NF-κB pathways in IL-1β-induced rat primary chondrocytes and a rat osteoarthritis model

Biomedicine & Pharmacotherapy 97 (2018) 264–270

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Original article

Aqueous extract of Codium fragile alleviates osteoarthritis through the MAPK/NF-κB pathways in IL-1β-induced rat primary chondrocytes and a rat osteoarthritis model

MARK

Sung-Min Moona,c, Seul Ah Leeb, Seul Hee Hanc, Bo-Ram Parkd, Mi Suk Choid, Jae-Sung Kima, ⁎ Su-Gwan Kima, Heung-Joong Kima, Hong Sung Chune, Do Kyung Kima, Chun Sung Kima,b, a

Oral Biology Research Institute, College of Dentistry, Chosun University, 375 Seosuk-dong, Dong-gu, Gwangju, 501-759, Republic of Korea Department of Oral Biochemistry, College of Dentistry, Chosun University, 375 Seosuk-dong, Dong-gu, Gwangju, 501-759, Republic of Korea CStech Research Institute, 38 Chumdanventuresoro, Gwangju 61007, Republic of Korea d Department of Dental Hygiene, Chodang University, Muan-ro, Muan-eup, Muan 534-701, Republic of Korea e Department of Biomedical Science, Chosun University, 375 Seosuk-dong, Dong-gu, Gwangju, 501-759, Republic of Korea b c

A R T I C L E I N F O

A B S T R A C T

Keywords: Osteoarthritis Codium fragile (Suringar) Hariot Nitric oxide MMP-13 ADAMTS-4 ADAMTS-5 MAPKs NF-κB

Background: Codium fragile (Suringar) Hariot has been used as a potential remedy in traditional medicine because of its anti-inflammatory and anti-oxidant effects. Osteoarthritis is a chronic progressive joint disease, characterized by complex mechanisms related to inflammation and degeneration of articular cartilage. In this study, we aimed to evaluate the cartilage protective effect of an aqueous extract of Codium fragile (AECF) using rat primary chondrocytes and the osteoarthritis animal model induced by destabilization of the medial meniscus (DMM). Methods: In vitro, rat primary cultured chondrocytes were pre-treated with AECF (0.5, 1, and 2 mg/mL) for 1 h and then incubated with interleukin-1β (10 ng/mL) for 24 h. Nitrite production was detected by the Griess reagent. Alteration of the protein levels of iNOS, MMP-13, ADAMTS-4, ADAMTS-5, mitogen-activated protein kinases (MAPKs), and nuclear factor-κB (NF-κB) was detected by western blotting. In vivo, osteoarthritis was induced by DMM of Sprague Dawley (SD) rats. The rats subjected to destabilization of the medial meniscus (DMM) surgery were orally administered with AECF (50, 100, and 200 mg/kg bodyweight) or distilled water for 8 w. The severity of cartilage lesions was evaluated by safranin O staining and the Osteoarthritis Research Society International (OARSI) score. Results: These results demonstrated that AECF significantly inhibited nitrite production and inhibited the levels of iNOS, MMP-13, ADAMTS-4, and ADAMTS-5 in interleukin-1β-induced rat primary cultured chondrocytes. Moreover, AECF suppressed interleukin-1β-induced NF-κB activation in the nucleus and phosphorylation of ERK1/2 and JNK in the cytosol. In vivo, the cartilage lesions in AECF‐treated osteoarthritis rats exhibited less proteoglycan loss and lower OARSI scores. Conclusions: These results suggested that AECF is a potential therapeutic agent for the alleviation of osteoarthritis progression.

1. Introduction Osteoarthritis (OA) is one of the most common joint diseases and is characterized by articular cartilage degeneration, joint pain, and dysfunction [1]. The progression of OA is characterized by pathological changes, such as destruction of the articular cartilage, synovium inflammation, subchondral bone sclerosis, and osteophyte formation, leading to severe joint pain and loss of movement [2,3]. However, the etiology of OA is not clear; extracellular matrix (ECM) degradation and ⁎

synovial fluid inflammation in articular cartilage were thought to be closely related to the pathogenesis of OA [4]. Currently, there are few effective treatments for joint diseases such as OA, e.g., joint replacement surgery [5]. Therefore, there is an urgent need to find an effective treatment to alleviate the progression of OA. Furthermore, molecular therapy for the progression of OA will become an important research direction in the future. The exact mechanism of the progression of OA is still unclear; however, an inflammatory response in the joint is thought to be involved [6]. Inflammation directly stimulates the catabolic

Corresponding author at: Department of Oral Biochemistry, College of Dentistry, Chosun University, 375 Seosuk−dong, Dong−gu, Gwangju, 501−759, Republic of Korea. E-mail address: [email protected] (C.S. Kim).

http://dx.doi.org/10.1016/j.biopha.2017.10.130 Received 30 August 2017; Received in revised form 12 October 2017; Accepted 23 October 2017 0753-3322/ © 2017 Elsevier Masson SAS. All rights reserved.

