Nicotine differentially activates inhibitory and excitatory neurons in the dorsal spinal cord

Pain 109 (2004) 308–318 www.elsevier.com/locate/pain

Nicotine differentially activates inhibitory and excitatory neurons in the dorsal spinal cord Matilde Cordero-Erausquin, Ste´phanie Pons, Philippe Faure, Jean-Pierre Changeux* Re´cepteurs et Cognition, CNRS URA2182, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France Received 10 September 2003; received in revised form 7 January 2004; accepted 26 January 2004

Abstract Nicotinic agonists have well-documented antinociceptive properties when administered subcutaneously or intrathecally in mice. However, secondary mild to toxic effects are observed at analgesic doses, as a consequence of the activation of the large family of differentially expressed nicotinic receptors (nAChRs). In order to elucidate the action of nicotinic agonists on spinal local circuits, we have investigated the expression and function of nAChRs in functionally identified neurons of neonate mice spinal cord. Molecular markers, amplified at the single-cell level by RT-PCR, distinguished two neuronal populations in the dorsal horn of the spinal cord: GABAergic/glycinergic inhibitory interneurons, and calbindin (CA) or NK1 receptor (NK1-R) expressing, excitatory interneurons and projection neurons. The nicotinic response to acetylcholine of single cells was examined, as well as the pattern of expression of nAChR subunit transcripts in the same neuron. Beside the most expressed subunits a4, b2 and a7, the a2 subunit transcript was found in 19% of neurons, suggesting that agonists targeting a2* nAChRs may have specific actions at a spinal level without major supra-spinal effects. Both inhibitory and excitatory neurons responded to nicotinic stimulation, however, the nAChRs involved were markedly different. Whereas GABA/glycine interneurons preferentially expressed a4a6b2* nAChRs, a3b2a7* nAChRs were preferentially expressed by CA or NK1-R expressing neurons. Recorded neurons were also classified by firing pattern, for comparison to results from single-cell RT-PCR studies. Altogether, our results identify distinct sites of action of nicotinic agonists in circuits of the dorsal horn, and lead us closer to an understanding of mechanisms of nicotinic spinal analgesia. q 2004 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. Keywords: Nicotine; Analgesia; Spinal; Interneuron; Projection; mRNA

1. Introduction The analgesic effects of nicotine on mammals are well established (Davis et al., 1932) and the discovery that epibatidine, a nicotinic agonist, displays antinociceptive properties at extremely low doses (Spande et al., 1992), stimulated research on the mechanisms of this analgesia, as well as the production of clinically relevant analogue molecules (reviewed in Flores, 2000). However, at analgesic doses, nicotine, epibatidine and its analogues have secondary cardiovascular and motor effects, and at slightly higher doses their effects vary from mildly toxic to lethal (Bannon et al., 1995; Boyce et al., 2000; Decker et al., 1998). Nicotine binds to the nicotinic receptor (nAChR), * Corresponding author. Tel.: þ33-1-45-68-88-05; fax: þ33-1-45-6888-36. E-mail address: [email protected] (J.P. Changeux).

which is a transmembrane protein formed of five subunits surrounding a central cationic pore (Corringer et al., 2000). In the central nervous system of mammals, nine nicotinic subunits (a2 –7, b2 –4) have been identified, that assemble to form several types of nAChR, with different kinetic and pharmacological properties (Sargent, 1993). The broad spectrum of the in vivo effects of nicotine is potentially linked to the differential implication of these nAChR types. Therefore, understanding the roles of specific nAChR types in identified nuclei or neurons is the first step towards the dissection of the various effects of nicotinic agonists, and the elaboration of clinical analogues devoid of side effects. In mice, the antinociceptive effect of nicotine and nicotinic agonists is well documented after supra-spinal (Flores, 2000) but also spinal injections (Damaj et al., 1998). Moreover, lower, non-analgesic, intrathecal doses of nicotine display anti-allodynic properties clearly separated from secondary or toxic effects (Rashid and Ueda, 2002).

