NFATc1 Links EGFR Signaling to Induction of Sox9 Transcription and Acinar–Ductal Transdifferentiation in the Pancreas

All studies published in Gastroenterology are embargoed until 3PM ET of the day they are published as corrected proofs on-line. Studies cannot be publicized as accepted manuscripts or uncorrected proofs.

Gastroenterology 2015;-:1–11

61 62 63 64 65 66 67 68 Nai-Ming Chen,1,* Garima Singh,2,* Alexander Koenig,1,3,* Geou-Yarh Liou,4 Peter Storz,4 69 Jin-San Zhang,3,5 Lisanne Regul,2 Sankari Nagarajan,6 Benjamin Kühnemuth,2 70 6 7 8 3 1 Steven A. Johnsen, Matthias Hebrok, Jens Siveke, Daniel D. Billadeau, Volker Ellenrieder, 71 and Elisabeth Hessmann1 72 73 1 Department of Gastroenterology II, 6Clinic for General, Visceral and Pediatric Surgery, University Medical Center Goettingen, 74 Goettingen, Germany; 2Signaling and Transcription Laboratory, Department of Gastroenterology, Philipps-University, Marburg, 75 3 Germany; Schulze Center for Novel Therapeutics, Division of Oncology Research, Mayo Clinic, Rochester, Minnesota; 76 4 5 Department of Cancer Biology, Mayo Clinic, Jacksonville, Florida; School of Pharmaceutical Sciences and Key Laboratory of 77 Biotechnology and Pharmaceutical Engineering, Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China; 7 8 78 Diabetes Center, University of California San Francisco, San Francisco, California; II Medizinische Klinik, Klinikum Rechts der 79 Isar, Technische Universität, Munich, Germany 80 ancreatic ductal adenocarcinoma (PDAC) is one of Q10 Q11 81 BACKGROUND & AIMS: Oncogenic mutations in KRAS Q12 contribute to the development of pancreatic ductal adenocarcithe most lethal malignancies with a 5-year survival 82 1 noma, but are not sufficient to initiate carcinogenesis. Secondary rate less than 5%. PDAC is believed to arise from 3 83 events, such as inflammation-induced signaling via the different precursor lesions, with pancreatic intraepithelial 84 epidermal growth factor receptor (EGFR) and expression of the neoplasia (PanIN) being the best described. Activating mu85 SOX9 gene, are required for tumor formation. We investigated tations in the Kras oncogene are detected in early PanIN 86 mechanisms that link EGFR signaling with activation of SOX9 lesions and in more than 90% of advanced human PDAC, 87 during acinar–ductal metaplasia, a transdifferentiation process thus leading to the current paradigm that this genetic 88 that precedes pancreatic carcinogenesis. METHODS: We alteration is crucial for PDAC initiation.2 Lineage-tracing 89 analyzed pancreatic tissues from KrasG12D;pdx1-Cre and studies in genetically engineered mice (GEM) have shown 90 G12D D/D Kras ;NFATc1 ;pdx1-Cre mice after intraperitoneal adminthat acinar cells expressing mutant KrasG12D lose their dif91 istration of caerulein, vs cyclosporin A or dimethyl sulfoxide ferentiation status and acquire a duct-like phenotype.3–7 92 (controls). Induction of EGFR signaling and its effects on the This process, termed acinar-to-ductal metaplasia (ADM), 93 expression of Nuclear factor of activated T cells c1 (NFATC1) or now is appreciated as an initial step in pancreatic carcino94 SOX9 were investigated by quantitative reverse-transcription genesis. ADM can evolve into PanIN lesions and eventually 95 polymerase chain reaction, immunoblot, and immunohisto3,5,7,8 However, ADM formation progress to metastatic PDAC. 96 chemical analyses of mouse and human tissues and acinar cell with a low penetrance and a long 97 explants. Interactions between NFATC1 and partner proteins and progression occurs G12D exposed to chemically 98 and effects on DNA binding or chromatin modifications were latency, unless Kras 8,9 mice areG12D Thus, Kras expression alone is induced pancreatitis. 99 studied using co-immunoprecipitation and chromatin immunonot sufficient for pancreatic cancer initiation in GEM, but 100 precipitation assays in acinar cell explants and mouse tissue. 101 RESULTS: EGFR activation induced expression of NFATC1 in rather requires poorly defined secondary events such as 8–10 In line 102 metaplastic tissues from patients with chronic pancreatitis and inflammatory signals to drive carcinogenesis. 103 in pancreatic tissues from KrasG12D mice. EGFR signaling also with this, epidemiologic studies have shown chronic promoted formation of a complex between NFATC1 and C-JUN in pancreatitis to be a major risk factor for PDAC development 104 dedifferentiating mouse acinar cells, leading to activation of Sox9 in human beings.10–12 105 transcription and induction of during acinar–ductal metaplasia. Metaplastic lesions often express high levels of tyrosine 106 This complex mediated acinar–ductal transdifferentiation kinase receptors such as epidermal growth factor receptor 107 through a process that required activation of Sox9 transcription. (EGFR) and its natural ligands EGF and transforming growth 108 Pharmacologic inhibition of NFATC1 or disruption of the Nfatc1 factor (TGF)a in patients with chronic pancreatitis or early 109 gene inhibited EGFR-mediated induction of Sox9 transcription 110 and blocked acinar–ductal transdifferentiation and pancreatic 111 cancer initiation in mice. CONCLUSIONS: EGFR signaling induces *Authors share co-first authorship. 112 expression of NFATc1 and Sox9 in mice, leading to acinar cell 113 Abbreviations used in this paper: ADM, acinar-to-ductal metaplasia; AP1, transdifferentiation and initiation of pancreatic cancer. Strategies __________________; ChIP, chromatin immunoprecipitation; CsA, cyclo114 designed to disrupt this pathway might be developed to prevent sporin A; EGFR, epidermal growth factor receptor; GEM, genetically 115 pancreatic cancer initiation in high-risk patients, such as patients engineered mice; MAP, mitogen-activated protein; NFATc1, nuclear factor 116 of activated T cells c1; PanIN, pancreatic intraepithelial neoplasia; PDAC, with chronic pancreatitis. pancreatic ductal adenocarcinoma; TGF, transforming growth factor. 117 118 Keywords: Signal Transduction; Mouse Model; Gene Regulation; © 2015 by the AGA Institute 119 ChIP. 0016-5085/$36.00 http://dx.doi.org/10.1053/j.gastro.2015.01.033 120

NFATc1 Links EGFR Signaling to Induction of Sox9 Transcription and Acinar–Ductal Transdifferentiation in the Pancreas

Q50

Q6

Q7

Q8 Q9

P

BASIC AND TRANSLATIONAL PANCREAS

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

2

BASIC AND TRANSLATIONAL PANCREAS

121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

Q15

Chen et al

Gastroenterology Vol.

stage tumors.11–14 Although transgenic expression of EGFR ligands provoked ADM formation in animal models,13–16 EGFR inactivation using either genetic or pharmacologic approaches preserved acinar cells in a well-differentiated state and suppressed metaplastic transformation by KrasG12D and inflammation.15,16 Although accumulating evidence from mouse and human studies support an essential role of EGFR signaling activation in inflammation-driven metaplasia and cancer initiation, the molecular mechanisms linking EGFR signaling with acinar cell dedifferentiation and ADM formation remain elusive. Nuclear factor of activated T cells c1 (NFATc1) belongs to a family of Ca2þ/calcineurin-responsive transcription factors that primarily are recognized for their central roles in T-cell activation.17 In recent years it became clear that NFATc1 expression and function is not restricted to the immune system and rather plays important roles in gene regulation during transformation and cancer progression.18–20 We observed ectopic expression and nuclear accumulation of NFATc1 in more than 60% of human pancreatic cancers, and particularly in tumors with peritumoral inflammation.21 In GEM models, transgenic expression of nuclear NFATc1 cooperates with KrasG12D in pancreatic carcinogenesis, resulting in rapid formation of precursor lesions and progression toward invasive PDACs.22 Here, we sought to determine whether nuclear NFATc1 activation bridges among EGFR signaling, ADM, and pancreatic cancer initiation. By taking advantage of an established experimental pancreatitis model in GEM, our studies identified a previously unknown EGFR-NFATc1 signaling and transcription pathway with essential functions in inflammation-driven carcinogenesis. EGFR signaling causes a robust induction of NFATc1 expression. In cooperation with partner proteins, NFATc1 controls a signaling network, which is required for promotion of acinar-toductal conversion both in animals and acinar cell explants. Finally, genetic or pharmacologic inactivation of NFATc1 Q13 prevents inflammation of or EGFR-mediated ADM in the pancreas.