Biomedicine & Pharmacotherapy 97 (2018) 264–270

S.-M. Moon et al.

fragile (100 g) sample was homogenized using a grinder and extracted with 50 volumes of distilled water at 90 °C for 4 h. This was followed by filtration utilizing a 55-μm bag filter, evaporation, and then lyophilization. The dry extract powder (8 g) was dissolved in distilled water (100 mg/mL), and the resulting solution was filtered using a 0.2-μm syringe filter before use.

effects of chondrocytes, which eventually results in the degradation of ECM [7]. Overproduction of pro-inflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α play important roles in the progression of OA [8]. Among these inflammatory cytokines, IL-1β plays a crucial catabolic role in ECM degradation, in that it can trigger chondrocytes to induce the expression of matrix metalloproteinases (MMPs), a disintegrin, metalloproteinase with thrombospondin motifs (ADAMTS), and other catabolic enzymes [9]. There are two predominant matrix-degrading enzymes that can hydrolyze aggrecan core proteins; the MMPs and ADAMTS families [10]. The involvement of the ADAMTS family is inferred from their participation in the degradation of aggrecan in articular cartilage [11]. MMPs comprise at least 20 structurally related zinc metalloproteinases capable of degrading ECM components [12]. Among these MMPs, MMP-1, −2, −3, −7, −8, −9, and −13 are expressed in the articular cartilage of OA patients [13]. Moreover, several members of the ADAMTS family influence the progression of OA. Among 19 members of the ADAMTS family, ADAMTS-1, ADAMTS-4, ADAMTS-5, ADAMTS-8, and ADAMTS9 have been shown to degrade proteoglycan in joint tissues of patients with OA [14]. IL-1β induces the activation of pro-inflammatory transcriptional factor nuclear factor-κB (NF-κB) through phosphorylation of IκB kinase (IKK) and IκB [15]. Activation of NF-κB induces inflammation-related gene expression, such as those encoding the MMPs and ADAMTS families [16]. Transcriptional activation of MMPs and ADAMTS family genes induced by IL-1β is also mediated by the transcriptional factor interferon regulatory factor-1 (IRF-1), which is expressed at a significantly higher level in OA chondrocytes compared to that in normal chondrocytes [17]. The NF-κB signaling pathway plays a crucial role in the regulation of inflammatory mediators related to the pathogenesis of OA [18]. NF-κB is localized in the cytoplasm as an inactive transcription factor that is associated with IκB. Upon phosphorylation to NF-κBp65, induced by IL-1β, NF-κB dissociates from IκB and is translocated to the nucleus as an active transcription factor to regulate the inflammatory response [19]. Besides, NF-κB inhibitors have been reported to reduce the expression of MMP-3 and MMP-13, which are overexpressed in response to IL-1β in human chondrocytes [20]. In addition, phosphorylation of extracellular signal-regulated kinase (ERK) −1/2, c-Jun N terminal kinase (JNK), and p38 is involved in catabolic and inflammatory responses [21]. Green algae provide a wide range of natural products with pharmacological activities, such as anti‐inflammatory, anti-oxidative, anticancer, and anti-nociceptive effects [22]. Codium fragile (Suringar) Hariot (C. fragile) is an edible algae belonging to the Codiaceae that is widely distributed on the coasts of East Asia, Oceania, and Northern Europe. In Korea, C. fragile is a green algae used as a culinary ingredient and has been used in traditional medicine to treat enterobiasis, dropsy, and dysuria [23]. Several studies have reported that ethanol and methanol extracts of C. fragile have anti-inflammatory, anti-oxidative, and anti-cancer properties [24,25]. Recently, Lee et al. demonstrated that an aqueous extract of C. fragile (AECF) showed non-cytotoxic anti-inflammatory effects by inhibiting NF-kB activation in RAW264.7 cells [26]. Therefore, the anti-inflammatory effect of AECF could provide protection from the progression of OA. However, the protective effect and molecular mechanisms of AECF for articular cartilage are unknown. In this study, we investigated the cellular mechanism and antiosteoarthritis activities of AECF both in vitro and in vivo.

2.2. Reagents 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), sulfanilamide, N-(1-naphthyl) ethylendiamine dihydrochloride, and phosphoric acid were purchased form Sigma-Aldrich Co. (St. Louis, MO, USA). Dulbecco’s Modified Eagle’s medium/Nutrient Mixture F-12, 1:1 Mixture (DMEM/F12) and penicillin-streptomycin solution were purchased from WelGene (Deagu, Republic of Korea). Fetal bovine serum (FBS) was purchased from Corning (Corning, NY, USA). Interleukin-1 beta (IL-1β) was purchased from Prospec (Prospec, Israel). 2.3. Cell culture and viability assay The tibial and femoral cartilages of 5-day-old Sprague-Dawley (SD) rats were dissected, added to 10 mL of 3% (w/v) collagenase Type II and digested for 45 min at 37 °C, two times. The cartilage pieces were retrieved and placed in 10 mL of collagenase Type II solution at 0.5 mg/ mL overnight at 37 °C. Chondrocytes were cultured at 37 °C in a 5% CO2-humidified incubator in DMEM/F12 containing 10% FBS and 1% penicillin/streptomycin. For the analysis of cell viability, chondrocytes were seeded at 2 × 105 cells/mL, incubated for 5 days, and treated with varying concentrations (0.5, 1, 2, and 3 mg/mL) of AECF for 24 h. Following incubation, cell viability was determined using the MTT assay. 2.4. Nitric oxide (NO) assay Chondrocytes were seeded at 2 × 105 cells/mL in 12-well plates. Chondrocytes were pretreated with varying concentrations (0.5, 1, 2, and 3 mg/mL) of AECF for 1 h and subsequently cultured with IL-1β (20 ng/mL) for 24 h. Nitrite accumulation in the culture medium was measured as an indicator of NO production, based on the Griess reaction. In brief, 100 μL of each supernatant from AECF-treated samples was mixed with an equal volume of Griess reagent (1% (w/v) sulfanilamide in 5% (v/v) phosphoric acid and 0.1% (w/v) naphthylethylenediamine) in a dark room for 10 min. Absorbance was then measured at 540 nm on a microplate reader (Epoch Bioteck; Bio-Tek Instruments Inc., Winooski, VT, USA). The nitrite concentration was determined by comparison with a standard curve of sodium nitrite. 2.5. Isolation of total RNA and reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA was isolated from chondrocytes using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using 1 μg of total RNA and a PrimeScript™ 1 st strand cDNA Synthesis kit (Takara Bio Inc., Otsu, Japan). cDNA was amplified via PCR using the following primers: rat Mmp13 (562 bp) sense 5′- GGCAAAAGCCATTTCATGCTCC CA-3′ and antisense 5′- AGACAGCATCTACTTTGTCGCCA-3′, rat Gapdh (578 bp) sense 5′- TGGTGCTGAGTATGTCG TGGAGTC-3′ and antisense 5′- AGACAACCTGGTCCTCA GTGTAGC-3′. The PCR results were visualized via agarose gel electrophoresis. Deviations in the samples represent data from three independent experiments. β-actin was used as an internal control to evaluate relative expression of Mmp13.