0304-3959/$20.00 q 2004 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.pain.2004.01.034

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

Understanding the spinal actions of nicotine is therefore a clinically important challenge. Nicotine exerts a presynaptic effect on inhibitory and excitatory terminals in the spinal cord (SC, Fucile et al., 2002; Genzen and McGehee, 2003; Kiyosawa et al., 2001; Marubio et al., 1999; Takeda et al., 2003) and induces serotonin (5HT) release (CorderoErausquin and Changeux, 2001). A model network of excitatory and inhibitory neurons proposed in the latter study has also been used to account for the anti-allodynic properties of intrathecal nicotine (Rashid and Ueda, 2002). However, the cellular characterization of this network relies on the ability to identify the functional role of the recorded neurons. We took advantage of the abundant immunocytochemical data available (reviewed in Todd, 2002) to select molecular markers that distinguish functional neuronal classes such as inhibitory and excitatory neurons. We used whole-cell recordings and single-cell RT-PCR to characterize the cellular expression of eight molecular markers and nine nicotinic transcripts, together with the response to nicotine and neuronal firing pattern. We show that GABAergic and/or glycinergic neurons preferentially express a4a6b2* nAChRs, whereas excitatory, calbindin or NK1-receptor expressing neurons are associated with a3b2a7* nAChRs.

2. Material and methods 2.1. Slice preparation Seven- to 12-day-old C57Bl6 mice (Janvier, Le GenestSt-Isle, France) were killed by decapitation. A thoracic portion of the SC was rapidly removed by hydraulic pressure, embedded in 4% agar, and transversely cut in an ice-cold oxygenated (95% O2, 5% CO2) solution containing (in mM): sucrose 213, KCl 2.5, MgCl2 1, CaCl2 2, NaHPO4 1.25, NaHCO3 26, glucose 25. The 250 mm slices were then allowed to recover for 1 h at 37 8C in a similar ACSF solution in which NaCl 126 mM replaced sucrose. 2.2. Reagents Unless specified, all chemical reagents were purchased from Sigma Aldrich. 2.3. Whole-cell recordings The recordings were done at room temperature. A single slice was transferred to the recording chamber superfused with oxygenated ASCF at a rate of 1.8 ml/min. Atropine (1 mM) was added to the solution to inhibit muscarinic receptors. Patch pipettes were filled with an internal solution containing (in mM): Kgluconate 144, MgCl2 3, Hepes 10, EGTA 0.5, pH 7.2, yielding to a 3– 4 MV resistance. Cells were visualized with an upright microscope with infrared illumination, and whole-cell recordings were made using

309

Axopatch-1C (Axon Instruments, Foster City, CA) amplifier, operating under current- and voltage-clamp mode. Data were filtered at 1 kHz, digitized at 3.33 kHz and analyzed using PClamp 8 (Axon Instruments). 2.4. Electrophysiological characterization The whole cell configuration was obtained in the voltageclamp mode. Whatever the recording mode, neurons were held at 2 72 mV (corrected for junction potential). All neurons exhibited a multiphasic capacitance transient, indicating the presence of multiple electric compartments; the first exponential component was corrected at the beginning of the recording. The firing pattern of neurons was examined in the current-clamp mode, in responses to 700 ms depolarizing steps (10 – 120 pA). The spike threshold was defined as the membrane potential at which the dV=dt exceeded 10 V s21 (Stuart et al., 1997). The spike width was the time needed for the potential to return and cross the threshold level again. The interspike interval (ISI) was defined as the time between the peaks of spikes. The coefficient of variation (CV) is, for each current step, the ISIs SD divided by the mean spike frequency. CV mean was calculated for each neuron from four depolarizing steps (30, 60, 90, 120 pA). Input resistance was measured from responses to a hyperpolarizing 30 pA step. A monoexponential fit of the rising phase of this response gave an estimate of the membrane time constant ðtÞ: Most neurons exhibited an IH -like current; this was quantified as the difference between the maximal voltage variation and the voltage deviation at the end of a 120 pA hyperpolarizing step, expressed as a percentage of the maximal voltage deviation. The recording was then switched to the voltageclamp mode for pharmacological characterization. 2.5. Drug application All drugs were dissolved in ASCF. Fast application of ACh (1 mM) was achieved by pressure-pulse delivery (5 psi for 30 ms) to a pipette positioned under visual control at < 30 mm from the targeted cell. After recording of the response, a Gaussian lowpass filter with a 100 Hz cutoff was applied before measuring its current amplitude. We chose a threshold of 20 pA to define responses to ACh. This threshold was two times the amplitude of baseline non-stimulated fluctuations (noise) which was typically of the order of 10 pA. Series and input resistances were monitored by a hyperpolarizing step (2 10 mV during 30 ms) preceding the ACh application. When studying the effect of an antagonist, three pulses of ACh (at 2 min intervals) were delivered to ensure stability of the response; the antagonist was then bath-perfused and its effect on ACh response was tested every 2 min. Responses are given as mean value ^ SEM.

