Niacin inhibits vascular oxidative stress, redox-sensitive genes, and monocyte adhesion to human aortic endothelial cells

Atherosclerosis 202 (2009) 68–75

Niacin inhibits vascular oxidative stress, redox-sensitive genes, and monocyte adhesion to human aortic endothelial cells夽 Shobha H. Ganji a,b , Shucun Qin a,b , Linhua Zhang a,b , Vaijinath S. Kamanna a,b,∗,1 , Moti L. Kashyap a,b,∗∗,1 a

Atherosclerosis Research Center, Department of Veterans Affairs Healthcare System, Long Beach, CA, United States b University of California, Irvine, CA, United States Received 20 September 2007; received in revised form 8 April 2008; accepted 10 April 2008 Available online 9 May 2008

Abstract In pharmacological doses, nicotinic acid (niacin) reduces myocardial infarction, stroke and atherosclerosis. The beneficial effects of niacin on lipoproteins are thought to mediate these effects. We hypothesized that niacin inhibits oxidative stress and redox-sensitive inflammatory genes that play a critical role in early atherogenesis. In cultured human aortic endothelial cells (HAEC), niacin increased nicotinamide adenine dinucleotide phosphate (NAD(P)H) levels by 54% and reduced glutathione (GSH) by 98%. Niacin inhibited: (a) angiotensin II (ANG II)induced reactive oxygen species (ROS) production by 24–86%, (b) low density lipoprotein (LDL) oxidation by 60%, (c) tumor necrosis factor ␣ (TNF-␣)-induced NF-␬B activation by 46%, vascular cell adhesion molecule-1 (VCAM-1) by 77–93%, monocyte chemotactic protein-1 (MCP-1) secretion by 34–124%, and (d) in a functional assay TNF-␣-induced monocyte adhesion to HAEC (41–54%). These findings indicate for the first time that niacin inhibits vascular inflammation by decreasing endothelial ROS production and subsequent LDL oxidation and inflammatory cytokine production, key events involved in atherogenesis. Initial data presented herein support the novel concept that niacin has vascular anti-inflammatory and potentially anti-atherosclerotic properties independent of its effects on lipid regulation. Published by Elsevier Ireland Ltd. Keywords: Niacin; Oxidative stress; Atherosclerosis; VCAM-1; MCP-1; Vascular inflammation; Glutathione; NADPH; Aortic endothelial cells; LDL oxidation

1. Introduction Nicotinic acid (niacin) has been widely used clinically to regulate abnormalities in lipid/lipoprotein metabolism 夽 Part of this work was presented in abstract form at the Arteriosclerosis, Thrombosis, and Vascular Biology Meeting, May 2004, San Francisco and at the International Atherosclerosis Society Meeting, June 2006, Rome. ∗ Corresponding author at: Atherosclerosis Research Center, Department of Veterans Affairs Healthcare System 5901 East Seventh Street (151), Long Beach, CA 90822, United States. Tel.: +1 562 826 5820; fax: +1 562 826 5675. ∗∗ Corresponding author at: Atherosclerosis Research Center Department of Veterans Affairs Healthcare System, 5901 East Seventh Street (11/111-I), Long Beach, CA 90822, United States. Tel.: +1 562 826 5844; fax: +1 562 826 5515. E-mail addresses: [email protected] (V.S. Kamanna), [email protected] (M.L. Kashyap). 1 These authors are senior coauthors of this paper.

0021-9150/$ – see front matter. Published by Elsevier Ireland Ltd. doi:10.1016/j.atherosclerosis.2008.04.044

and in the treatment of atherosclerotic coronary heart disease (CHD; reviewed in Ref. [1]. In pharmacologic doses (1–3 g/day), niacin reduces plasma cholesterol, triglycerides, LDL, lipoprotein(a), and increases high-density lipoprotein (HDL) levels. Clinical studies have demonstrated that niacin alone or in combination can slow or reverse the progression of atherosclerosis, and reduce cardiovascular event rates and total mortality in patients with hypercholesterolemia and established atherosclerotic cardiovascular disease [1]. In combination therapy (e.g., statins), niacin can effect human coronary atherosclerosis regression and dramatically lower cardiovascular events by over 70% [2]. These unique beneficial effects of niacin on lipoproteins have been assumed to contribute to its anti-atherosclerotic properties. However, it is not clear whether the beneficial effects of niacin on atherosclerosis are completely explained by alterations in lipids.