2. Materials and methods 2.1. Preparation of AECF

2.6. Western blotting analysis

Fresh C. fragile (1 kg) was collected along the coast of Wando, Korea, in June 2016, washed three times with tap water to remove salt, epiphytes, and sand attached to the surface. The washed C. fragile is dried using an air supplied dryer oven at 50 °C for 48 h. The dried of C.

Cells were lysed using a protein extraction reagent (iNtRON Biotechnology, Seoul, Republic of Korea) for 30 min on ice. The 265

Biomedicine & Pharmacotherapy 97 (2018) 264–270

S.-M. Moon et al.

supernatant was transferred to a new tube after centrifugation at 12,000 × g for 15 min at 4 °C (Sorvall centrifuge, Bad Homburg, Germany). Protein concentrations were quantified using the BCA protein assay (Pierce, Rockford, IL, USA) with BSA as a standard. Approximately 20 μg of protein from each lysate was solubilized in Laemmli sample buffer and loaded onto 8–16% gradient gels (Invitrogen) or 10% SDS-polyacrylamide gels. Proteins were separated by electrophoresis at 120 V for 90 min. The separated proteins were transferred to a nanofiber membrane containing polyvinylidene difluoride (Amomedi, Gwangju, Korea). Membranes were blocked for 1 h with 5% BSA at room temperature, followed by overnight incubation with primary antibodies comprising anti‐iNOS (Abcam, Cambrige, MA, USA), anti-aggrecan(Abcam, Cambrige, MA, USA), anti-ADAMTS-4 (Abcam, Cambrige, MA, USA), anti-ADAMTS-5 (Abcam, Cambrige, MA, USA), anti-MMP-13 (Abcam, Cambrige, MA, USA), anti-total MAPKs (Cell Signaling Technology, Danvers, MA, USA), anti-phospho-MAPKs (Cell Signaling Technology, Danvers, MA, USA), and anti-β-actin (Santa Cruz Biotechnology, Inc). After washing three times with TBS-T (0.1% Tween-20, 50 μM Tris-HCl pH 7.5, 150 μM NaCl), membranes were incubated for 1 h with secondary antibodies (Santa Cruz Biotechnology) and washed three with TBS-T. Immunoreactive proteins were detected using the Immobilon™ Western Chemilunescent HRP Substrate (Millipore corporation, Billerica, MA, USA.) and visualized using a Microchemi 4.2 device (DNR Bioimaging Systems, Jerusalem, Israel).

2.10. Histological analysis and scoring

2.7. Zymography

3.1. Effect of AECF on cytotoxicity of rat primary cultured chondrocytes

Approximately 30 μL of media was solubilized in 4 × non-reducing sample dye (250 mM Tris-HCL, pH 6.8; 40% (v/v) glycerol; 8% (w/v) SDS; 0.01% (w/v) bromophenol blue) and loaded onto 8% SDS-polyacrylamide gels with 0.2% (w/v) gelatin or casein. SDS-PAGE was run at 30 V overnight on ice. Following electrophoresis, the gels were removed and placed in 2.5% (w/v) Triton X-100 to renature enzymes for 30 min, three times. The gels were then incubated in 50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7.8, at 37 °C overnight to allow sufficient time for caseinolytic activity to occur. Follow overnight incubation, the gels were incubated with Coomassie stain (0.1% (w/v) Coomassie brilliant Blue R250, 50% (v/v) methanol and 10% (v/v) glacial acetic acid) for 1 h, followed by destaining (40% (v/v) methanol, 10% (v/v) glacial acetic acid) until clear bands were visible, at which time the gels were imaged.

No toxicity was observed at all concentrations. Therefore, 1, 2, and 4 mg/mL of AECF were used for subsequent experiments (Fig. 1).