310

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

2.6. Cytoplasm harvest, single cell RT-PCR and multiplex PCR The cytoplasm was retrieved by aspiration through the patch-pipette at the end of the recording; aspiration was applied only as long as the gigaseal was maintained. The pipette content was expelled into a test tube in which the RT reaction was performed in a final volume of 10 ml (Lambolez et al., 1992) and left overnight at 37 8C. The two steps of multiplex PCR were performed as described previously (Le´na et al., 1999) with primers specific to mouse sequences as listed in Table 1. The primers were located in different exons to rule out genomic DNA amplification. The cDNAs of the 17 studied species present in the whole volume of the RT reaction were amplified simultaneously in a first step. Taq polymerase (2.5 U) (Quiagen, Hilden, Germany) and 10 pmol of each of the 34 primers were added in the buffer supplied by the manufacturer (final volume 100 ml), and 30 cycles (94 8C, 1 min; 60 8C, 1 min; 72 8C, 1.30 min) of PCR were run. Second rounds of PCR were then performed using 2 ml of the first PCR as a template (final volume 50 ml). In this second PCR, each cDNA was amplified individually using its specific primer pair by performing 35 cycles as described above. Twenty microliters of each individual PCR were then run on a 2% agarose gel; sequencing (Genome Express, Grenoble, France) was done to confirm the specificity of PCR products. 2.7. RT-PCR controls Positive and negative controls were performed as follows: total RNA was extracted (RNeasy Mini, Quiagen) from the brain and SC of a C57Bl6 12-day-old mouse. The primers were first successfully tested on 50 ng of these

extracts; a positive control tube, containing 50 ng of brain RNA was then systematically included in every RT and subsequent PCR session. Conversely, at the end of each recording session, extracellular solution was aspired through a new patch pipette near harvested neurons. The content of this control pipette was expelled and underwent the same RT-PCR process. In every session, any marker that was not detected in the positive control, or that was detected in the negative control, was excluded from analysis. 2.8. Statistical analysis of associations The association between two molecular markers A and B was tested using a x 2 test of independence of two attributes in a 2 £ 2 contingency table. This test is based on the comparison between the experimentally observed and the theoretically determined distribution of any two markers within the neuronal population; the theoretically determined (or expected) distribution is derived from the observed proportion of neurons expressing each individual marker, assuming that the markers are expressed independently of each other. For example, the expected number of neurons expressing both A and B is EðA and BÞ ¼ ðnA nB Þ=N; where nA ðnB Þ is the number of neurons expressing the marker A (the marker B) and N is the total number of neurons (see legend of Fig. 3 for a numerical example). We similarly determined EðA not BÞ ; Eðnot A and BÞ and Eðnot A and not BÞ ; which are the expected number of neurons expressing A and not B, B and not A, nor A nor B. For each of these sub-populations, the deviation between these theoretically determined numbers and the experimentally observed ones is calculated. The x 2 value reflects the sum of these individual deviations; if x 2 . 3:84; the null hypothesis (i.e. independence of A and B expression) is rejected (P ¼ 0:05; dll ¼ 1), meaning that there is an association (or an exclusion) between