Materials and Methods Animals Q14

Generation and characterization of pdx1-Cre, LSL-KrasG12D, and NFATc1fl/fl mice have been described before.23–26 Mouse strains were interbred to obtain KrasG12D;pdx1-Cre and KrasG12D;NFATc1D/D;pdx1-Cre mice. All strains had a C57Bl/6 background. Sex was irrelevant for ADM development. Caerulein (50 mg/kg, 3 times/wk, AnaSpec), cyclosporin A (CsA) (5 mg/kg, 5 times/wk), or dimethyl sulfoxide were administrated by intraperitoneal injection at the age of 8 weeks for a duration of 4 weeks. All animal experiments were performed using protocols approved by the Institutional Animal Care and Use Committee at the Philipps-University of Marburg in Germany.

Acinar Cell Isolation Acinar cell isolation was performed as described previously.27 Briefly, the whole pancreas was dissected and incubated at 37 C in a collagenase VIII–containing solution. The

-,

No.

-

minced pancreas was passed through a 100-mm nylon filter. After repetitive washing, acini were exposed to culture solution containing 30% fetal calf serum. Acinar cells were cultured in collagen supplemented with 0.1% fetal calf serum and, unless otherwise indicated, treated with dimethyl sulfoxide, CsA (0.5 mmol/L), TGFa (50 ng/mL), FK506 (10 nmol/L), or EGF (20 ng/mL). Ducts were counted after the indicated time points using brightfield microscopy and Hoechst33324 staining to show cell viability.

Chromatin Immunoprecipitation Chromatin immunoprecipitation (ChIP) assay in 266-6 acinar cells and in pancreatic tissue was performed as described previously.28 For detailed information please refer to the Supplementary Materials and Methods section.

Results NFATc1 Is Induced in EGFR-Mediated Acinar-toDuctal Metaplasia Transdifferentiation of acinar cells into the cells with duct-like structures is induced by oncogenic Kras mutation and activation of the EGFR signaling pathway.15,29 Consistently, we found increased phosphorylation levels of EGFR and its downstream extracellular-regulated kinase/ mitogen-activated protein (MAP) kinase in metaplastic Q16 areas of human pancreatitis (Figure 1A, Supplementary Figure 1A). Importantly, immunohistochemical analysis also showed a robust increase in NFATc1 expression in the areas of ductal metaplasia (Figure 1A, Supplementary Figure 1A). To examine whether NFATc1 plays a role in pancreatitis-induced ADM, we treated KrasG12D mice with caerulein, a well-established inducer of inflammatory pancreatic damage.29,30 A 4-week treatment resulted in severe exocrine pancreatic injury with disordered acinar structure and induction of ADM (Figure 1B). As predicted, progressive ADM formation was associated with an activation of the EGFR signaling pathway. Immunohistochemistry and immunoblot analysis confirmed phosphorylation of both EGFR and extracellular-regulated kinase/MAP kinase (Figure 1B and C). Caerulein treatment also induced high levels of EGF (Figure 1C), an EGFR ligand frequently overexpressed in human pancreatitis. To ascertain the in vivo functions of NFATc1, we explored changes in its expression levels and pattern in the pancreata of KrasG12D mice. NFATc1 expression in KrasG12D control animals was limited predominantly to the cytoplasm of exocrine cells, indicating NFATc1 transcriptional inactivity in acinar cells (Figure 1B, Supplementary Figure 1B). However, as reported previously,31 and consistent with findings in human pancreatitis, NFATc1 was highly induced in the exocrine pancreas in response to caerulein administration (Figure 1B and C). Of note, NFATc1 expression specifically was detected in the nuclei of ADM lesions (Supplementary Figure 1B). Together, these experiments provided evidence for a link between EGFR signaling and NFATc1 activation during the early stages of cancer initiation.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

Q23

NFATc1 and Pancreatic Transdifferentiation

3

Figure 1. EGFR signaling induces NFATc1 expression. (A and B) Analysis of H&E and immunohistochemical staining in (A) human chronic pancreatitis samples and (B) 12week-old KrasG12D mice after administration of caerulein. Scale bars: 100 mm. (C) Western blot analysis of indicated proteins in pancreatic tissue of KrasG12D mice.

Q1

print & web 4C=FPO

241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300

2015

NFATc1 Is Required for EGFRSignaling–Induced ADM Cellular adaptation in response to external stimuli was attributed previously to NFAT signaling and transcription in various tissues.22,30 To investigate whether NFATc1 is involved directly in EGFR-signaling–induced acinar-to-ductal transdifferentiation, we analyzed NFATc1 expression and function in acinar cells undergoing ductal conversion in response to EGFR stimulation. As predicted from previous studies, the activation of EGFR signaling via stimulation with either EGF or TGFa strongly promoted conversion of acinar cells into duct-like cells (Figure 2A and B, Supplementary Figure 2A and B). Importantly, acinar-to-ductal transdifferentiation was accompanied by a strong induction of NFATc1 messenger RNA expression and increased protein levels in acinar cells (Figure 2C and Supplementary Figure 2C). Strikingly, either depletion of NFATc1 or administration of the clinically used calcineurin inhibitors CsA or FK506, which prevent NFAT activation, blocked acinar-to-ductal conversion even upon activation of EGFR signaling (Figure 2A and B, Supplementary Figure 2A, B, and D). As a consequence, duct formation was inhibited and the expression of ductal differentiation genes, such as cytokeratins 7 and 19 and E-cadherin (Figure 2D and E, Supplementary Figures 2E and 3), were decreased after

NFATc1 depletion, whereas amylase expression was maintained in response to NFATc1 inhibition (Figure 2F). Together, these studies highlight the important role of NFATc1 during EGFR-signaling–induced acinar cell reprogramming, and suggest that NFATc1 activation is required for the acquisition of a premalignant duct-like phenotype.

EGFR-Signaling–Mediated Activation of NFATc1 Involves Complex Formation With c-Jun To regulate changes in gene expression, NFAT proteins interact with other DNA binding partners that frequently occupy adjacent sequences on common target gene promoters. We previously examined genome-wide NFATc1 occupancy in pancreatic cancer cells using ChIPsequencing22,32 and consistently observed composite Q17 binding sites between NFAT and AP1, a heterodimeric Q18 transcription factor consisting of members of the c-Jun and c-Fos families on numerous target genes. In fact, 61.8% of the 6273 identified NFATc1 binding peaks were enriched for consensus AP1 binding sites (NFATc1:AP1) (Figure 3A). Notably, Genomic Regions Enrichment of Annotations Tool analyses showed an enrichment of EGF or related pathways for genes containing NFAT:AP1 overlapping sites (Supplementary Tables 1 and 2).

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360

BASIC AND TRANSLATIONAL PANCREAS

-

4

Gastroenterology Vol.

-,

No.

-

Figure 2. EGFR-signaling–mediated acinar-to-ductal transdifferentiation requires activation of NFATc1. (A) TGFa-treated acinar cell explants from Kraswt mice in the presence or absence of CsA (0.5 mmol/L) or FK506 (10 nmol/L) were analyzed for duct formation 72 hours after cell isolation. Scale bars: 100 mmol/L. (B) Duct formation was determined after short hairpin RNAmediated depletion of NFATc1 in wild-type mice after TGFa treatment for 5 days (n ¼ 3, means ± SD). Scale bars: 100 mm. *P < .05 as compared with short hairpin (sh)control alone. **P < .05 as compared with shcontrol þ TGFa. (C) Western Blot analysis shows NFATc1 expression in acinar explants after the indicated treatments. (D–F) Quantitative reverse-transcription polymerase chain reaction shows cytokeratin 19 expression in response to EGF treatment after (D) small interfering RNA (siRNA)-mediated depletion of NFATc1 in acinar cells from KrasG12D mice and (E) messenger RNA (mRNA) expression of the indicated markers after pharmacologic inhibition with FK506 (10 nmol/L) or (F) CsA (0.5 mmol/L) in acinar cell explants from Kraswt mice (n ¼ 3, means ± SD). DMSO, dimethyl sulfoxide. Q19

