellfish Immunol. 46, 737–744. Zhu, L., Lan, J., Huang, Y., Zhang, C., Zhou, J., Fang, W., 2014. SpALF4: a newly identified anti-lipopolysaccharide factor from the mud crab Scylla paramamosain with broad spectrum antimicrobial activity. Fish Shellfish Immunol. 36, 172–180.