Table 1 PCR primer sequences Marker

Forward primer sequence

Reverse primer sequence

Size

a2 a3 a4 a5 a6 a7 b2 b3 b4 NPY ChAT CA PV GAD65 GAD67 GLYT2 NK1

CTTCTTCACGGGCACTGTGCACTGGGTG CGTGCTTTACAACAACGCCGATGGGG TCCATCCGCATCCCATCTGAACTCAT GACGGTGGACCTAAATCTCGGAATAC CTCAAGTATGACGGTGTGATAACCTGG GTGGAACATGTCTGAGTACCCCGGAGTGAA GCTCCAACTCTATGGCGCTGCTG CCATCGGAGTCGCTCTGGCTGCCTGAC GCTATGAAGGGGTGAACATTCTGAGGAT TGTTTGGGCATTCTGGCTGAGG GGTCCCCCCAAAGATGCCTG AGGCGCGAAAGAAGGCTGGAT AAGAACCCGGATGAGGTGAAGA TCTTTTCTCCTGGTGGCGCC TACGGGGTTCGCACAGGTC CATGGTGTCAAGTCCAAGCGTG CAGGACTTACGAGAAAGCGTAC

GGGATGACCAGTGAGGTGGATGGGATTAT GGAAGGGATGGTCTCGGTGATCACGAGG CCACACGGCTGTGCATGCTCA GCTTGACTGCTCACTAAGTCCAGTGTAA GGAAGATGGTCTTCACCCACTTGGGC GAGTCTGCAGGCAGCAAGAATACCAGCA CCTCAGGCTTCCATGTGAGGCGATA CGTCCGAGGGTAGGTAGAACACCAGGAC AGGGGAACGTCGAGGGAGGTGGGAGG TTCTGGGGGCGTTTTCTGTGC TTCAGCCAGTATTCAGAGACCC TCCCACACATTTTGATTCCCTGG ATGGCGTCATCCGAGGGCC CCCCAAGCAGCATCCACGT CCCCAGGCAGCATCCACGT TTCTGCATGACTGCCTATCCGA GAGATCTGGGTTGATGTAGGGC

486 523 268 296 619 510 282 466 593 205 260 431 360 390 599 702 232

Shown are the sequences of PCR primers used in this study, as well as the size of the amplified segment.

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

the expression of A and B; it is possible to decide within an association or an exclusion by analyzing which individual deviation has the biggest weight on the x 2 ; i.e. which subpopulation is more distant from the expected value. The same method was used to quantify the association between a molecular marker and a discontinuous parameter (for example, presence of an ACh response). To prevent false analysis due to the large differences in expression levels of the individual markers, it is essential that all four sub-populations be considered. Also, this technique only allows a comparison of parameters two by two; the definition of a population of neurons that preferentially express a set of markers is therefore an extrapolation of these two by two results. All continuous parameters (ACh response kinetics, firing properties) have been compared with all binary parameters (presence of a marker, of an ACh response) using a Student’s t-test; only positive results are mentioned in the text. 2.9. Anatomical analysis The SC of a C57Bl6 8-day-old mouse was dissected, postfixed overnight in 4% PFA, and transversely cut (50 mm). Slices were incubated in hematoxylin (Gill), dehydrated in ethanol, incubated in Histocleare and mounted. Images were acquired with a digital color camera linked to the microscope (Zeiss). One of these pictures (Fig. 2) was taken as a reference to resize the subsequent pictures of fresh tissue slices used in electrophysiological recordings. An arc was drawn on this reference picture, that best respected the disposition of neurons whatever its radius, but with a fixed center (e.g. orange and red arcs in Fig. 2 (right), the cross representing their center). The location of recorded neurons was quantified as follows: the recording

311

pipette was pictured while still in the slice; this picture was resized to fit the reference picture and the pipette tip location was plotted (Fig. 2, left). The distance of a recorded neuron was defined as the radius of the arc that crossed its plot divided by the maximal diameter (distance of the most superficial recorded neuron ¼ 1).