BASIC AND TRANSLATIONAL PANCREAS

361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420

Chen et al

Based on these data, we examined whether combined NFATc1:AP1–dependent transcription links EGFR signaling activation with gene regulation during acinar-toductal conversion. Consistently, EGF treatment caused a time-dependent activation of the AP1 factors c-Fos and cJun, as evidenced by a progressive increase in MAP kinase–dependent phosphorylation in an acinar cell line and in acinar cell explants (Figure 3B and C, Supplementary Figures 4 and 5A–D). We then tested whether EGFR signaling activation stimulates transcription from NFATc1:AP1–responsive promoters. To do so, we used primary pancreatic cancer cells from KrasG12D;p53wt/D;EgfrD/D mice lacking EGFR expression. Consistent with its dependence on the EGFR-MAP kinase pathway, introduction of c-Jun showed only marginal effects on NFATc1-mediated promoter transactivation (Figure 3C). However, NFATc1:c-Jun transcriptional activity was enhanced strongly upon restoration of the EGFR signaling pathway after transfection of cells with a constitutively active mutant receptor (Figure 3C). In contrast, NFATc1 activity remained unaffected by c-Fos expression (Figure 3C), even upon EGFR signaling activation, thereby confirming the essential function of c-Jun in NFATc1-mediated promoter transactivation. Consistent with a role for c-Jun in acinar-to-ductal

transdifferentiation, c-Jun induction and phosphorylation were detected in response to caerulein treatment (Figure 3D and Supplementary Figure 5E), and immunohistochemical analyses showed high levels of phosphorylated c-Jun in ductal-like lesions of KrasG12D mice (Figure 3E). Finally, coimmunoprecipitation studies confirmed inducible NFATc1:c-Jun interactions both in cultured acinar cell explants undergoing EGFR-induced ductal conversion (Supplementary Figure 5F) and in transforming KrasG12D mice pancreata (Figure 3F). In summary, these findings support a role for EGFR signaling in inducing NFATc1 transcriptional activity in transdifferentiating acinar cells by promoting NFATc1:c-Jun complex formation.

EGFR Signaling Induces NFATc1-Dependent Sox9 Expression in Pancreatic Carcinogenesis The establishment and maintenance of pancreatic metaplastic lesions depend on the expression and activation of transcription factor machinery that drives acinar transdifferentiation toward a ductal phenotype. Recently, Sox9 was implicated in ADM formation and pancreatic cancer initiation.32,33 In line with these observations, acinar cell explants showed an induction of Sox9 expression in

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480

NFATc1 and Pancreatic Transdifferentiation

5

Figure 3. EGFR signaling induces NFATc1:c-Jun complex formation in acinar-ductal transdifferentiation. (A) Pie chart shows the portion of AP1 binding sites within NFATc1 peaks identified by ChIP-sequencing. Motif analyses on NFATc1 binding using Regulatory sequence analysis tools (RSAT) peak-motifs shows AP1 binding motif. Statistical significance is denoted with –log10 P value. (B) EGF-treated acinar 266-6 cells and acinar cell explants from Kraswt mice were analyzed by immunoblotting. (C) Luciferase reporter assay shows activity of an NFAT-responsive promoter construct in KrasG12D;p53wt/D;EgfrD/D cells after expression of indicated constructs (n ¼ 3, means ± SD). (D) Protein expression of c-Jun and p-c-Jun in pancreatic lysates of caerulein-challenged KrasG12D mice. (E) Immunohistochemistry shows expression and phosphorylation of c-Jun in caeruleintreated 3-month-old KrasG12D mice. Scale bars: 100 mm. (F) Co-immunoprecipitation shows NFATc1/c-Jun complex formation in tissue from caerulein-treated 3-month-old KrasG12D mice. CCK, ________________; IL, interleukin; IP, ___________________.

response to EGF treatment (Figure 4A–C). A luciferase reporter assay in primary pancreatic cancer cells from mice with combined constitutive activation of Kras and mutation of the tumor-suppressor p53 (KrasG12D;Trp53R172H) showed transactivation of the Sox9 promoter upon EGF treatment (Figure 4D), confirming Sox9 as a downstream target of EGFR signaling. Interestingly, depletion of NFATc1 rescued EGFR-dependent induction of Sox9 transactivation and expression (Figure 4). Thus, these data identify Sox9, a known mediator of pancreatic cancer initiation and progression, as an important NFATc1 target gene downstream of EGFR signaling.

NFATc1:c-Jun Complex Formation Is Required for Transcriptional Activation of Sox9 Detailed sequence analyses showed the presence of 3 NFATc1 consensus sequences adjacent to AP1 binding sites within the proximal promoter region of the Sox9 gene (Figure 5A). We examined basal and inducible NFATc1 and c-Jun promoter recruitment in EGF-treated KrasG12D acinar cells by performing ChIP analyses after activation of EGFR signaling. Interestingly, EGFR signaling induced NFATc1 occupancy at the -825 bp and þ370 bp sites (Figure 5A). Importantly, inactivation of NFATc1 with CsA resulted in

decreased c-Jun recruitment and reduced occupancy of the active histone mark H3K4me3 on the Sox9 promoter, suggesting that NFATc1 plays an essential role in EGFR-driven Sox9 gene expression (Figure 5B). Similarly, depletion of c-Jun significantly decreased NFATc1 recruitment to the Sox9 promoter and reduced EGF-induced Sox9 promoter activation as shown by decreased RNA polymerase II recruitment (Figure 5C and Supplementary Figure 5G). Interestingly, in line with the repressive effect of c-Fos on NFATc1-mediated promoter transactivation (Figure 3C), overexpression of c-Fos diminished NFATc1 occupancy and activity of the Sox9 promoter in KrasG12D;p53wt/D;EgfrD/D cells in response to EGFR signaling activation (Figure 5D), indicating that c-Fos impairs binding of the NFATc1:c-Jun complex to target gene promoters. Taken together, these findings suggest that EGFR signaling activates a hierarchical transcriptional cascade in which NFATc1:c-Jun complexes specifically drive Sox9 gene expression during the process of acinar-to-ductal conversion.

NFATc1 Deletion Prevents Inflammation-Induced ADM In Vivo To further examine the importance of NFATc1 for Sox9 induction in the context of ADM, we crossed KrasG12D mice

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

Q24

Q25

541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600

BASIC AND TRANSLATIONAL PANCREAS

481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540

2015

print & web 4C=FPO

-

6

BASIC AND TRANSLATIONAL PANCREAS

601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660

Chen et al

Gastroenterology Vol.

-,

No.

-

Figure 4. EGFR signaling activity involves NFATc1dependent induction of Sox9. (A) Western blot analysis showing NFATc1 and Sox9 expression in EGF-treated acinar cell explants in KrasG12D or KrasG12D;NFATc1D/D mice. (B) Quantitative reversetranscription polymerase chain reaction shows Sox9 messenger RNA (mRNA) expression in acinar cell explants of KrasG12D mice after the designated treatments (n ¼ 3, means ± SD). (C) Quantitative reverse-transcription polymerase chain reaction shows Sox9 expression in KrasG12D vs KrasG12D; NFATc1D/D mice in response to EGF treatment. (D) Luciferase reporter assay in primary pancreatic tumor cells from KrasG12D;Trp53R172H mice to show Sox9 promoter activity in response to EGF treatment in the presence and absence of NFATc1 (n ¼ 3, means ± SD). siRNA, small interfering RNA.

with NFATc1fl/fl;pdx1-Cre animals to obtain mice with pancreas-specific deletion of NFATc1. KrasG12D;NFATc1D/D mice were born at the expected Mendelian frequency without any gross alterations in pancreatic development or acinar cell specification, rendering it a suitable GEM model to investigate NFATc1-dependent transcription and function in the context of EGFR signaling (Supplementary Figure 6A and B). In agreement with our pharmacologic and small interfering RNA–mediated approaches, acinar cell explants from KrasG12D;NFATc1D/D mice expressed low levels of the ductal markers cytokeratin 7 and 19 upon EGF treatment (Supplementary Figure 6C–E), indicating impaired ADM formation in the absence of NFATc1. Most importantly, loss of NFATc1 rendered the Sox9 gene insensitive to caeruleininduced transcriptional activation (Figure 4A and C). To verify the biological relevance of this novel pathway in acinar cell conversion and cancer initiation, we used the various GEM models and monitored caerulein-induced acinar-to-ductal transdifferentiation after genetic or pharmacologic inactivation of NFATc1. NFATc1 staining confirmed the absence of the transcription factor in NFATc1-deficient mice (Figure 6A and Supplementary