Animals were sacrificed at 8 weeks following AECF administration. Knee joint samples were fixed in 10% neutral buffered formalin for 3 days at 4 °C. The samples were then decalcified in 0.5 M EDTA (pH 7.4), dehydrated through an alcohol gradient, cleared, and embedded in paraffin blocks. Lateral serial 4-μm-thick sections were cut across the joint and five slides per joint were made. Slide sections were stained with Hematoxylin-Eosin and Safranin-O/Fast Green. The stained sections were photographed digitally under a microscope (Reica) and were scored using the Osteoarthritis Research Society International (OARSI) advanced Osteoarthritis Cartilage Histopathology Assessment System (0–6.5) score in a blind manner to assess cartilage destruction [42]. 2.11. Statistical analysis The results were expressed as the mean ± SD. One-way analysis of variance (ANOVA) followed by Dunnett's t-test was employed for multiple comparisons, using GraphPad Prism (GraphPad Software Inc., La Jolla, CA, USA). Statistical significance was set to *, p < 0.05, **, p < 0.01, # p < 0.05, ## p < 0.01. 3. Results

3.2. Inhibitory effect of AECF on IL-1β-induced nitrite production and iNOS protein expression on rat primary cultured chondrocytes To confirm the anti-inflammatory effects of AECF on IL-1β-induced nitrite production and iNOS expression on rat primary chondrocytes, we assessed whether AECF suppressed nitrite production. Nitrite production in the culture supernatants was measured with the Griess reagent. IL-1β (10 ng/mL) was found to significantly increase nitrite production by 6-fold (24.94 ± 0.48 μM) compared with the control (3.898 ± 0.495 μM). However, 1.0 mg/mL of AECF treatment 2-folds (11.545 ± 0.654 μM) reduced the nitrite production (Fig. 2A). We also assessed whether AECF inhibited iNOS protein level. Cells were pretreated with 0.5, 1, 2 mg/mL of AECF for 1 h and then treated with IL1β (10 ng/mL) for 24 h. The results showed that unstimulated rat primary chondrocytes had an undetectable iNOS protein level; however, treatment with IL-1β caused a marked increase in iNOS protein levels.

2.8. Animals Male SD rats (300–330 g, 10 weeks old) were purchased from the Damool science (Daejeon, Republic of Korea). They were housed in plastic cages under controlled environment conditions; temperature (21 ± 1 °C), humidity (55 ± 5%) and a reversed light-dark cycle (12:12 h) and were supplied pellets and water ad libitum. The rats were acclimatized for 1 week before the experiment to allow environmental adaptation. All the experimental procedures and animal comfort were controlled and approved by the Chosun University Institutional Animal Care and Use Committee (CIACUC2016-S0029). 2.9. DMM-induced OA in rat models The animals (n = 25) were randomly divided into five groups: Sham, OA, and three different doses of AECF (50, 100, and 200 mg/kg, bodyweight) groups. All animals (except Control and Sham groups) underwent surgical operation by destabilization of the medial meniscus (DMM) on the right and left knees to induce OA. In brief, under deep anesthesia with 2.5% isoflurane in oxygen, the knee joint capsule was opened and the medial meniscrotibial ligament (MMTL) was transected with a microsurgical knife without damaging other tissues. A sham operation visualized the MMTL but it was not transected. The day after the DMM surgery, AECF (50, 100, and 200 mg/kg, bodyweight) was orally administered for 8 weeks daily.

Fig. 1. Effects of AECF on the cell viability of rat primary cultured chondrocytes. To evaluate the cytotoxic effect of AECF, rat primary chondrocytes were isolated from the cartilage in knee joints of rat by enzymatic digestion and seeded into six-well culture plates. Chondrocytes were treated with AECF using MTT assay. Cell viability of chondrocytes was not significantly altered by AECF at various concentrations (1, 2, and 4 mg/ mL) for 24 h. Results were expressed as percent of the control. Each data point represents the means ± SD of three independent experiments.

266

Biomedicine & Pharmacotherapy 97 (2018) 264–270

S.-M. Moon et al.

Fig. 2. Inhibitory effects of AECF on IL-1β-induced nitrite production and iNOS protein level in rat primary cultured chondrocytes. Cells were pre-treated with 0.5, 1, 2 mg/mL of AECF for 1 h, followed by co-incubation with IL-1β (10 ng/mL) for 24 h. Nitrite production in the cell culture supernatant was determined by Griess reagent (A) and iNOS protein expression levels confirmed by western blotting (B). β-actin served as an internal control. Quantitative data was analyzed by using image J software. Results were expressed as the means ± SD of three independent experiments. Data are expressed as mean ± S E M. * P < n0.05, ** P < 0.01 compared with the control group, # p < 0.05, ## p < 0.01 compared with the IL-1β alone group.

3.4. Inhibitory effects of AECF on IL-1β-induced aggrecan-degrading enzymes in rat primary cultured chondrocytes

In contrast, 1.0 mg/mL of AECF treatment significantly reduced the nitrite production (Fig. 2A) and inhibited of the iNOS protein level (Fig. 2B).

Cells were pre-treated with AECF for 1 h and subsequently induced with IL-1β (10 ng/mL) for 24 h. IL-1β-induced rat primary chondrocytes showed increased the protein levels of ADAMTS-4, and ADAMTS-5 compared with the control. The increased protein level of ADAMTS-4, and ADAMTS-5 induced by IL-1β was dose‐dependently decreased by AECF pre-treatment (Fig. 4A, B).