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

Niacin, as a precursor for the synthesis of nicotinamide adenine dinucleotide (NAD+ ), increases cellular concentrations of NAD+ [3]. Yan et al. have shown that the NAD+ precursors (e.g., niacin and nicotinamide) upregulate the expression of glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting enzyme in the pentose phosphate pathway and the principal source of cellular reduced nicotinamide adenine dinucleotide phosphate (NADPH). Increased levels of NADPH decrease cellular reactive oxygen species (ROS) through regulating ROS-generating oxidases or by maintaining anti-oxidant enzymes such as catalase and glutathione reductase in active forms [4,5]. Although niacin increases NAD+ levels and upregulates G6PD in Jurkat cell line (human T-cell lymphoma), the roles of niacin in vascular endothelial cell ROS formation, and subsequent oxidation of LDL and expression of oxidation-sensitive inflammatory genes involved in early atherosclerotic processes are not known. In this study, we hypothesized that niacin by increasing NAD(P)H levels increases the redox state of vascular endothelial cells resulting in decreased ROS formation, LDL oxidation, oxidation-responsive expression of vascular cell adhesion molecule-1 (VCAM-1), monocyte chemotactic protein-1 (MCP-1), and, functionally, endothelial monocyte adhesion and infiltration, key early inflammatory events involved in atherosclerosis.

69

mized enzymatic recycling method. HAEC cells were grown in 100 mm dishes and then treated with niacin (0–1 mM) for 24 h in serum free media. After the treatment, cells were washed with PBS and cell lysate was prepared in PBS containing EDTA (1 mM). Reduced glutathione (GSH) and oxidized glutathione (GSSG) content in cell lysate was measured using method described in Cayman GSH assay kit. 2.4. Determination of superoxide (O2 − ) release by cytochrome C reduction assay Superoxide dismutase (SOD) inhibitable cytochrome C reduction assay was used to measure O2 − levels as described previously [6]. HAEC (∼70% confluent) were grown in 12 well dishes. The cells were treated with niacin (0–1.0 mM) for 24 h. After incubation, cells were treated with cytochrome C (33 ␮M) in 1 ml of phenol red free medium (GIBCO-BRL medium 199) without and with SOD (100 ␮g) and catalase (100 ␮g) for 3 h. At the end of the incubation the medium was collected and centrifuged at 4000 × g for 5 min and the absorbance of the medium was measured at 550 nm. The concentration of O2 − released by the cells was calculated using absorption coefficient of cytochrome C (19.1) and expressed as nmoles of O2 − released/milligram of protein [6]. 2.5. ROS measurement by DCFDA fluorescence

2. Materials and methods 2.1. Materials Normal human aortic endothelial cells (HAEC) and growth media were purchased from Lonza Biologics. Human macrophage THP-1 cell line was obtained from American Type Culture Collection. Angiotensin II (ANG II) and all other chemicals used were from Sigma Chemical Company. Tumor necrosis factor-␣ (TNF-␣) and human LDL were purchased from Calbiochem. 2.2. Measurement of NADH and NADPH levels in HAEC Total NADH levels was measured using NADH quantitation kit from Biovision. The assay specifically recognizes NADH/NAD in an enzyme cycling reaction. HAEC were incubated with niacin (0–1 mM) for 24 h. After the treatment, cells were washed with cold PBS and cell lysate was prepared according to the manufacturers instruction. The level of NADH was measured by measuring optical density at 450 nm. Similarly total NADPH content was measured using NADPH quantitation kit from Biovision. 2.3. Measurement of GSH and GSSG Total glutathione content in HAEC was determined using a Cayman GSH assay kit. The assay utilizes a carefully opti-

ROS production in HAEC was measured using 6-carboxy2-7 dichlorodihydroxyfluorescein diacetate (DCFDA; mainly detects H2 O2 ) fluorescent labeling method. HAEC (60–70% confluent) in chamber slides were treated with niacin (1 mM) for 24 h. Cells were loaded with DCFDA (10 ␮M) for 30 min at 37 ◦ C. Media containing DCFDA was aspirated and then ROS production was stimulated with Ang II (1 ␮M) for 10 min. The fluorescent DCFDA was quantified using Confocal Microscope (Nikon TE200 Inverted phase contrast microscope) with an excitation and emission wavelengths of 488 and 520 nm, respectively [6]. For the quantitative measurement of fluorescence intensity, HAEC cells were grown in six well plates and treated with niacin (0–1.0 mM) for 24 h. The cells were loaded with DCFDA and then stimulated with Ang II (1 ␮M) according to the procedure described above. At the end of the incubation, the cells were collected and lysed in PBS containing Triton X-100 (0.5%). The fluorescence intensity in the cell lysate was measured using BMG Lab tech instrument with excitation and emission wavelength of 488 and 520, respectively [6]. 2.6. Measurement of LDL oxidation in HAEC HAEC were incubated with LDL (100 ␮g/ml) in phenol red free medium (GIBCO-BRL medium 199) in presence of niacin (0–0.5 mM) for 24 h. At the end of the incubation media were collected and thiobarbituric acid reactive