Figure 7). Strikingly, although caerulein caused a massive acceleration of ductal-like lesions in 3-month-old KrasG12D mice, loss of NFATc1 rendered acinar cells insensitive to inflammation-induced acinar-to-ductal transdifferentiation (Figure 6A and B and Supplementary Figure 7). Immunohistochemistry and immunoblot analyses confirmed stable expression levels of acinar cell differentiation markers (eg, amylase) in NFATc1-deficient mice, although ductal differentiation markers were not induced (Figure 6A and D, Supplementary Figure 7). Consistent with a critical role of Sox9 in NFATc1mediated acinar-to-ductal conversion, we confirmed a strong induction of Sox9 expression upon transdifferentiation both at the RNA and protein levels (Figure 6A, D, and E). Furthermore, and consistent with a cooperative role of NFATc1 and c-Jun in the induction of Sox9 gene expression in acinar cells, we observed inducible NFATc1 and c-Jun binding to and increased activation of the Sox9 promoter in KrasG12D pancreata upon caerulein treatment (Figure 6F). Thus, disrupted NFATc1:c-Jun complex formation as a consequence of genetic inactivation of NFATc1 disables Sox9 transcriptional induction and

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720

721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780

2015

NFATc1 and Pancreatic Transdifferentiation

7

Figure 5. Transcriptional activation of Sox9 requires NFATc1:c-Jun complex formation on the Sox9 promoter. (A) Cartoon displays putative NFAT and predicted AP1 binding sites in the mouse Sox9 promoter. Promoter mapping shows NFATc1 binding to the Sox9 promoter. (B) ChIP assays to determine occupancy of NFATc1, c-Jun, and H3K4me3 on the Sox9 promoter in 266-6 cells in response to EGF and/or CsA (3 hours). NFATc1 and c-Jun, þ370 bp; H3K4me3, -825 bp (means ± SD). (C) ChIP assays to show NFATc1 and RNA Pol II occupancy on the Sox9 promoter (þ370 bp) in c-Jun–depleted 266-6 cells after treatment with EGF for 3 hours. (D) ChIP analyses in primary pancreatic KrasG12D;p53wt/D;EgfrD/D cells shows NFATc1 binding and H3K4me3 as well as RNA Pol II occupancy on the Sox9 promoter (-825 bp) after transfection of EGFR ± c-Fos. siRNA, small interfering RNA.

subsequent ductal transdifferentiation in acinar cells despite the presence of oncogenic Kras mutations and activation of EGFR signaling. In summary, our studies identified NFATc1/c-Jun as a critical transcription factor complex that is essential for the integration of EGFR and inflammatory signals that promote acinar-to-ductal transdifferentiation in the pancreas. Significantly, NFATc1 is induced by cell-autonomous EGFR signaling and this pathway is operative both in human and GEM models of carcinogenesis, specifically when exposed to an inflammatory environment.

Discussion Acinar transdifferentiation toward a duct-like phenotype represents a defining response of acinar cells to stress signals, including inflammation,34 and is considered to be the initial step in pancreatic carcinogenesis.35 In the absence of oncogenic signaling, ADM represents a regenerative program that allows restoration of pancreatic tissue integrity.36 However, in the presence of oncogenic Kras mutation, the acinar cell lacks the regenerative potential after tissue damage and undergoes a transition from ductal-like lesions to PanINs, thus promoting pancreatic carcinogenesis.37 Over the past few years, multiple studies have shown that singular oncogenic activation of Kras is not sufficient to induce

Q26

PDAC initiation.4,38 Kras activation rather requires complementary signals such as inflammation to fully induce pancreatic carcinogenesis.8,29 Previous work showed mechanistic details of the inflammatory signaling program as an inducer of cellular plasticity in the pancreas. Upregulation of epidermal growth factor receptors in the acinar cells has long been observed after chronic inflammation and in PDAC.11,12 A central role of EGFR signaling during ADM induction and progression to neoplastic precursor lesions in response to inflammatory signals recently was shown.15,16,27 However, the selection of EGFRdependent targets in the context of acinar-to-ductal transdifferentiation remains poorly understood. Initial evidence connecting EGFR-signaling to NFAT Q20 transcription factors in carcinogenesis came from expression analyses showing that both proteins are highly induced in pancreatic cancer samples.39 Furthermore, recent work has shown EGFR-dependent and NFAT-mediated Cox2 expression in colorectal tumorigenesis, which showed a functional relevance for this hypothesized link.40 The identification of Cox2 as an EGFR/NFAT target already points toward critical functions of the EGFR/NFAT cascade for the integration of inflammatory signals during carcinogenesis. In particular, during pancreatic cancer formation, NFAT proteins have been shown to play a central role in the integration of environmental signals into oncogenic

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840

BASIC AND TRANSLATIONAL PANCREAS

-

BASIC AND TRANSLATIONAL PANCREAS

841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900

Chen et al

Gastroenterology Vol.

-,

No.

-

print & web 4C=FPO

8

Figure 6. Genetic ablation of NFATc1 prevents inflammation-induced acinar-to-ductal transdifferentiation in vivo. (A–E) Mice with indicated genotypes were challenged with caerulein and CsA as indicated. Expression analyses and quantification of ductal-like lesions were performed after 4 weeks of treatment. (A) H&E staining and immunohistochemistry. Scale bars: 100 mm. (B) Quantification of ductal-like lesions (n ¼ 5, means ± SD). (C) E-cadherin messenger RNA (mRNA) expression in pancreatic tissue. (D and E) Western Blot analysis and Sox9 mRNA (n ¼ 4, means ± SD) expression in pancreatic tissues. (F) ChIP analysis in caerulein-treated KrasG12D mice shows NFATc1 and c-Jun occupancy (þ370 bp) and H3K4me3 (-825 bp) binding to Sox9 promoter.

transcriptional processes that mediate proliferation, cellular differentiation, and adaptation to inflammation.21,22,28,30 In this study, we showed that sustained pancreatic inflammation induced a strong up-regulation of NFATc1 in metaplastic areas of both murine and human chronic pancreatitis models. Detailed in vitro studies using acinar cell extracts confirmed increased NFATc1 expression as a result of EGFR activation. Notably, NFATc1 depletion by pharmacologic or genetic approaches resulted in reduced EGFR-mediated expression of ductal gene expression signatures and impaired acinar cell transdifferentiation in vitro and in vivo.

Most importantly, pancreatic cancer initiation in response to inflammation could be blocked significantly in KrasG12D; NFATc1D/D mice, highlighting the biological significance of the previously unrecognized EGFR-NFATc1 axis in pancreatic cancer initiation. Characteristically, sufficient DNA binding on target gene promoters and enhancers by NFAT transcription factors requires interaction with partner proteins.21,28,41 In the case of the NFAT proteins, the selection of cooperating transcription factors defined NFATc1 target gene specificity and the resulting cellular functions.42 For instance, interaction

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960

Q21

961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020

2015

NFATc1 and Pancreatic Transdifferentiation

with GATA factors is mandatory for NFAT-induced cardiac cell differentiation,43,44 whereas T-cell activation and proliferation requires cooperation with members of the AP1 (cJun/c-Fos) family of bZIP proteins.43 Notably, recent studies further implicated NFATc1:AP1 cooperativity in adaptive gene regulation and confirmed a role for this interaction in various aspects of carcinogenesis.45 ChIP-sequencing analysis showed that more than half of the NFATc1-bound genetic regions possess composite DNA elements that are bound putatively by AP1 proteins.22 Consensus NFAT:AP1 binding elements were found preferentially in genes implicated in cytokine/growth factor signaling regulation, growth promotion, and tumor-matrix interactions,22 suggesting that a primary function of NFAT:AP1 in complexes in cancer may be to integrate environmental signals with tumorpromoting, cell-specific gene responses. Here, we show that inflammation-induced pancreatic cancer initiation involves NFATc1:c-Jun complex formation in dedifferentiated pancreatic lesions. Importantly, physical NFATc1:c-Jun association was visible only in the presence of EGF or caerulein, stressing that upstream signals highly influence NFATc1 partner protein selection and the mode of transcriptional activity on target genes. Inflammation-induced EGFR activation was linked previously to an increase of Sox9 expression levels. EGFR activation in response to epithelial injury induced Sox9 expression during the development of urothelial cancer,46 thereby describing a functional link between EGFR signaling and Sox9 expression in carcinogenesis. Most importantly, in a recent report, Sox9 was identified as a critical transcription factor in acinar cell dedifferentiation and ductal conversion.32 Although loss of Sox9 during acinar cell transdifferentiation resulted in reversed ductal gene expression signatures and blocked ADM formation and progression into preneoplastic lesions, ectopic induction of Sox9 in acinar cells in KrasG12D;Sox9 mice accelerated KrasG12D-driven carcinogenesis and gave rise to a pancreatic phenotype that resembles morphologic alterations of KrasG12D mice with conditional activation of NFATc1 (KrasG12D;NFATc1), including severe acinar cell destruction and progressive formation of ductal-like lesions.22,32 Although the relevance of the EGFR-Sox9 axis has been shown in multiple cellular contexts, the underlying mechanism linking inflammation-induced EGFR activation and Sox9 induction in pancreatic cancer initiation remained elusive. Herein, we show that the EGFR-mediated induction of NFATc1 expression during this process provides a link between EGFR activation and Sox9-controlled effects during acinar cell transdifferentiation. This is shown by increased Sox9 promoter activation and increased Sox9 expression levels upon EGFR-induced NFATc1 activation. Consequently, high Sox9 expression levels likewise were found in primary KrasG12D;NFATc1 tumor cells, whereas pharmacologic inhibition or genetic depletion of NFATc1 caused a loss of Sox9 expression even upon EGFR activation. Promoter and ChIP analyses confirmed NFATc1 recruitment to specific Sox9-promoter regions in response to EGFR activation. Significantly, Sox9 promoter activation was dependent on cooperative NFATc1:c-Jun binding because sequential