3. Results 3.1. Somato-dendritic nicotinic response of dorsal spinal neurons A total of 119 neurons located within the spinal dorsal horn of 7- to 12-day-old mice were recorded, and acetylcholine (ACh, 1 mM) was pressure-applied in the presence of 1 mM atropine on 89 neurons (V-clamp configuration). Beside presynaptic effects described previously in the dorsal SC (Fucile et al., 2002; Genzen and McGehee, 2003; Kiyosawa et al., 2001; Marubio et al., 1999; Takeda et al., 2003), ACh elicited a measurable (. 20 pA) somato-dendritic current in 65 neurons (73%; Fig. 1a and b). Responses varied in amplitude and kinetics. The mean postsynaptic response amplitude was 112.5 ^ 14.9 pA ðn ¼ 65Þ; the mean rise time was 98.1 ^ 10.4 ms and the current returned to baseline in less than 2 s (9.1 ^ 1.15% residual current after 1.8 s). The current elicited by ACh was completely inhibited by 30 mM mecamylamine (n ¼ 3; Fig. 1c). In a subset of responding neurons, the effect of ACh was tested in current clamp ðn ¼ 7Þ; the depolarization induced by ACh lead to spike firing in 6 out of 7 tested neurons (Fig. 1a). The responding neurons were preferentially located in the deep dorsal horn (Fig. 2). In order to quantify this

Fig. 1. Nicotinic response of dorsal horn neurons. (a) Voltage- and current-clamp recording of a neuron responding to pressure applied ACh (1 mM, 30 ms, triangles, in the presence of 1 mM atropine); same scale as in (b). (b) Voltage-clamp recording of a non-responding neuron. (c) Inhibition of the ACh-gated current (tested every 2 min) by 30 mM mecamylamine (horizontal bar).

312

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

The nAChRs identified by our recordings could be located both on excitatory or inhibitory neurons, and might therefore act at different sites in the spinal local circuit. Moreover, different types of nAChRs could be involved. We examined these points in experiments using single cell RT-PCR. 3.2. nAChRs expression in single dorsal spinal neurons Fig. 2. Distribution of responding and non-responding neurons within the dorsal horn of the spinal cord. Neurons responding with a somato-dendritic current to the application of ACh are plotted with a gray circle; those nonresponding this way with a white circle. The radius of the red and orange arcs is the mean distance of responding and non-responding neurons, respectively, to the neck of the spinal cord (x). A gray line borders the gray matter of the spinal cord.

observation, we ranked the distance of the recorded neurons to the neck of the dorsal horn (see Section 2). We avoided defining laminae according to visual landmarks, since they differ in adults, neonates and young animals (Woodbury et al., 2000). The mean distance to the neck of responding neurons (0.52 ^ 0.03) was statistically smaller than the one of non-responding neurons (0.69 ^ 0.05; t-test, P , 0:005).

Single-cell RT-PCR, amplifying the transcript for nAChR subunits a2 –7, b2 –4 and other molecular markers (see below), was performed on 95 of the recorded neurons (Fig. 3a). The more widespread expressed nAChR subunits in the brain, a4, b2 and a7 were also the most often detected in our preparation (60, 49 and 23% of tested neurons, Fig. 3b). However, the a2 subunit which has the most restricted expression in the brain, was the next most expressed subunit in our spinal sample, detected in 19% of tested neurons. The SC is among the few regions where a3 and b4, or a6 and b3, are not co-expressed: the transcript for a3 (a6) was detected in 18% (12%) of tested neurons whereas the transcript for b4 (b3) was detected only in 3% (1%) of

Fig. 3. Distribution and association of nicotinic transcripts among recorded neurons. (a) Agarose gel analysis of the RT-PCR product of a single dorsal horn neuron, expressing a2, a4, a6 and b2 transcripts. (b) Distribution of nicotinic transcripts among tested neurons (the numbers into brackets indicate the number of neurons where each transcript was actually tested for). (c) The first line of pie charts represents the theoretically expected distributions of neurons expressing (E) or not (NE) a3, a2 or b2, among neurons responding (R) or not (NR) to ACh, assuming that the expressing of nicotinic transcript is independent of the response to ACh. The second line of pie charts similarly represents the experimentally observed distributions. For example, among 77 neurons tested for the expression of a3 and the presence of an ACh response, 15 express a3 and 54 respond to ACh; the expected number of neurons expressing a3 and responding to ACh is therefore 15 £ 54/77 ¼ 10.52, expressing a3 but non-responding to ACh is 15 £ (77 2 54)/77 ¼ 4.48, non-expressing a3 and responding to ACh is (77 2 15) £ 54/77 ¼ 43.48 and non-expressing a3 and non-responding to ACh is (77 2 15) £ (77 2 54)/77 ¼ 18.52. This expected distribution is statistically different from the one experimentally observed (14, 1, 40, 22, respectively). (d) Observed associations between nicotinic transcripts. The colored squares represent a statistical association between two transcripts according to the x 2 test.