70

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

substance (TBARS) was measured as an index of LDL oxidation [7]. 2.7. VCAM-1 gene transcription assay A luciferase reporter assay for the VCAM-1 promoter was carried out to assess the effect of niacin on VCAM-1 gene transcription. The human VCAM-1 promoter sequence (−1717 ∼ +110 bp) covering the known regulatory elements (NF-kB, AP-1, SP-1, IRF-1 and GATA) was amplified by PCR from human genomic DNA, with the primers, 5 AGCTCTTACGCGTAGATTAGGCATTTCTCCAATGTTG (sense), and 5 -CAGATCTCGAGGTGATGAGAAAATAGTGGTTCC (anti-sense). The 1.8 kb PCR products were digested by MluI and XhoI (Invitrogen, CA), cloned into the pGL3 (R2.1) basic luciferase reporter vector (Promega, Madison, WI), and sequence-verified. HAEC were transfected with the pGL3-VCAM-1-Luc plasmid (VCAM-1) using 1.5 ␮l of FuGENE 6 transfection reagent (Roche). 5 ng of phRL-TK (Int-) vector (Promega) containing wild-type Renilla luciferase (Rluc) was included as an internal transfection control. After 24 h, transfected cells were washed with phosphate-buffered saline once and cultured for 18 h in serum-starved medium (basal EBM-2) alone or containing niacin, then incubated in the presence or absence of 10 ng/ml of TNF-␣ for 4 h. The cells were lysed for luciferase assay with the dual-luciferase reporter assay system (Promega) on a Turner Designs Luminometer TD20/20. The VCAM-1 promoter activities are reflected by the luciferase activities that are expressed as relative light units (R.L.U.) to the internal control Rluc. [8]. 2.8. Measurement of VCAM-1 and MCP-1 protein ELISA kits (Biosource) were used for the measurement of protein levels of VCAM-1 and MCP-1. HAEC were incubated in the absence or presence of niacin (0–1 mM) for 24 h in serum-free media. Cells were then stimulated with TNF-␣ (10 ng/ml) for 6 h. MCP-1 and VCAM-1 protein levels were assessed in medium and cell lysate, respectively [9,10]. 2.9. HAEC–monocyte adhesion assay Human monocytic cell line (THP-1) were labeled with fluorescent dye by incubating with 2 ,7 -bis(2-carboxyethyl)5(6)-carboxy fluorescein acetoxymethyl ester (10 ␮mol/L; Molecular Probes) at 37 ◦ C for 1 h in RPMI medium, and subsequently washed by centrifugation. HAEC were preincubated with niacin (0–1 mM) for 18 h, and were then stimulated with 10 ng/ml TNF-␣ for 5 h. HAEC were then incubated with fluorescent labeled THP-1 (106 cells/ml) for 1 h at 37 ◦ C. Non-adherent cells were removed by gently washing with PBS. The number of adherent monocytes were determined by counting 4-fields per 100× high power field using fluorescent microscopy [11].

2.10. NF-kB activation assay Activation of nuclear factor-␬B (NF-␬B) was determined using TransAM ELISA kit (Active Motif). Cells were treated with niacin (0–0.5 mM) for 24 h, and then stimulated with TNF-␣ (10 ng/ml) for 2 h. After the stimulation cells were washed, centrifuged and nuclear extract was prepared using nuclear extract kit form Active Motif according to the manufacturer’s instruction. Nuclear protein (3 ␮g) or jurkat nuclear extract (1 ␮l) as positive control were incubated in 96-well plates with immobilized oligonucleotides containing the NF␬B consensus DNA-binding site (5 -GGGACTTTCC-3 ) for 1 h at room temperature. NF-␬B (p65 subunit) binding assay was done according to the procedure provided in the assay kit. 2.11. HAEC viability assay Effect of varying concentration of niacin on HAEC viability was performed using CellTiter-Glo cell viability assay kit (Promega), a highly sensitive method for assaying cytotoxicity. The assay uses unique stable form of luciferase to measure ATP as an indicator of viable cells. HAEC were grown in 96 well plates (∼20,000 cells per well). Cells were treated with niacin (0–1 mM) for 24 h in serum free medium. At the end of incubation the cell viability was assessed using the procedure described by the manufacturer. 2.12. Statistical analysis Data presented are mean ± S.E. of three separate experiments. Statistical significance was calculated by using Student’s t test, and a value of P < 0.05 was considered significant.