9

depletion of the transcription factors rendered the Sox9 promoter insensitive to EGFR activation, resulting in decreased Sox9 expression and impairment of acinar-toductal transdifferentiation. The identification of Sox9 as a direct target gene of NFATc1 in pancreatic carcinogenesis also is supported by results from a recently published genome-wide ChIP-sequence analysis showing a recruitment of NFATc1 to the Sox9 promoter in primary pancreatic tumor cells derived from KrasG12D;NFATc1 mice.22 The activation of the NFATc1-Sox9 axis is not restricted to epithelial regeneration or cancer initiation because recent work identified NFATc1 recruitment to the Sox9 promoter during tracheal cartilage development.47 In summary, our work shows a previously uncharacterized EGFR-NFATc1 signaling and transcription pathway that bridges EGFR signaling with Sox9 expression during ADM and pancreatic cancer initiation. By using a wellestablished chronic pancreatitis model in GEM as well as experimental approaches in acinar cell explants, we found that EGFR signaling induces strong NFATc1 expression in metaplastic pancreatic cells. EGFR-mediated activation of NFATc1 involves complex formation with c-Jun on the Sox9 promoter, rendering it transcriptionally active. Given the abundance of experimental and clinical evidence linking EGFR-NFATc1 activation with chronic pancreatitis and cancer initiation, we propose that disruption of the pathway is translationally relevant, and identifies new targets and preventive strategies in patients at high risk for developing PDAC.

Supplementary Material Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at http://dx.doi.org/10.1053/j. gastro.2015.01.033.

References 1. Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2009. CA Cancer J Clin 2009;59:225–249. 2. Maitra A, Hruban RH. Pancreatic cancer. Annu Rev Pathol 2008;3:157–188. 3. Aguirre AJ, Bardeesy N, Sinha M, et al. Activated Kras and Ink4a/Arf deficiency cooperate to produce metastatic pancreatic ductal adenocarcinoma. Genes Dev 2003;17:3112–3126. 4. Hingorani SR, Petricoin EF, Maitra A, et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 2003;4:437–450. 5. Pérez-Mancera PA, Guerra C, Barbacid M, et al. What we have learned about pancreatic cancer from mouse models. Gastroenterology 2012;142:1079–1092. 6. Collins MA, Bednar F, Zhang Y, et al. Oncogenic Kras is required for both the initiation and maintenance of pancreatic cancer in mice. J Clin Invest 2012; 122:639–653. 7. Pylayeva-Gupta Y, Lee KE, Hajdu CH, et al. Oncogenic Kras-induced GM-CSF production promotes the

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080

BASIC AND TRANSLATIONAL PANCREAS

-

Q22

10

BASIC AND TRANSLATIONAL PANCREAS

1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18. 19.

20.

21.

22.

23.

Chen et al

Gastroenterology Vol.

development of pancreatic neoplasia. Cancer Cell 2012; 21:836–847. Guerra C, Schuhmacher AJ, Cañamero M, et al. Chronic pancreatitis is essential for induction of pancreatic ductal adenocarcinoma by K-Ras oncogenes in adult mice. Cancer Cell 2007;11:291–302. Reichert M, Rustgi AK. Pancreatic ductal cells in development, regeneration, and neoplasia. J Clin Invest 2011; 121:4572–4578. Yadav D, Lowenfels AB. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology 2013; 144:1252–1261. Korc M, Chandrasekar B, Yamanaka Y, et al. Overexpression of the epidermal growth factor receptor in human pancreatic cancer is associated with concomitant increases in the levels of epidermal growth factor and transforming growth factor alpha. J Clin Invest 1992; 90:1352–1360. Tobita K, Kijima H, Dowaki S, et al. Epidermal growth factor receptor expression in human pancreatic cancer: significance for liver metastasis. Int J Mol Med 2003; 11:305–309. Means AL, Ray KC, Singh AB, et al. Overexpression of heparin-binding EGF-like growth factor in mouse pancreas results in fibrosis and epithelial metaplasia. Gastroenterology 2003;124:1020–1036. Wagner M, Greten FR, Weber CK, et al. A murine tumor progression model for pancreatic cancer recapitulating the genetic alterations of the human disease. Genes Dev 2001;15:286–293. Ardito CM, Grüner BM, Takeuchi KK, et al. EGF receptor is required for KRAS-induced pancreatic tumorigenesis. Cancer Cell 2012;22:304–317. Navas C, Hernández-Porras I, Schuhmacher AJ, et al. EGF receptor signaling is essential for k-ras oncogenedriven pancreatic ductal adenocarcinoma. Cancer Cell 2012;22:318–330. Macian F. NFAT proteins: key regulators of T-cell development and function. Nat Rev Immunol 2005; 5:472–484. Mancini M, Toker A. NFAT proteins: emerging roles in cancer progression. Nat Rev Cancer 2009;9:810–820. König A, Fernandez-Zapico ME, Ellenrieder V. Primers on molecular pathways–the NFAT transcription pathway in pancreatic cancer. Pancreatology 2010;10:416–422. Müller MR, Rao A. NFAT, immunity and cancer: a transcription factor comes of age. Nat Rev Immunol 2010; 10:645–656. Buchholz M, Schatz A, Wagner M, et al. Overexpression of c-myc in pancreatic cancer caused by ectopic activation of NFATc1 and the Ca2þ/calcineurin signaling pathway. EMBO J 2006;25:3714–3724. Baumgart S, Chen N-M, Siveke JT, et al. InflammationInduced NFATc1-STAT3 transcription complex promotes pancreatic cancer initiation by KrasG12D. Cancer Discov 2014;4:688–701. Davis BP, Hammer RE, Messing A, et al. Selective expression of trypsin fusion genes in acinar cells of the pancreas and stomach of transgenic mice. J Biol Chem 1992;267:26070–26077.

-,

No.

-

24. Gu G, Wells JM, Dombkowski D, et al. Global expression analysis of gene regulatory pathways during endocrine pancreatic development. Development 2004; 131:165–179. 25. Jackson EL, Willis N, Mercer K, et al. Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev 2001; 15:3243–3248. 26. Aliprantis AO, Ueki Y, Sulyanto R, et al. NFATc1 in mice represses osteoprotegerin during osteoclastogenesis and dissociates systemic osteopenia from inflammation in cherubism. J Clin Invest 2008;118:3775–3789. 27. Means AL, Meszoely IM, Suzuki K, et al. Pancreatic epithelial plasticity mediated by acinar cell transdifferentiation and generation of nestin-positive intermediates. Development 2005;132:3767–3776. 28. Koenig A, Linhart T, Schlengemann K, et al. NFATinduced histone acetylation relay switch promotes cMyc-dependent growth in pancreatic cancer cells. Gastroenterology 2010;138:1189–1199. e1–2. 29. Guerra C, Collado M, Navas C, et al. Pancreatitisinduced inflammation contributes to pancreatic cancer by inhibiting oncogene-induced senescence. Cancer Cell 2011;19:728–739. 30. Gurda GT, Crozier SJ, Ji B, et al. Regulator of calcineurin 1 controls growth plasticity of adult pancreas. Gastroenterology 2010;139:609–619. e1–6. 31. Gurda GT, Guo L, Lee S-H, et al. Cholecystokinin activates pancreatic calcineurin-NFAT signaling in vitro and in vivo. Mol Biol Cell 2008;19:198–206. 32. Kopp JL, Figura von G, Mayes E, et al. Identification of Sox9-dependent acinar-to-ductal reprogramming as the principal mechanism for initiation of pancreatic ductal adenocarcinoma. Cancer Cell 2012;22:737–750. 33. Fukuda A, Chiba T. Sox9-dependent acinar-to-ductal reprogramming is critical for pancreatic intraepithelial neoplasia formation. Gastroenterology 2013; 145:904–907. 34. Miyamoto Y, Maitra A, Ghosh B, et al. Notch mediates TGF alpha-induced changes in epithelial differentiation during pancreatic tumorigenesis. Cancer Cell 2003; 3:565–576. 35. Pinho AV, Chantrill L, Rooman I. Chronic pancreatitis: a path to pancreatic cancer. Cancer Lett 2014; 345:203–209. 36. Mallen-St Clair J, Soydaner-Azeloglu R, Lee KE, et al. EZH2 couples pancreatic regeneration to neoplastic progression. Genes Dev 2012;26:439–444. 37. Morris JP, Cano DA, Sekine S, et al. Beta-catenin blocks Kras-dependent reprogramming of acini into pancreatic cancer precursor lesions in mice. J Clin Invest 2010; 120:508–520. 38. Hingorani SR, Wang L, Multani AS, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell 2005;7:469–483. 39. Holzmann K, Kohlhammer H, Schwaenen C, et al. Genomic DNA-chip hybridization reveals a higher incidence of genomic amplifications in pancreatic cancer than conventional comparative genomic hybridization

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200

1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260

2015

40.