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

tested neurons (Fig. 3b). The last two transcripts were too infrequently detected for further statistical analysis. nAChR transcripts expression did not appear to be linked to the location of neurons within the dorsal horn (result not shown). Only the a3 subunit had a tendency to be preferentially expressed in deeper neurons (t-test, P ¼ 0:09; wilcox-test, P ¼ 0:05). We tested the kinetic properties of nicotinic currents in relation to the expression of mRNAs for nAChR. Neurons ðn ¼ 14Þ responding to ACh and expressing a7 had a faster inactivating current than those not expressing a7 (4.8 ^ 1.6 vs. 10.6 ^ 1.4% residual current after 1.8 s, t-test, P ¼ 0:03), while those ðn ¼ 11Þ expressing a2 tended to have larger residual current than those not expressing a2 (13.0 ^ 1.9% vs. 9.3 ^ 1.6%, wilcox-test, P ¼ 0:05). From the expression probability of each nicotinic transcript, and the mean probability of response to ACh (73%), it is possible to derive a theoretically expected distribution of neurons expressing, or not, a specific transcript and responding, or not, to ACh (assuming that these parameters are independent, see Section 2 and Fig. 3 legend). We compared this theoretically expected distribution with the experimentally observed one (Fig. 3c): the transcripts for a2, a3 and b2 were more frequent than expected in ACh responding neurons (x 2 ¼ 3:98; 4.79 and 4.19, respectively, P , 0:05). There was a similar trend for the transcript for a4 (x 2 ¼ 3:61; P , 0:06). The other transcripts were equally distributed among ACh responding and non-responding neurons. This result is consistent with the fact that presynaptic responses to nicotine, that implicate nAChR subunits addressed to the axon, have been observed in the SC (Fucile et al., 2002; Genzen and McGehee, 2003; Kiyosawa et al., 2001; Marubio et al., 1999; Takeda et al., 2003). The following analysis has been done regardless of the presence or absence of a somatic nicotinic response, unless otherwise specified. We similarly tested the statistical association between pairs of nAChR subunits. Fig. 3d represents the preferential associations observed: a2 with a6 (x 2 ¼ 4:60; P , 0:05), a4 with a5 (x 2 ¼ 6:02; P , 0:05) and b2 (x 2 ¼ 5:12;

313

P , 0:05), and a3 with a7 (x 2 ¼ 10:97; P , 1023 ) and b2 (x 2 ¼ 4:05; P , 0:05). 3.3. Molecular markers define functional classes of neurons The RT-PCR performed on each recorded neuron was designed to amplify, besides the nine nicotinic transcripts, eight molecular markers (Fig. 4a). They were the synthesizing enzymes glutamic acid decarboxylase (GAD65 and GAD67) and choline acetyl transferase (ChAT), the glycine transporter (GlyT2), the calcium binding proteins parvalbumin (PV) and calbindin (CA), the neuropeptide Y (NPY), and finally the substance P-receptor (NK1-R). Most of these markers were uniformly distributed along a dorso-ventral axis in the dorsal horn, and were not associated with a statistically higher (or lower) probability to display a nicotinic somatic response. Only GlyT2 was preferentially expressed in deeper neurons (t-test, P , 0:02) and was more frequent than theoretically expected among ACh responding neurons (x 2 ¼ 5:20; P , 0:05). Whereas NK1-R and CA were not preferentially associated together or with any of the non-nicotinic markers, clear combinations were observed among the remaining six markers (Fig. 4c). The transcripts for GAD65 and GAD67 were expressed in 33 and 32% of tested neurons (Fig. 4b), and were strongly associated ( x 2 ¼ 22:39; P , 2 £ 1026 ; Fig. 4c). Both were also linked to GlyT2 (x 2 ¼ 9:40; P , 0; 005 and x 2 ¼ 18:75; P , 2 £ 1025 ; respectively). GAD65 was also found co-expressed with ChAT (x 2 ¼ 6:39; P , 0:05) and GAD67 with PV (x 2 ¼ 6:02; P , 0:05). Finally there was a trend (3 , x 2 , 4; P , 0:10) for ChAT to combine with GlyT2, PV or NPY. GAD65, GAD67, GlyT2, together with ChAT, PV and NPY were therefore generally co-expressed (Fig. 4c) defining an inhibitory neuronal population. 3.4. nAChR types on distinct neuronal populations a4a6b2* nAChRs were preferentially expressed in the inhibitory cell population (Fig. 4c). The transcript for a4