3. Results 3.1. Effect of niacin on HAEC viability Initially, the effect of niacin on HAEC viability was studied using CellTiter-Glo cell viability assay kit. Incubation of HAEC with niacin (0.25–1 mM) for 24 h had no toxic effect on HAEC viability. The Relative Luminescence Unit (103 ) values for Control, niacin (0.25 mM), niacin (0.5 mM), and niacin (1 mM) were 258.16 ± 38.51, 282.05 ± 47.19, 262.64 ± 63.37, 257.17 ± 65.73, respectively. 3.2. Niacin increases NADPH and GSH levels Since NAD(P)H levels regulate redox state and the production or removal of ROS, we measured these reduced nucleotides. Preincubation of cells with niacin (0.25–1 mM) for 24 h significantly increased NADPH levels by 34–54% (Fig. 1 A). Niacin had no significant effect on NADH levels in HAEC (Fig. 1B). Niacin did not affect total glutathione

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

71

Fig. 1. Niacin increases redox state in HAEC. Cells were treated with niacin (0–1 mM) for 24 h, and various redox state parameters were measured as described in Section 2. (A) NADPH; (B) NADH; (C) GSH; and (D) GSH/GSSG ratio. Control cells are treated with PBS vehicle. Data are mean ± S.E. of three independent experiments.

content in HAEC (data not shown). However, niacin significantly increased GSH levels by 98% and GSH/GSSG ratio compared to control (Fig. 1C and 1D). 3.3. Niacin inhibits ROS production and LDL oxidation in HAEC Since NADPH and GSH regulate cellular redox state, we examined the effect of niacin on ROS production and subsequent effects on LDL oxidation in HAEC. Niacin inhibited O2 −• C production by 60% in HAEC (Fig. 2A). We further examined the effect of niacin on ROS production induced by Ang II, a known modulator of oxidative stress and related inflammatory events in vascular cells. Fluorescence microscopic examination of HAEC preloaded with DCFDA indicated that Ang II (1 ␮M) markedly induced ROS production (Fig. 2B). Preincubation of HAEC with niacin (1 mM) markedly blocked Ang II-induced ROS production (Fig. 2B). This fluorescence microscopic observation was further quantified by measuring the fluorescence intensity of the cells loaded with DCF-DA. The fluorescence intensity in the cell lysate was measured with excitation and emission ave length of 488 and 520 respectively. Treatment of HAEC with Ang II (1 ␮M)-induced ROS production by 8 fold compared to con-

trol. Niacin (0.25–1 mM) significantly and dose-dependently inhibited ROS production by 24–86% (Fig. 2C). As a bioassay we further assessed the effect of niacin on LDL oxidation in HAEC. Incubation of LDL (100 ␮g/ml) in phenol red free medium (GIBCO-BRL medium 199) with HAEC-induced LDL oxidation. Incubation of HAEC with niacin (0.5 mM) markedly inhibited LDL oxidation induced by HAEC (Fig. 3). 3.4. Niacin inhibits VCAM-1 and MCP-1 expression Because niacin showed anti-oxidant properties, we assessed the effect of niacin on redox-sensitive VCAM1 and MCP-1 expression induced by TNF-␣ (10 ng/ml) in HAEC. TNF-␣ markedly increased VCAM-1 gene promoter activity by 87% in HAEC. Preincubation of HAEC with niacin (0.25–0.5 mM) significantly inhibited VCAM-1 promoter activity by 77–93% (Fig. 4A). Analysis of VCAM-1 protein in cell lysate as assessed by ELISA showed that niacin (0.5–1 mM) inhibited TNF-␣-induced VCAM-1 levels by 19–32% (Fig. 4B). However, niacin had no significant effect on VCAM-1 protein secretion in the medium. VCAM-1 protein levels in the medium (ng/ml of media) in control and niacin treated cells were: control: 69.9 ± 1.3,

72

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

Fig. 2. Niacin inhibits ROS production in HAEC. (A) Superoxide; (B) representative fluorescence microscopic observation of Ang II (1 ␮M)-induced ROS production; (C) quantitative analysis of fluorescence intensity of Ang II-induced ROS production. Data are mean ± S.E. of three independent experiments.