3.3. Inhibitory effects of AECF on IL-1β-induced MMP-13 in rat primary cultured chondrocytes We verified the effects of AECF on IL-1β-induced MMP-13 levels using RT-PCR and western blotting analysis. The results showed that IL1β significantly upregulated the mRNA and protein levels of MMP-13 compared with the control group. AECF treatment showed a dose-dependent inhibitory effect on the upregulation of MMP-13 mRNA and protein levels in IL-1β-induced rat primary chondrocytes (Fig. 3A, B). Moreover, we also confirmed the effect of AECF on IL-1β-induced MMP13 activity by zymography. The results showed that AECF reduced the proteolytic activity in IL-1β-induced rat primary chondrocytes (Fig. 3C).

3.5. Effect of AECF on MAPKs and NF-κB in IL-1β-induced rat primary cultured chondrocytes The MAPKs are fundamental regulators in the inflammatory response. We estimated the effect of AECF to stimulate IL-1β-induced phosphorylation of ERK1/2, JNK, and p38 in IL-1β-induced rat primary chondrocytes. Cells were pre-treated with AECF for 1 h and subsequently induced with IL-1β (10 ng/mL) for 24 h. As shown in Fig. 5A,

Fig. 3. Inhibitory effects of AECF on IL-1β-induced MMP-13 in rat primary cultured chondrocytes. Cells were pre-treated with 0.5, 1, 2 mg/mL of AECF for 1 h, followed by co-incubation with IL-1β (10 ng/mL) for 24 h. Total RNA, cell lysates, and conditioned medium were prepared for RT-PCR (A), western blotting (B), and casein zymography (C), respectively. β-actin served as an internal control. Quantitative data was analyzed by using image J software. Results were expressed as the means ± SD of three independent experiments. Data are expressed as mean ± S E M. * P < 0.05, ** P < 0.01 compared with the control group, # p < 0.05, ## p < 0.01 compared with the IL-1β alone group.

267

Biomedicine & Pharmacotherapy 97 (2018) 264–270

S.-M. Moon et al.

Fig. 4. Effects of AECF on ADAMTS-4, and ADAMTS-5 in the IL-1β-induced rat primary cultured chondrocytes. Cells were pre-treated with 0.5, 1, 2 mg/mL of AECF for 1 h, followed by co-incubation with IL-1β (10 ng/mL) for 24 h. The protein expression levels of ADAMTS-4, and ADAMTS-5 were determined by western blotting (A, B). β-actin served as an internal control. Quantitative data was analyzed by using image J software. Results were expressed as the means ± SD of three independent experiments. Data are expressed as mean ± S E M. * P < 0.05, ** P < 0.01 compared with the control group, # p < 0.05, ## p < 0.01 compared with the IL-1β alone group.

NF-κB signaling pathway by preventing nuclear translocation of the NFκB p65 subunit.

IL-1β-induced chondrocytes alone significantly increased the phosphorylation of ERK1/2, JNK, and p38, when compared with the control levels. However, pre-treatment with AECF at 1 mg/mL significantly suppressed the phosphorylation of ERK1/2 and JNK, respectively. In addition, the total protein levels of the MAPKs did not differ among the compared groups. However, activation of p38 was unaffected by AECF. These data suggested that the AECF effectively suppressed ERK1/2 and JNK phosphorylation during the IL-1β −induced inflammatory response in rat primary chondrocytes. NF-κB is also an important transcription factor that stimulates inflammation-related gene expression, such as MMPs and ADAMTS family genes. To estimate NF-κB activity, we investigated the effect of AECF on IL-1β-induced nuclear translocation of the NF-κB p65 subunit using western blotting. As shown in Fig. 5B, IL-1β-induction for 30 min significantly increased the translocation of NF-κB p65 subunit from the cytosol to the nucleus. However, pre-treatment with AECF for 1 h suppressed the nuclear translocation of the NF-κB p65 subunit. These data suggested that AECF suppressed the

3.6. Histological evaluation within the articular cartilage To assess whether AECF has a protective effect against progression of OA in vivo, surgical OA models were established in rats, followed by oral administration AECF (50, 100, and 200 mg/mL bodyweight) or distilled water daily for 8 weeks. Histological analysis of OA was evaluated by Safranin-O staining, Hematoxylin-Eosin staining, and the OARSI score. As shown in Fig. 6A, the non-treated-OA group showed superficial cartilage destruction, cartilage erosion, and marked proteoglycan loss, as compared with the sham control group. However, the AECF-treated OA group showed less proteoglycan loss and cartilage destruction compared with the non-treated-OA group. The OARSI histological scoring system was applied to quantitatively analyze the cartilage degeneration after DMM surgery. The summed and maximal

Fig. 5. Effects of AECF on phosphorylation of MAPKs and NF-κB activation in IL-1β-induced rat primary cultured chondrocytes. Cells were pre-treated with 0.5, 1, 2 mg/mL of AECF for 1 h, followed by co-incubation with IL-1β (10 ng/mL) for 1 h. Phosphorylation of MAPKs (A) and nuclear translocation of the NFκB p65 (B) were determined by western blotting. α- tubulin and Lamin B served as an cytosol and nucleic protein markers, respectively.