Fig. 4. Distribution and association of molecular and nicotinic transcripts among recorded neurons. (a) Agarose gel analysis of the RT-PCR product of a single dorsal horn neuron, expressing GAD65, GAD67, NPY and PV transcripts. (b) Distribution of molecular transcripts among tested neurons (the numbers into brackets indicate the number of neurons where each transcript was actually tested for). (c) Observed associations between molecular and nicotinic transcripts. The colored squares represent an association between two transcripts according to the x 2 test; the X represents a trend towards exclusion between PV and a3 transcripts.

314

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

was associated with GAD67 (x 2 ¼ 14:75; P , 2 £ 1024 ), GAD65, GlyT, ChAT and PV (x 2 ¼ 5:03; 5.51, 5.19 and 4.72, respectively, P , 0:05); the transcript for a6 was associated with GAD65 and GAD67 (x 2 ¼ 5:81 and 4.35, P , 0:05) as was the one for b2 (x 2 ¼ 5:28 and 4.38, P , 0:05). NPY was found together with a5 (x 2 ¼ 5:90; P , 0:05) and also had a tendency to be co-expressed with a4 (x 2 ¼ 3:28; P , 0:10). Similarly, the transcript for a2 tended to be associated with GAD67 (x 2 ¼ 3:13; P , 0:10), and the one for a3 to be in opposition with PV (x 2 ¼ 3:10; P , 0:10). GAD65 expressing neurons, as well as NPY expressing ones, showed ACh currents with a shorter rise time (68.0 ^ 12.1 and 62.4 ^ 13.6 ms, respectively) than the one observed in non-GAD65, or non-NPY, expressing neurons (117.3 ^ 14.4 ms, t-test, P ¼ 0:02; 120.1 ^ 13.9 ms, t-test, P ¼ 0:01; respectively). NK1-R and CA expressing neurons, which form an excitatory population (see Section 4), preferentially expressed a distinct nAChR type (Fig. 4c). Both NK1-R and CA were associated with a3 (x 2 ¼ 5:63 and 3.99, P , 0:05), CA was also strongly associated with a7

(x 2 ¼ 17:50; P , 3 £ 1024 ) and NK1-R with b2 (x 2 ¼ 7:11; P , 0:01). 3.5. Intrinsic membrane properties are not related to functional neuronal classes The firing patterns and membrane properties of 118 neurons, of which 93 were analyzed by RT-PCR, were studied in detail. Neurons could be divided into four classes according to their firing pattern (Fig. 5a). Class A neurons ðn ¼ 47Þ were characterized by a regular firing and no spike amplitude attenuation at all injected currents (from 10 to 120 pA). Class B neurons ðn ¼ 21Þ also presented a regular firing, but the spike amplitude was markedly attenuated at the end of strong depolarizing steps (therefore preventing the detection of spikes at the end of the step). Class C neurons ðn ¼ 27Þ had an irregular firing pattern, while class D neurons ðn ¼ 23Þ responded by one or few spikes at the very beginning of the current step. The firing behavior (number of spikes in response to 30, 60, 90 and 120 pA steps, Fig. 5b) differed statistically between classes