TNF-␣: 337 ± 29.2, TNF-␣ + niacin (0.5 mM): 389.6 ± 31 (not significant when compared to TNF-␣ treated cells), TNF-␣ + niacin (1.0 mM): 321 ± 4.71 (not significant when compared to TNF-␣ treated cells). Incubation of cells with niacin (0.5–1 mM) significantly inhibited TNF-␣-induced MCP-1 secretion in medium by 34–124% when compared to TNF-␣ treated cells. MCP-1 levels in the medium (pg/mg protein) in control and niacin treated cells were: control: 316.84 ± 81; TNF-␣: 1049.62 ± 20.97 (p = 0.001 compared to control); TNF-␣ + niacin (0.5 mM): 803.43 ± 31.41 (p = 0.03 compared to TNF-␣); TNF-␣ + niacin (1.0 mM): 137.89 ± 3.02 (p = 0.0003 compared to TNF-␣). We observed that niacin at 1 mM concentration reduced MCP-1 levels below the control cells (without stimulation with TNF-␣). Based on the toxicity assessment, we believe that the effect of niacin at 1 mM concentration on MCP-1 secretion is not due to the cellular toxicity effect. Rather it is likely that niacin at 1 mM con-

centration is inhibiting the basal MCP-1 secretion in these cells. 3.5. Niacin inhibits monocyte adhesion to HAEC VCAM-1 and MCP-1 are primary pathobiologic mediators involved in monocyte adhesion and chemotaxis, key early pathobiologic events involved in atherosclerosis. As shown in Fig. 5, TNF-␣ markedly increased monocyte adhesion to HAEC. Preincubation of HAEC with niacin (0.5–1.0 mM) significantly inhibited TNF-␣ (10 ng/ml)-induced monocyte adhesion to HAEC by 41–54% (Fig. 5). 3.6. Niacin inhibits NF-κB activation induced by TNF-α in HAEC The transcription factor NF-␬B is a major regulator of pro-inflammatory cytokine expression in TNF-␣ stimulated

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

Fig. 3. Niacin inhibits endothelial cell (EC) mediated LDL oxidation. Incubation of cells with niacin and LDL oxidation were performed as described in Section 2. Data are mean ± S.E. of three independent experiments. Statistical comparisons were made between no cells vs. EC, EC vs. EC + niacin at 0.25–0.5 mM.

73

Fig. 5. Niacin inhibits TNF-␣-induced monocyte adhesion to HAEC. Experimental protocols are as described in Section 2. The number of adherent monocytes were determined by counting 4-fields using fluorescent microscopy. Statistical comparisons were made between TNF-␣ vs. TNF-␣ + niacin at 0.5–1 mM. Data are mean ± S.E. of three experiments.

endothelial cells. The effect of niacin on the binding activity of the NF-␬B subunit (p65) induced by TNF-␣ was examined. Results showed that niacin (0.25–0.5 mM) significantly inhibited the TNF-␣ stimulated binding activity (p65 subunit) by 46% (Fig. 6).

4. Discussion The data in this report demonstrate for the first time that niacin has significant anti-inflammatory properties in aortic endothelial cells. The evidence indicates a newer mechanism for niacin’s action on atherogenesis in addition to its established effects on lipid metabolism. In human aortic endothelial cells, niacin increased NADPH levels and GSH/GSSG ratio, and inhibited ROS production in concert

Fig. 4. Niacin inhibits redox-sensitive VCAM-1 expression in HAEC. (A) VCAM-1 promoter activity. VC = vector control. Statistical comparisons were made between VCAM-1 plasmid control vs. TNF-␣, TNF-␣ vs. TNF␣ + niacin at 0.25–0.5 mM. (B) VCAM-1 protein expression in cell lysate. Statistical comparisons were made between TNF-␣ vs. TNF-␣ + niacin at 0.25–0.5 mM. Data are mean ± S.E. of three independent experiments.

Fig. 6. (A) Niacin inhibits TNF-␣-induced binding activity of NF-␬B subunit in HAECs. Experimental protocols are described in Section 2. NF-␬B subunit p65 binding activity was performed by measuring optical density at 450 nm. Statistical comparisons were made between TNF-␣ vs. TNF␣ + niacin at 0.25–0.5 mM. Data are mean ± S.E. of three experiments.