268

Biomedicine & Pharmacotherapy 97 (2018) 264–270

S.-M. Moon et al.

Fig. 6. Effects of AECF on cartilage degradation of knee joint of rats at 8 weeks after DMM surgery. After DMM surgery or sham operation, rats were orally administrated with distilled water or AECF (50, 100, 200 mg/kg bodyweight) during following 8 weeks (n = 5 per group). Knee joints were isolated at 8 weeks after surgery and analyzed histologically safranin O–fast green staining (A). Summed and maximal histologic scores for cartilage structure damage were evaluated by OARSI-recommended scoring system (B).

degradation of cartilage in OA patients [8]. IL-1β-treated chondrocytes induced the expression of iNOS, which leads to the production of NO. High levels of NO have been reported in various pathological findings in patients with OA [28]. Therefore, inhibition of iNOS might be effective as a therapy for OA. Previously, we reported that water-soluble extracts of C. fragile have potentially pro-inflammatory effects by inhibiting NO production and iNOS protein expression in RAW 264.7 cells [26]. Therefore, we examined whether AECF could inhibited IL-1β-induced inflammatory responses in rat primary chondrocytes. AECF was inhibited IL-1β-induced NO production through suppression of the iNOS protein level in a dose-dependent manner, which suggested that AECF has an anti-inflammatory effect in rat primary chondrocytes. MMPs are proteolytic enzymes involved in ECM degradation [12]. Excessive release of MMPs in synovial fluid disrupts the balance between the synthesis and degradation of the ECM in articular cartilage [13]. Among the MMPs, MMP-13 plays an important role in OA progression by degrading Type II collagen, which is the principal constituent of the ECM structure [36]. We confirmed that AECF suppressed IL-1β-induced MMP-13 overexpression at the mRNA and protein levels in rat primary chondrocytes. The ADAMTS family comprises secreted proteins that have crucial roles in joint tissue morphogenesis and pathophysiological regeneration [37]. ADAMTS-4 and ADAMTS-5 are the primary aggrecanases responsible for degradation of aggrecan in the pathogenesis of OA [14]. We demonstrated that AECF inhibited IL-1β-induced increases in ADAMTS-4 and ADAMTS-5 protein levels in rat primary chondrocytes. MAPKs have important roles as inflammatory mediators in synovial inflammation [13]. Therefore, the effects of AECF on the IL-1β-induced phosphorylation of ERK1/2, JNK, and p38 were examined. AECF significantly suppressed the phosphorylation of ERK1/2 and JNK in IL-1βinduced rat primary chondrocytes. Pro-inflammatory cytokines may be upregulated through the activation of the NF-κB signaling pathway,

OARSI scores of femurs and tibiae demonstrated that the AECF-treated (100, and 200 mg/mL bodyweight) rat OA models had a significantly lower OARSI score (2.5 ± 0.33) than the non-treated rat OA model (10.60 ± 0.15) at 8 weeks after DMM surgery (Fig. 6B). Taken together, these results indicated that AECF alleviated the progression of OA in a rat OA model. 4. Discussion OA is a common joint disease that can lead to physical disability [27]. The pathophysiological mechanism of the progression of OA is not well understood, and there are few effective treatments currently available to alleviate its progression. The progression of OA is considered to be associated with early stage inflammation [28]. Pro-inflammatory cytokines, such as IL-1β, have been reported to play an important role in the pathogenesis of OA through the activation of various signaling pathways, such as MAPK and NF-κB [29,30]. Recently, pharmacological agents for OA have focused on relieving pain and inflammation via nonsteroidal anti-inflammatory drugs (NSAIDs) or other drugs; however, these drugs can have serious adverse effects on patients [31,32]. OA is a chronic disease mainly in the elderly population; therefore, it is very important to reduce the adverse effects of OA drugs. However, the adverse effects of the currently used drugs appear avoidable. C. fragile is a green algae used as a culinary ingredient and has been used in traditional medicine with fewer adverse effects [33]. Several studies have been reported that extracts of C. fragile have potential antiinflammatory effects without toxicity in RAW 264.7 cells [34,35]. In the present study, we investigated whether AECF could alleviate the progression of OA in a rat OA model and suppress the IL-1β-induced inflammatory response in rat primary chondrocytes. Pro-inflammatory cytokines, such as IL-1β, has been reported to play critical roles in 269

Biomedicine & Pharmacotherapy 97 (2018) 264–270

S.-M. Moon et al.