41.

42.

43.

44.

45.

46.

NFATc1 and Pancreatic Transdifferentiation

and leads to the identification of novel candidate genes. Cancer Res 2004;64:4428–4433. Wang J-Y, Chen B-K, Wang Y-S, et al. Involvement of store-operated calcium signaling in EGF-mediated COX2 gene activation in cancer cells. Cell Signal 2012; 24:162–169. Macián F, García-Rodríguez C, Rao A. Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun. EMBO J 2000; 19:4783–4795. Baumgart S, Ellenrieder V, Fernandez-Zapico ME. Oncogenic transcription factors: cornerstones of inflammation-linked pancreatic carcinogenesis. Gut 2013;62:310–316. Masuda ES, Tokumitsu H, Tsuboi A, et al. The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT. Mol Cell Biol 1993;13:7399–7407. Chen Y, Cao X. NFAT directly regulates Nkx2-5 transcription during cardiac cell differentiation. Biol Cell 2009;101:335–349. Wu A, Ericson K, Chao W, et al. NFAT and AP1 are essential for the expression of a glioblastoma multiforme related IL-13Ra2 transcript. Cell Oncol 2010;32:313–329. Ling S, Chang X, Schultz L, et al. An EGFR-ERKSOX9 signaling cascade links urothelial development

11

and regeneration to cancer. Cancer Res 2011; 71:3812–3821. 47. Lin S-S, Tzeng B-H, Lee K-R, et al. Cav3.2 T-type calcium channel is required for the NFAT-dependent Sox9 expression in tracheal cartilage. Proc Natl Acad Sci U S A 2014;111:E1990–E1998.

1261 1262 1263 1264 1265 1266 1267 Authors names in bold designate shared first co-authors. 1268 1269 Received August 21, 2014. Accepted January 21, 2015. 1270 Reprint requests 1271 Address requests for reprints to: Elisabeth Hessmann, MD, Department of 1272 Gastroenterology II, University Medical Center Goettingen, Robert Koch Strasse 40, 37075 Goettingen, Germany. e-mail: [email protected] Q2 Q3 goettingen.de; fax: (49) 551-39-69-21. 1274 Acknowledgments 1275 The authors kindly thank Kristina Reutlinger, Sarah Hanheide, Waltraut Kopp 1276 (all from the Department of Gastroenterology II, University Medical Center 1277 Goettingen), and Bettina Geisel (Department of Gastroenterology, PhilippsUniversity) for technical support. 1278 1279 Conflicts of interest Q4 The authors disclose no conflicts. 1280 1281 Funding This work was supported by the DFG (KFO210, SFB-TR17 to V.E.), the German 1282 Cancer Research Foundation (109423 to V.E., 109992 to J.S., and a Mildred 1283 Scheel Fellowship to A.K.), the Mayo Foundation for Medical Research, a postdoctorate fellowship from the Center for Regenerative Medicine at the 1284 Mayo Clinic Jacksonville (G.-Y.L.), National Cancer Institute (R01 CA140182 1285 to P.S. and RO1 CA172045 to M.H.), and a National Cancer Institute Q5 1286 Pancreas SPORE grant (P50 CA102701 to D.D.B.). 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 BASIC AND TRANSLATIONAL PANCREAS

-

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

11.e1

1321 1322 1323 1324 1325Q27 1326 1327 1328 1329 1330 1331 1332 1333 1334Q28 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347Q29 1348 1349 1350Q30 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367Q31 1368 1369Q32 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380

Chen et al

Gastroenterology Vol.

Supplementary Materials and Methods Genotyping To perform mouse genotyping, genomic DNA was extracted from tail cuttings using PBND and protein kinase (Applichem). Three polymerase chain reactions were performed for each animal to test for the presence of LsLKrasG12D, NFATc1D/D, and Pdx1-Cre transgene constructs.

-,

No.

-

Human Chronic Pancreatitis Samples Human chronic pancreatitis samples were obtained from 9 different patients and were derived from the Institute of Pathology of the Philipps University Marburg and from Irene Esposito (Helmholtz Zentrum, Munich, Germany) in accordance with the ethical regulations of both institutions. All samples were subjected to immunohistochemistry as described earlier and were evaluated by 2 blinded pathologists. The samples shown in the article are representative for all patients.

Cell Lines The acinar pancreatic cell line 266-6 was derived by Robert E. Hammer from a young adult mouse.1 Cells were cultured in Dulbecco’s modified Eagle medium (Gibco), supplemented with 10% fetal calf serum (Gibco). CsA (1 mmol/L; Sigma) administration was performed for the indicated durations. For EGF treatment, cells were starved in serum-free medium for 24 hours and afterward were stimulated with EGF (20 ng/mL; Sigma) for the indicated time points. Primary cells from KrasG12D;p53wt/D ;EgfrD/D mice and KrasG12D;Trp53R172H animals2,3 were cultured in Dulbecco’s modified Eagle medium containing 10% fetal calf serum and 1% nonessential amino acids (Gibco).

Solutions for Acinar Cell Extraction Solutions used for acinar cell extraction were as follows: washing solution: 1 Hank’s balanced salt solution medium (Gibco), 5% fetal bovine serum; collagenase-containing solution: 1 Hank’s balanced salt solution medium, 1 mg/mL collagenase I (BD Biosciences); and culture solution: 1 Waymouth medium (Gibco), 1% heat-inactivated fetal bovine serum, 0.1 mg/mL trypsin inhibitor, and 1 mg/mL dexamethasone.

Histologic Evaluation and Immunohistochemistry For immunohistochemistry, formalin-fixed, paraffinembedded tissues were sectioned (4 mm) and stained with H&E. Mouse acinar-ductal metaplasia was classified according to histopathologic criteria as recommended elsewhere.2,4 For quantification of ADM in the different transgenic mouse models, the total area of acinar-ductal metaplasia in the entire pancreas was determined and the relative proportion of ADM to total pancreatic area was recorded for each animal. Immunohistochemical staining of mouse and human tissue was performed as described elsewhere,4 using the antibodies listed in Supplementary Table 1. Antibody binding was visualized using a biotinylated secondary antibody, avidin-conjugated peroxidase (Vector Laboratories), and 3,30 -diaminobenzidine tetrachloride. Hematoxylin was used as a counterstain.

Ki-67 Quantification Quantification of Ki-67 was performed as described previously.4 Briefly, for quantification of Ki-67–positive exocrine and endocrine pancreatic cells, Ki-67–positive and Ki-67–negative cells were counted in 8 visual fields per sample to determine the percentage of Ki-67–positive cells.

Isolation of Protein From Acinar Cells, Cell Lines, and Pancreatic Tissue and Immunoblotting Protein isolation of pancreatic tissue and cell lines was performed as described previously.4,5 For protein isolation from acinar cells, solidified collagen was dissolved using collagenase I (Sigma). Whole-cell lysates were prepared using lysis buffer (50 mmol/L HEPES, pH 7.5–7.9, 150 mmol/L NaCl, 1 mmol/L ethylene glycol-bis(b-aminoethyl ether)-N,N,N0 ,N0 -tetraacetic acid, 10% glycerin, 1% Triton X100, 100 mmol/L NaF, and 10 mmol/L Na4P2O7  10 H2O) containing protease inhibitors. For Western blotting, 20 mg of protein extracts were electrophoresed through 10% or 15% sodium dodecyl sulfate/polyacrylamide gels and transferred onto nitrocellulose membranes (Millipore) as Q33 described previously (Supplementary Table 2).5

Luciferase Reporter Assays Luciferase reporter assays were performed as described previously.6 The following constructs were transfected using Lipofectamine 2000 reagent (Invitrogen): MSCV-caNFATc1 Q34 (200 ng; N.A. Clipstone), Sox9 promoter (400 ng; M. Q35 Hebrok), cisNFATc1 (200 ng; Stratagene), pSG5-v-ErbB-EGFR (400 ng; M. Privalsky), c-Jun (200 ng; Y. Yamamura), pFA-cFos (200 ng; Stratagene), and pMCV (Stratagene). A Q36 plasmid-expressing Renilla luciferase (15 ng, kindly provided by R. Urrutia) was added for normalization of luciferase activity. For genetic depletion of NFATc1, cells were transfected transiently with NFATc1 small interfering RNA (Ambion).

RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction Analysis RNA from cell lines, acinar cells, and mice tissues was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and first-strand complementary DNA was synthesized from 2 mg total RNA using random primers and the Omniscript Reverse Transcriptase Kit (Qiagen). RPLP0 was used as a housekeeping gene for normalization of gene expression. For primer sequences please refer to the Supplementary Materials and Methods section. Real-time polymerase chain reaction experiments were performed in triplicate, and the results are shown as ± SD Q37 (Supplementary Table 3).

ChIP

ChIP analysis in cell lines. ChIP in 266 cells was performed after EGF or CsA treatment and after transient

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440

-

2015

NFATc1 and Pancreatic Transdifferentiation

c-Jun depletion. For c-Jun knockout, 266 cells were trans1441 Q38 fected with c-Jun small interfering RNA (sc-29224; Santa 1442 Cruz) for 48 hours using siLentFect Lipid reaction kit (1701443 3361; Bio-Rad). Culture medium was exchanged after 24 1444 hours and cells were starved before EGF treatment. Acinar 1445 cells were cross-linked with 37% formaldehyde for 10 mi1446 nutes at room temperature. Cross-linking was terminated 1447 Q39 using 2.5 mol/L glycin. Cells were washed with and har1448 vested in ice-cold DPBS. Nuclear lysates were extracted 1449 using lysis buffer (5 mmol/L PIPES, pH 8, 85 nmol/L KCl, 1450 0.5% NP) and RIPA buffer (1 mol/L Tris, pH 7.4, 5 mol/L 1451 Q40 Q41 NaCl, 10% Triton X-100, 5 g natrium-deoxycholate, 0.25 1452 mol/L EDTA, 0.2 mol/L ethylene glycol-bis(b-aminoethyl 1453 ether)-N,N,N0 ,N0 -tetraacetic acid, pH 7.2), and DNA was 1454 Q42 sheered to fragments of 500 base pairs by sonification. The 1455 following antibodies were added to precleared chromatin 1456 for overnight incubation: mouse IgG (2 mg, sc2025; Santa 1457 Cruz), rabbit IgG (2 mg, sc-2027; Santa Cruz), NFATc1 (4 mg, 1458 sc13033; Santa Cruz), H3K4trime (1.100, 9727s; Cell 1459 Signaling), c-Jun (4 mg, 09-754; Millipore), and RNA1460 Polymerase II (2 mg, 05-623; Millipore). Protein G or A 1461 beads were added and incubated for 2 hours at 4 C. Beads 1462 were washed using different washing buffers as described 1463 6 Reversion was performed using RNAse A previously. 1464 (R4642; Sigma), protein kinase, and 5 mol/L sodium 1465 dodecyl sulfate overnight at 65 C. DNA was isolated using 1466 phenol-chloroform and analyzed via quantitative reverse1467 transcription polymerase chain reaction. Primer pairs 1468 were designed after ChIP-sequence database analysis. 1469 ChIP analysis in pancreatic tissue. Dissected tissue 1470 from an entire pancreas was cross-linked with 1.5% form1471 aldehyde for 10 minutes and the reaction was stopped using 1472 2.5 mol/L glycin. Tissue was washed and mashed in ice-cold 1473 DPBS. Preparation of nuclear lysates, sonification, immu1474 noprecipitation, reversion, elution, and quantitative reverse1475 transcription polymerase chain reaction–based analysis of 1476 DNA were performed as mentioned earlier (Supplementary 1477 Table 4). 1478 1479 Bioinformatic Analyses 1480 ChIP-sequencing data for NFATc1 were used from data 1481 sets with GEO accession number GSE39969. The sequencing 1482 7 1483Q43 data were mapped using Bowtie, and NFATC1 binding peaks were identified using model-based analysis of ChIP1484 sequencing.8 Regulatory sequence analysis tools peak1485 motifs were used for the motif analysis.9 Motifs were 1486 Q44 searched for oligo-analysis, dyad-analysis, and local-word 1487 occurrences. Coordinates identified with AP1 motifs by 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500

11.e2

peak-motifs analyses from NFATc1 binding profiles were used as AP1 and NFATc1 overlapping peaks and the rest were used as NFATc1-only binding sites. These regions were used for finding pathway enrichment using the Genomic Regions Enrichment of Annotations Tool10 and Q45 compared with gene sets from the molecular signatures database.11

References 1. Davis BP, Hammer RE, Messing A, et al. Selective expression of trypsin fusion genes in acinar cells of the pancreas and stomach of transgenic mice. J Biol Chem 1992;267:26070–26077. 2. Shi C, Hong S-M, Lim P, et al. KRAS2 mutations in human pancreatic acinar-ductal metaplastic lesions are limited to those with PanIN: implications for the human pancreatic cancer cell of origin. Mol Cancer Res 2009; 7:230–236. 3. Ardito CM, Grüner BM, Takeuchi KK, et al. EGF receptor is required for KRAS-induced pancreatic tumorigenesis. Cancer Cell 2012;22:304–317. 4. Baumgart S, Chen N-M, Siveke JT, et al. Inflammationinduced NFATc1-STAT3 transcription complex promotes pancreatic cancer initiation by KrasG12D. Cancer Discov 2014;4:688–701. 5. Singh SK, Baumgart S, Singh G, et al. Disruption of a nuclear NFATc2 protein stabilization loop confers breast and pancreatic cancer growth suppression by zoledronic acid. J Biol Chem 2011;286:28761–28771. 6. Baumgart S, Glesel E, Singh G, et al. Restricted heterochromatin formation links NFATc2 repressor activity with growth promotion in pancreatic cancer. Gastroenterology 2012;142:388–398. e1–7. 7. Langmead B, Trapnell C, Pop M, et al. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 2009;10:R25. 8. Zhang Y, Liu T, Meyer CA, et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol 2008;9:R137. 9. Thomas-Chollier M, Defrance M, Medina-Rivera A, et al. RSAT 2011: regulatory sequence analysis tools. Nucleic Acids Res 2011;39:W86–W91. 10. McLean CY, Bristor D, Hiller M, et al. GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol 2010;28:495–501. 11. Liberzon A, Subramanian A, Pinchback R, et al. Molecular signatures database (MSigDB) 3.0. Bioinformatics 2011;27:1739–1740.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560

1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620

web 4C/FPO

11.e3

Chen et al

Gastroenterology Vol.

-,

No.

-

Supplementary Figure 1. NFATc1 is induced in human and murine chronic pancreatitis models. (A) Lower magnification (4) of immunohistochemical analysis of the human chronic pancreatitis samples shown in Figure 1A. (B) Representative immunohistochemical analysis of 3-month-old KrasG12D mice in the absence or presence of caerulein shows intracellular localization of NFATc1.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680

-

1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740

2015

NFATc1 and Pancreatic Transdifferentiation

11.e4

Supplementary Figure 2. Inhibition of NFATc1 impairs ADM formation in response to EGFR-signaling activation. (A) Brightfield microscopy combined with Hoechst 33324 staining shows representative areas of KrasG12D acinar cell extracts cultured in collagen for 2 days after stimulation with TGFa or pharmacologic NFATc1 inhibition with 0.5 mmol/L CsA or 10 nmol/L FK506 (left panel). Scale bar: 100 mmol/L. Quantification of ducts on day 2 of culture (means ± SD) from 3 counted wells are shown (right panel). (B) Brightfield microscopy shows morphology of EGF-treated acinar cell explants from KrasG12D mice in the absence or presence of CsA. Right panel: quantification of ductal lesions at the indicated time points (means ± SD from 3 counted wells). (C) NFATc1 messenger RNA (mRNA) expression in response to TGFa was determined using quantitative reverse-transcription polymerase chain reaction. Expression levels after 24 and 48 hours were normalized to control (means ± SD). (D) Quantitative reverse-transcription polymerase chain reaction shows NFATc1 mRNA expression levels in Kraswt mice after indicated treatments (TGFa, 50 ng/mL; CsA, 0.5 mmol/L). (E) Cytokeratin 19 mRNA expression in KrasG12D animals after EGF treatment and CsA-mediated NFATc1 inhibition.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800

1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860

Chen et al

Gastroenterology Vol.