74

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

with reductions in NF-kB activation, VCAM-1, MCP-1 production, LDL oxidation, and monocyte adhesion. The atherogenic properties of endothelial cell-mediated LDL oxidation include: transformation of monocyte/macrophages into lipid-laden foam-like cells, increased chemotactic activity for human monocytes, and inhibitory motility activity for tissue macrophages [7,12]. It has been suggested that the biological oxidation of LDL by aortic endothelial and other cells could account for foam cell formation and the initiation, or at least acceleration, of the atherosclerotic process [13]. Niacin, by inhibiting ROS generation and LDL oxidation by HAEC, may inhibit various atherogenic processes, including foam cell formation and monocyte-endothelial cell adhesion and chemotaxis, an early pathobiologic event in atherogenesis. Taken together, these observations lend initial but compelling evidence that niacin may have antiatherogenic effects in addition to its well-known effects on lipid metabolism, through unique vascular anti-inflammatory properties. Although the exact steps in effecting these vascular anti-inflammatory parameters in this report require extensive additional research, the data indicates a new direction of research to elucidate niacin’s well-established anti-atherogenic properties. Recently, Kuvin et al. have shown that niacin decreased C-reactive protein levels by 15% in patients with stable coronary artery disease [14]. In patients with metabolic syndrome, treatment with extended release niacin (1 g/day) for 52 weeks, improved their endothelial function by 22% and there was decrease in C reactive protein by 20% [15]. Since CRP is known to be regulated by NF-kB activation [16], our in vitro studies demonstrating the inhibition of NF-kB activation and oxidation processes by niacin in vascular cells may, at least in part, explain reductions in CRP by niacin therapy. Niacin was also shown to increase homocysteine levels [17], which may have negative effects on endothelial cells. Although mechanism by which homocysteine impairs endothelial functions is not fully understood, studies suggest that homocysteine increases superoxide production through impairment of cellular anti-oxidant system, which lead to the decrease in NO bioavailability [18]. Based on our in-vitro data in endothelial cells showing that niacin increases reduced form of GSH levels, we suggest that the negative effect caused by increased homocysteine by niacin may be eliminated by increase in redox state in these cells. Although niacin has long been used clinically, the pharmacokinetics and plasma level of niacin after ingestion of 1–3 g niacin (a commonly used dose) in humans is not clearly established. In humans, plasma levels of niacin was found to be about 0.3 mM after oral ingestion of 1 g of niacin [19,20]. Since the reported plasma concentrations are one time measurement, it is unclear whether these levels reflect trough or peak values. Furthermore, there is no reported clinical data available regarding plasma concentration of niacin after ingestion of 3 g of niacin, a commonly used dose of niacin. Extrapolation of the available data using oral dose of 1 g niacin would indicate that the 3 g of niacin oral adminis-

tration may lead to the plasma concentrations of niacin in the range of 0.8–1 mM. In our in-vitro studies we used 0.25 to 1 mM niacin, and we believe that the concentrations of niacin used in our in vitro studies are physiologically relevant in interpretation of the data and establishing the proof-ofprinciple in vascular cells. However, caution should be taken in extrapolating in vitro finding to the in-vivo mechanisms in humans. As discussed earlier, increased NADPH has been previously shown to regulate xanthine oxidase and glutathione reductase system that prevents cellular levels of ROS formation [4,5]. We suggest that the increased NADPH levels by niacin, through inhibiting xanthine oxidase and/or maintaining glutathione reductase in its reduced form, may inhibit ROS production and subsequent LDL oxidation in HAEC. Pathobiologic mediators including hormones and inflammatory cytokines (e.g., ANG II, TNF-␣) have been shown to induce vascular cell ROS production through activating NADPH oxidase system [21]. Additionally, Li and Shah [22] reported that ANG II-stimulated endothelial NADPH oxidase activity is regulated through serine phosphorylation of p47phox and its enhanced binding to p22phox. Since niacin blocked ANG II-induced ROS production in HAEC, we suggest that niacin may also have inhibitory role on NADPH oxidase activity. However, additional studies are warranted on the direct effect of niacin on these oxidases and anti-oxidation enzyme systems. Additionally, further work is warranted in understanding the role of mitochondria in niacin-mediated decreased ROS production. The initial observations presented in this report provide rationale for further extensive studies defining the mechanisms of anti-oxidation and antiinflammatory properties of niacin in vascular cells. Recruitment of circulating monocytes into the artery wall is an important early pathobiologic feature involved in the development of atherosclerosis. During early atherogenesis, increased expression of VCAM-1 and MCP-1 are major cytokines involved in monocyte adhesion and subsequent transmigration into the artery wall [23]. Elevated levels of VCAM-1 and MCP-1 have been seen in patients with atherosclerosis [24–27]. Additionally, mice deficient in VCAM-1 or MCP-1 have reduced fatty streak and atherosclerotic lesions [28,29]. The expression of these genes (VCAM-1 and MCP-1) has shown to be regulated by inflammatory mediators (e.g., TNF-␣, IL-1␤) and oxidative products [23]. Endothelial cell VCAM-1 expression by diverse inflammatory cytokines (e.g., TNF-␣, IL-1␤) has been shown to occur through an anti-oxidant-inhibitable mechanism that involves a reduction-oxidation sensitive activation of NF-kB nuclear factor [30]. MCP-1 expression has also been regulated by oxidation-mediated mechanisms that involve redox-regulated transcription factors [31,32]. In our studies, we have shown that niacin significantly decreased NF-kB activation, expression of VCAM-1 and MCP-1 induced by TNF-␣, and inhibited TNF-␣induced monocyte adhesion to endothelial cells. We suggest that niacin, through inhibiting NF-kB activation, inhibits