[14] The role of ADAM-TS4 2016 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation, Osteoarthr Cartil 9 (2001) 539–552. [15] Y. Fu, et al., Overexpression of HMGB1 A-box reduced IL-1β-induced MMP expression and the production of inflammatory mediators in human chondrocytes, Exp. Cell Res. 349 (1) (2016) 184–190. [16] S.D. Lee, J.W. Choe, B.J. Lee, M.H. Kang, M.K. Joo, J.H. Kim, et al., Butein effects in colitis and interleukin-6/signal transducer and activator of transcription 3 expression, World J. Gastroenterol. 21 (2015) 465–474. [17] K. Vuolteenaho, T. Moilanen, R.G. Knowles, E. Moilanen, The role of nitric oxide in osteoarthritis Scand, J. Rheumatol. 36 (2007) 247–258. [18] B.K. Marcu, et al., NF-κB signaling: multiple angles to target OA, Curr. Drug Targets 11 (5) (2010) 599–613. [19] S. Rigoglou, A.G. Papavassiliou, The NF-κB signalling pathway in osteoarthritis, Int. J. Biochem. Cell Biol. 45 (11) (2013) 2580–2584. [20] A. Liacini, et al., Inhibition of interleukin-1-stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF-κB) transcription factors downregulates matrix metalloproteinase gene expression in articular chondrocytes, Matrix Biol. 21 (3) (2002) 251–262. [21] S. Ahmed, N. Wang, B.B. Hafeez, V.K. Cheruvu, T.M. Haqqi, L. Punica granatum, extract inhibits IL-1beta-induced expression of matrix metalloproteinases by inhibiting the activation of MAP kinases and NF-kappaB in human chondrocytes in vitro, J. Nutr. 135 (2005) 2096–2102. [22] L. Wang, X. Wang, H. Wu, R. Liu, Overview on biological activities and molecular characteristics of sulfated polysaccharides from marine green algae in recent years, Mar. Drugs 12 (9) (2014) 4984–5020. [23] C.L. Pires, S.D. Rodrigues, D. Bristot, H.H. Gaeta, D.O. de Toyama, W.R. Lobo Farias, M.H. Toyama, Evaluation of macroalgae sufated polysaccharides on the Leishmania (L.) amazonensis promasigote, Mar. Drugs 11 (3) (2013) 934–943. [24] R.G. Dilshara, C.H. Kang, U.H. Choi, G.Y. Kim, Methanol extract of Codium fragile inhibits tumor necrosis factor- a-induced matrix metalloproteinase-9 and invasiveness of MDA-MB −231 cells by suppressing, Asian Pacific Journal of Tropical Medicine (2016). [25] C. Lee, G.H. Park, E.M. Ahn, B.A. Kim, C.I. Park, J.H. Jang, Protective effect of Codium fragile against UVB-induced pro-inflammatory and oxidative damages in HaCaT cells and BALB/c mice, Fitoterapia 86 (2013) 54–63. [26] Seul Ah Lee, Sung-Min Moon, Yun Hee Choi, Seul Hee Han, Bo-Ram Park, Mi Suk Choi, Jae-Sung Kim, Yong Hwan Kim, Do Kyung Kim, Chun Sung Kim, Aqueous extract of Codium fragile suppressed inflammatory responses in lipopolysaccharidestimulated RAW264.7 cells an carrageenan-induced rats, Biomed. Pharmacother. 93 (2017) 1055–1064. [27] M. Feldmann, Pathogenesis of arthritis: recent research progress, Nat. Immunol. 2 (2001) 771–773. [28] D.T. Felson, Clinical practice: osteoarthritis of the knee, N. Engl. J. Med. 354 (2006) 841–848. [29] J.A. Mengshol, M.P. Vincenti, C.I. Coon, A. Barchowsky, C.E. Brinckerhoff, Interleukin-1 induction of collagenase 3 (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c-JunN-terminal kinase, and nuclear factor kappaB: differential regulation of collagenase 1 and collagenase 3, Arthritis Rheum. 43 (2000) 801–811. [30] W.B. van den Berg, Pathophysiology of osteoarthritis, Joint Bone Spine 67 (2000) 555–556. [31] D.C. Brater, Effects of nonsteroidal anti-inflammatory drugs on renal function: focus on cyclooxygenase-2-selective inhibition, Am. J. Med. 107 (1999) (65S-70S; discussion S-1S.). [32] I. Bjarnason, J. Hayllar, A.J. MacPherson, Side effects of nonsteroidal anti-inflammatory drugs on the small and large intestine in humans, Gastroenterology 104 (1993) 1832–1847. [33] J.W. Blunt, B.R. Copp, M.H. Munro, P.T. Northcote, M.R. Prinsep, Marine natural products, Nat. Prod. Rep. 27 (2) (2010) 165–237. [34] P. Ganesan, K. Matsubara, T. Ohkubo, Y. Tanada, K. Noda, T. Suqawara, T. Hirata, Anti-angiogenic effect of siphonaxanthin from green alga, Codium fragile, Phytomedicine 17 (14) (2010) 1140–1144. [35] M.N. Khan, J.S. Choi, M.C. Lee, E. Kim, T.J. Nam, H. Fujii, Y.K. Hong, Anti-inflammatory activities of methanol extracts from various seaweed species, J. Environ. Biol. 29 (4) (2008) 465–469. [36] T. Shiomi, V. Lemaître, J. D’Armiento, Y. Okada, Matrix metalloproteinases, a disintegrin and metalloproteinases, and a disintegrin and metalloproteinases with thrombospondin motifs in non-neoplastic diseases, Pathol. Int. 60 (2010) 477–496. [37] S.S. Glasson, R. Askew, B. Sheppard, B. Carito, T. Blanchet, H.L. Ma, C.R. Flannery, D. Peluso, K. Kanki, Z. Yang, M.K. Majumdar, E.A. Morris, Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis, Nature 434 (2005) 644–648. [38] J.A. Roman-Blas, S.A. Jimenez, NF-kappaB as a potential therapeutic target in osteoarthritis and rheumatoid arthritis, Osteoarthr Cartil. 14 (2006) 839–848. [39] M. Karin, A. Lin, NF-kappaB at the crossroads of life and death, Nat. Immunol. 3 (2002) 221–227. [40] Y.D. Liu, H.X. Yang, L.F. Liao, et al., Systemic administration of strontium or NBD peptide ameliorates early stage cartilage degradation of mouse mandibular condyles, Osteoarthr. Cartil. 24 (2016) 178–187. [41] L.X. Chen, L. Lin, H.J. Wang, et al., Suppression of early experimental osteoarthritis by in vivo delivery of the adenoviral vectormediated NF-kappaBp65-specific siRNA, Osteoarthr. Cartil. 16 (2008) 174–184. [42] K.P. Pritzker, S. Gay, S.A. Jimenez, et al., Osteoarthritis cartilage histopathology: grading and staging, Osteoarthr. Cartil. 14 (2006) 13–29.