-,

No.

-

web 4C=FPO

11.e5

Supplementary Figure 3. Depletion of NFATc1 reduces the expression of ductal markers in acinar cell explants. (A–C) Relative messenger RNA (mRNA) expression levels of (A) NFATc1, (B) cytokeratin 7, and (C) E-cadherin in response to EGF in acinar cell explants from KrasG12D mice after small interfering RNA (siRNA)-mediated transient depletion of NFATc1 (means ± SD from at least 3 independent experiments).

Supplementary Figure 4. Analyses of acinar and ductal characteristics of the acinar cell line 266-6. (A) Western blot analysis shows a time-dependent decrease of amylase expression on stimulation with EGF. (B) Increased Sox9 expression levels after EGF treatment in 266-6 cells are shown by immunoblot. (C) Quantitative reverse-transcription polymerase chain reaction shows expression of NFATc1, cytokeratin 19 (CK-19), and amylase upon indicated treatments for 24 hours. DMSO, dimethyl sulfoxide; mRNA, messenger RNA.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920

1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980

2015

NFATc1 and Pancreatic Transdifferentiation

11.e6

web 4C=FPO

-

Supplementary Figure 5. Inflammation-induced acinar-ductal metaplasia comprises up-regulation of c-Jun expression. (A–D) Western blot analyses show specificity of the indicated antibodies. (E) c-Jun messenger RNA (mRNA) levels in pancreatic tissue of 12-week-old Pdx1-Cre;KrasG12D mice exposed to caerulein. Results display mean values of 3 different mice per condition ± SD. (F) NFATc1 immunoprecipitation in 266-6 cells shows biochemical interaction with c-Jun after EGFR activation. Whole-cell lysates were used as input samples, Erk1/2 serves as a loading control. (G) ChIP analysis in 266-6 cells on Sox9 promoter þ370 confirms the successful genetic depletion of c-Jun. siRNA, small interfering RNA.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040

2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 2058 2059 2060 2061 2062 2063 2064 2065 2066 2067 2068 2069 2070 2071 2072 2073 2074 2075 2076 2077 2078 2079 2080 2081 2082 2083 2084 2085 2086 2087 2088 2089 2090 2091 2092 2093 2094 2095 2096 2097 2098 2099 2100

Chen et al

Gastroenterology Vol.

-,

No.

-

web 4C=FPO

11.e7

Supplementary Figure 6. NFATc1-deficient KrasG12D mice do not show developmental deficiencies but lack induction of ductal markers. (A) Pdx1-Cre;NFATc1D/D mice at the age of 2 and 7 months were characterized for morphologic alterations (H&E), proliferation capacities (Ki-67), as well as acinar cell (amylase) and endocrine (insulin) function. Scale bars: 100 mmol/L for H&E, amylase, and insulin stainings; and 50 mmol/L for Ki-67 staining. (B) Ki-67 quantification in acinar cells and pancreatic islets was performed in 2- and 7-month-old Pdx1-Cre- and Pdx1-Cre;NFATc1D/D mice (mean proliferation index was expressed as a percentage of total cells ± SD of 3 animals per group). (C and D) Acinar cell explants from Pdx1-Cre;KrasG12D mice and Pdx1-Cre;KrasG12D;NFATc1D/D mice were subjected to 3 hours of EGF treatment and quantitative reversetranscription polymerase chain reaction was performed to determine the expression of (B) NFATc1 and the ductal markers (D) cytokeratin 7 and (E) cytokeratin 19 (means ± SD of 3 independent experiments). mRNA, messenger RNA.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

2101 2102 2103 2104 2105 2106 2107 2108 2109 2110 2111 2112 2113 2114 2115 2116 2117 2118 2119 2120 2121 2122 2123 2124 2125 2126 2127 2128 2129 2130 2131 2132 2133 2134 2135 2136 2137 2138 2139 2140 2141 2142 2143 2144 2145 2146 2147 2148 2149 2150 2151 2152 2153 2154 2155 2156 2157 2158 2159 2160

2161 2162 2163 2164 2165 2166 2167 2168 2169 2170 2171 2172 2173 2174 2175 2176 2177 2178 2179 2180 2181 2182 2183 2184 2185 2186 2187 2188 2189 2190 2191 2192 2193 2194 2195 2196 2197 2198 2199 2200 2201 2202 2203 2204 2205 2206 2207 2208 2209 2210 2211 2212 2213 2214 2215 2216 2217 2218 2219 2220

2015

NFATc1 and Pancreatic Transdifferentiation

11.e8

web 4C=FPO

-

Supplementary Figure 7. Genetic ablation of NFATc1 prevents inflammation-induced acinar-ductal transdifferentiation in vivo. Mice with indicated genotypes were challenged with caerulein and CsA as indicated. Expression analyses and quantification of ductal-like lesions were performed after 4 weeks of treatment. H&E staining and immunohistochemistry show lower magnifications of the pancreatic tissue samples stained in Figure 6A. Scale bars: 100 mmol/L.

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

2221 2222 2223 2224 2225 2226 2227 2228 2229 2230 2231 2232 2233 2234 2235 2236 2237 2238 2239 2240 2241 2242 2243 2244 2245 2246 2247 2248 2249 2250 2251 2252 2253 2254 2255 2256 2257 2258 2259 2260 2261 2262 2263 2264 2265 2266 2267 2268 2269 2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280

11.e9

2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291Q47 2292 2293 2294 2295 2296 2297 2298 2299 2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317 2318 2319 2320 2321 2322 2323 2324 2325 2326 2327 2328 2329 2330 2331 2332 2333 2334 2335 2336 2337 2338 2339 2340

Q46

Chen et al

Gastroenterology Vol.

Supplementary Table 1. --Antibody Amylase c-Jun Phospho-c-Jun p-EGFR p-Erk NFATc1 Cytokeratin-19 Sox9 Ki-67

Dilution 1:600 1:100 1:400 1:100 1:1000 1:100 1:50 1:6000 1:600

-,

No.

-

Supplementary Table 3. --Company

Santa Cruz Santa Cruz Santa Cruz Santa Cruz Cell Signaling Abcam Santa Cruz Abcam Epitomics

Article number sc-46657 sc-1694 sc-822 sc-101668 4376 ab25916 sc-33119 ab26414 4203-1

Gene

Forward primer

Reverse primer

RPLP0 NFATc1 E-cadherin Cytokeratin 7 Cytokeratin 19 Sox9

gtcggaggagtcggacgag gccttttgcgagcagtat agaaaatgctggccgatttaa cacgaacaaggtggagttgga cctcccgcgattacaaccact cgtgcagcacaagaaagacca

gcctttatttccttgttttgcaaa gctgccttccgtctcata cctgagtgctgggcttaaagg tgtctgagatctgcgactgca ggcgagcattgtcaatctgt gcagcgccttgaagatagcat

Q48

Supplementary Table 2. --Antibody

Dilution

Company

b-actin c-Jun Phospho-c-Fos Phospho-c-Jun E-cadherin EGF p-Erk Erk1/2 NFATc1 Sox9 Amylase Cytokeratin-19 Anti-mouse IgG Anti-rabbit IgG

1:10,000 1:500 1:1000 1:500 1:1000 1:500 1:1000 1:1000 1:500 1:1000 1:5000 1:1000 1:10,000 1:10,000

Sigma-Aldrich Santa Cruz Cell Signaling Santa Cruz BD Biosciences Santa Cruz Cell Signaling Cell Signaling Santa Cruz Abcam Santa Cruz Abcam Cell Signaling Cell Signaling

Article number A3854 Sc-1694 5348 Sc-822 610181 Sc-374255 4376 9102 sc-7294 ab26414 sc-46657 ab15463 7076 7074

Supplementary Table 4. --Gene Sox9 -825 promoter Sox9 -105 promoter Sox9 þ370 promoter

Forward primer

Reverse primer

ccgggaaaggacttgtcag

tctggttcaacgaagctgg

tccaaaatccggtccaatcag

ctccttcacgttagatacctcg

cgcgtatgaatctcctggac

ggtgttctccgtgtccg

FLA 5.2.0 DTD
YGAST59584_proof
7 March 2015
5:53 am
ce

Q49

2341 2342 2343 2344 2345 2346 2347 2348 2349 2350 2351 2352 2353 2354 2355 2356 2357 2358 2359 2360 2361 2362 2363 2364 2365 2366 2367 2368 2369 2370 2371 2372 2373 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2395 2396 2397 2398 2399 2400