S.H. Ganji et al. / Atherosclerosis 202 (2009) 68–75

redox-sensitive VCAM-1 and MCP-1 expression in endothelial cells. In summary, our data indicate that niacin by increasing the redox potential of vascular endothelial cells, inhibits LDL oxidation and redox-sensitive inflammatory genes involved in monocyte chemotaxis, key early event in atherogenesis. Initial data presented herein support the novel concept that niacin has vascular anti-inflammatory and potentially antiatherosclerotic properties independent of its effect on lipid regulation.

Acknowledgments This study was supported in part by grants from the Department of Veterans Affairs Merit Review Program and the Southern California Institute for Research and Education.

References [1] Meyers CD, Kamanna VS, Kashyap ML. Niacin therapy in atherosclerosis. Curr Opin Lipidol 2004;15:659–65. [2] Brown BG, Zhao X-Q, Chait A, et al. Simvastatin and niacin, antioxidant vitamins, or the combination for the prevention of coronary disease. N Eng J Med 2001;345:1583–92. [3] Yan Q, Briehl M, Crowley CL, et al. The NAD + precursors, nicotinic acid and nicotinamide upregulate glyceraldehyde-3phosphate dehydrogenase and glucose-6-phosphate dehydrogenase mRNA in Jurkat cells. Biochem Biophys Res Commun 1999;255: 133–6. [4] Harris CM, Sanders SA, Massey V. Role of the flavin midpoint potential and NAD binding in determining NAD versus oxygen reactivity of xanthine oxidoreductase. J Biol Chem 1999;274:4561–9. [5] Cao Z, Li Y. Chemical induction of cellular antioxidants affords marked protection against oxidative injury in vascular smooth muscle cells. Biochem Biophys Res Commun 2002;292:50–7. [6] Parinandi NL, Kleinber MA, Usatyuk PV, et al. Hyperoxia-induced NAD(P)H oxidase activation and regulation by MAP kinases in human lung endothelial cells. Am J Physiol 2003;284:L26–38. [7] Steinbrecher UP, Parthasarathy S, Leake DS, Witztum JL, Steinberg D. Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids. Proc Natl Acad Sci 1984;81(12):3883–7. [8] Dagia NM, Harii N, Meli AE, et al. Phenyl methimazole inhibits TNF-ainduced VCAM-1 expression in an IFN regulatory factor-1-dependent manner and reduces monocytic cell adhesion to endotelial cells. J Immunol 2004;173:2041–9. [9] Jiang Mi-Zu, Tsukahara H, Ohshima Y, et al. Effect of antioxidants and nitric oxide on TNF-␣-induced adhesion molecule expression and NF␬B activation in human dermal microvascular endothelial cells. Life Sci 2004;75:1159–70. [10] Chen XL, Grey JY, Thomas S, et al. Sphingosine kinase-1 mediates TNF-alpha-induced MCP-1 gene expression in endothelial cells: upregulation by oscillatory flow. Am J Physiol Heart Circ Physiol 2004;287:H1452–8. [11] Chen JW, Chen YH, Lin FY, Chen YL, Lin SJ. Ginkgo biloba extract inhibits tumor necrosis factor-alpha-induced reactive oxygen species generation, transcription factor activation, and cell adhesion molecule expression in human aortic endothelial cells. Arterioscler Thromb Vasc Biol 2003;23(9):1559–66.