which is a potential target for the treatment of OA [38]. P65 is the active subunit that is important for NF-κB signaling in various cell types [39]. Liu et al. showed that the proportion of phosphorylated p65 increased significantly in temporomandibular joint (TMJ)-OA mice [40]. Chen et al. also showed that a p65-specific short interfering RNA could suppress the induction of IL-1β and alleviate cartilage degradation in an early stage OA mouse model [41]. Overall, this evidence indicated that the p65 subunit of the NF-κB signal pathway is related to the progression of OA. Therefore, we investigated whether AECF exerted its antiinflammatory effects through the NF-κB signaling pathway. The results showed that AECF inhibited the translocation of IL-1β-induced NF-κB p65 phosphorylation to the nucleus in rat primary chondrocytes. Furthermore, we have found that AECF alleviated the progression of OA in the articular cartilage in rats after DMM surgery. We also confirmed a significant decrease in the OARSI score in the AECF-treated group compared with the OA alone group at 8 weeks after DMM surgery. In conclusion, our results demonstrated that AECF inhibited the IL1β-induced NO, iNOS, MMP-13, ADAMTS-4, and ADAMTS-5 by suppressing MAPKs and NF-κB signaling pathways in rat primary chondrocytes. Furthermore, AECF alleviated cartilage destruction in a rat OA model. Overall, these results suggested that AECF may be a potent anti-osteoarthritic agent for the treatment of OA. Conflict of interest The authors declare that they have no conflict of interest. Acknowledgements This research was financially supported by the Ministry of Trade, Industry, and Energy (MOTIE), Korea, under the “Regional Specialized Industry Development Program (R & D, R0005657)” supervised by the Korea Institute for Advancement of Technology (KIAT). References [1] S. Krasnokutsky, J. Samuels, S.B. Abramson, Osteoarthritis in 2007, Bull. NYU Hosp. Jt. Dis. 65 (2007) 222–228. [2] J. Shen, D. Chen, Recent progress in osteoarthritis research, J. Am. Acad. Orthop. Surg. 22 (2014) 467–468. [3] T. Hayami, M. Pickarski, Y. Zhuo, G.A. Wesolowski, G.A. Rodan, L.T. Duong, Characterization of articular cartilage and subchondral bone changes in the rat anterior cruciate ligament transection and meniscectomized models of osteoarthritis, Bone 38 (2006) 234–243. [4] D.S. Jevsevar, G.A. Brown, D.L. Jones, E.G. Matzkin, P.A. Manner, P. Mooar, J.T. Schousboe, S. Stovitz, J.O. Sanders, K.J. Bozic, M.J. Goldberg, W.R. Martin3rd, D.S. Cummins, P. Donnelly, A. Woznica, L. Gross, The American Academy of Orthopaedic Surgeons evidence-based guideline on treatment of osteoarthritis oftheknee, 2nd edition, J. Bone Joint Surg. Am. Vol. 95 (2013) 1885–1886. [5] G.A. Hawker, S. Mian, K. Bednis, Osteoarthritis year 2010 in review: non-pharmacologic therapy, Osteoarthr. Cartil. 19 (2011) 366–374. [6] F. Berenbaum, Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis), Osteoarthr. Cartil. 21 (2013) 16–21. [7] M.B. Goldring, S.R. Goldring, Osteoarthritis, J. Cell. Physiol. 213 (2007) 626–634. [8] R.F. Loeser, Molecular mechanisms of cartilage destruction:mechanics, inflammatory mediators, and aging collide, Arthritis Rheum. 54 (2006) 1357–1360. [9] P.S. Burrage, K.S. Mix, C.E. Brinckerhoff, Matrix metalloproteinases: role in arthritis, Front. Biosci. 11 (2006) 529–543. [10] M.D. Tortorella, A.M. Malfait, C. Deccico, E. Arner, The Role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a Model of Cartilage Degradation, (2001). [11] M. Wang, E.R. Sampson, H. Jin, J. Li, Q.H. Ke, H.J. Im, et al., MMP13 is a critical target gene during the progression of osteoarthritis, Arthritis Res. Ther. 15 (2013) R5. [12] T. Klein, R. Bischoff, Physiology and pathophysiology of matrix metalloproteases, Amino Acids 41 (2) (2011) 271–290. [13] L.C. Tetlow, D.J. Adlam, D.E. Woolley, M.D. Tortorella, A.M. Malfait, C. Deccico, E. Arner, Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: associations with degenerative changes, Arthritis Rheum. 44 (2001) 585–594.

270