75

[12] Quinn MT, Parthasarathy S, Fong LG, Steinberg D. Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during atherogenesis. Proc Natl Acad Sci 1987;84(9):2995–8. [13] Steinberg D. Atherosclerosis in perspective: hypercholesterolemia and inflammation as partners in crime. Nat Med 2002;8:1211–7. [14] Kuvin JT, Dave DM, Sliney KA, et al. Effect of extended-release niacin on lipoprotein particle size, distribution, and inflammatory markers in patients with coronary artery disease. Am J Cardiol 2006;98(6):743–5. [15] Thoenes M, Oguchi A, Nagamia S, et al. The effects of extendedrelease niacin on carotid intimal media thickness, endothelial function and inflammatory markers in patients with the metabolic syndrome. Int J Clin Pract 2007;61(11):1942–8. [16] Patel DN, King CA, Bailey SR, et al. Interleukin-17 stimulates Creactive protein expression in hepatocytes and smooth muscle cells via p38 MAPK and ERK1/2-dependent NF-KappaB and C/EBP beta activation. J Biol Chem 2007;282(37):27229–38. [17] Wang W, Basinger A, Neese RA, et al. Effect of nicotinic acid administration on hepatic very low density lipoprotein-triglyceride production. Am J Physiol Endocrinol Metab 2001;43:E540–7. [18] Upchurch GR, Welch GN, Fabian AJ, et al. Homocyst(e)ine decreases bioavailable nitric oxide by a mechanism involving glutathione peroxidase. JBC 1997;272(27):17012–7. [19] Carlson LA, Oro L, Ostman J. Effect of single dose of nicotinic acid on plasma lipids in patients with hyperlipoproteinemia. Acta Med Scand 1968;183(5):457–65. [20] Stern RH, Spence JD, Freeman DJ, Parbtani A. Tolerance to nicotinic acid flushing. Clin Pharmacol Ther 1991;50(1):66–70. [21] Griendling KK, Sorescu D, Ushio-Fukai M. NADPH oxidase: role in cardiovascular biology and disease. Circ Res 2000;86:494–501. [22] Li JM, Shah AM. Mechanism of endothelial cell NADPH oxidase activation by angiotensin II. J Biol Chem 2003;278:12094–100. [23] Libby P. Inflammation in atherosclerosis. Nature 2002;420:868–74. [24] Wallen NH, Held C, Rehnqvist N, Hjemdahl P. Elevated serum intercellular adhesion molecule-1 and vascular adhesion molecule-1 among patients with stable angina pectoris who suffer cardiovascular death or non-fatal myocardial infarction. Eur Heart J 1999;20(14):1039–43. [25] Hwang SJ, Ballantyne CM, Sharrett AR, et al. Circulating adhesion molecules VCAM-1, ICAM-1, and E-selectin in carotid atherosclerosis and incident coronary heart disease cases: the Atherosclerosis Risk In Communities (ARIC) study. Circulation 1997;96(12):4219–25. [26] Hackman A, Abe Y, Insull Jr W, et al. Levels of soluble cell adhesion molecules in patients with dyslipidemia. Circulation 1996;93(7):1334–8. [27] de Lemos JA, Morrow DA, Sabatine MS, et al. Association between plasma levels of monocyte chemoattractant protein-1 and long-term clinical outcomes in patients with acute coronary syndromes. Circulation 2003;107(5):690–5. [28] Cybulsky MI, Iiyama K, Li H, et al. A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J Clin Invest 2001;107(10):1255–62. [29] Gu L, Okada Y, Clinton SK, et al. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptordeficient mice. Mol Cell 1998;2(2):275–81. [30] Marui N, Offermann MK, Swerlick R, et al. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J Clin Invest 1993;92:1866–74. [31] Chen XL, Zhang Q, Zhao R, Medford RM. Superoxide, H2 O2 , and iron are required for TNF-a-induced MCP-1 gene expression in endothelial cells: role of Rac1 and NADPH oxidase. Am J Physiol Heart Circ Physiol 2004;286:H1001–7. [32] Ping D, Boekhoudt GH, Rogers EM, Boss JM. Nuclear factor-kappa B p65 mediates the assembly and activation of the TNF-responsive element of the murine monocyte chemoattractant-1 gene. J Immunol 1999;162(2):727–34.