Fig. 5. Definition of neuronal populations according to their membrane properties. (a) Representative voltage traces in response to hyperpolarizing current steps (þ 120 pA on the first line, þ30 pA on the second) from neurons of the four classes. (b) Curves representing the mean number of spike as a function of the current step amplitude (30–120 pA, 700 ms) for each neuron class. (c) Mean coefficient of variation of the interspike interval for each neuron class; this value cannot be measured for class D neurons that respond with a single spike. *P , 0:05:

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

315

Table 2 Membrane properties of recorded neurons according to their firing class

N Spike threshold (mV) Spike width (ms) Rin (GV) t (ms) % IH -like sag

A

B

C

D

t-test

47 243.00 ^ 0.74 2.54 ^ 0.72 0.71 ^ 0.04 43.90 ^ 3.21 18.82 ^ 1.78

21 242.36 ^ 1.08 2.96 ^ 0.11 1.17 ^ 0.17 56.64 ^ 7.84 13.60 ^ 2.33

27 240.79 ^ 0.95 2.64 ^ 0.15 0.60 ^ 0.10 30.72 ^ 4.79 14.72 ^ 2.62

23 242.98 ^ 1.35 4.03 ^ 0.26 0.80 ^ 0.17 31.77 ^ 6.39 9.56 ^ 1.76

**A,B A,D B,D C,D **A,B B,C **B,C *B,D A,C **A,D

The indicated values are mean ^ SEM from n neurons (n indicated in the second line). The measures are described in Section 2; Rin ; input resistance, t; membrane time constant. The last column shows the classes that differ for each parameter according to a Student’s test: *P , 0:05; **P , 0:01:

(ANOVA, P , 0:0001). The CV, that represents the ISI variation related to the spike frequency (see Section 2), was also statistically different for classes A, B, and C (P , 0:05; Fig. 5c, not measured for class D). Other physiological parameters differed between these classes of neurons (Table 2). The first spike of Class D neurons was statistically larger than the one of the three other classes ðP , 0:01Þ: These cells also had a rather small time constant and a smaller IH -like sag (see statistics in Table 2). The input resistance and membrane time constant of class B neurons were the highest, and class A neurons exhibited the largest IH -like sag (see statistics in Table 2). None of the four classes of neurons defined according to membrane properties were associated with any of the above molecular and nicotinic markers (result not shown). There also was no link between the markers and individual physiological parameters. However, there was an inverse relationship between the spike width and the number of spikes (especially in response to the 120 pA step): the slope of the linear regression was statistically different from zero (t ¼ 6:98; P , 0:001).

4. Discussion We investigated the targets of nicotinic agonists in the dorsal horn of the SC, taking into account the possible physiological function of recorded neurons, as well as the diversity of nAChRs. We distinguished inhibitory and excitatory neurons, expressing different types of nAChRs. 4.1. Somato-dendritic nicotinic response On spinal slices from neonate mice, ACh elicited a somatic current in 73% of dorsal horn neurons, deep neurons responding more often than superficial ones. This is consistent with previous work on neonatal/young rats showing that 84% of deep neurons (Urban et al., 1989) and 33% of SG neurons (Kiyosawa et al., 2001) respond to nicotine. In order to move towards the understanding of global actions of nicotine on the dorsal SC network, we performed single-cell RT-PCR designed to specifically amplify molecular markers giving the functional identity

of neurons, as well as nAChR transcripts giving information on the types of nAChRs potentially assembled. 4.2. nAChRs expression by single neurons In situ hybridization, performed on the superficial layers of adult rat SC, detected the presence of a3, a4, a5, a7 and b2; a2 and b4 were not detected, and a6 and b3 not studied (Wada et al., 1989). However, the expression of nicotinic mRNA evolves during development (Keiger et al., 2003; Zoli et al., 1995), and our approach interested the whole dorsal horn in mice. In these conditions, all subunits were detected at least once and the prevalence order was the following: a4, b2 . a7, a2, a3 . a5, a6 . b4, b3. As in the brain, a4, b2 and a7 are the most expressed subunits; however, we also detected a2 in 19% of the neurons. This result is of interest since in situ hybridization (Wada et al., 1989) as well as single-cell RT-PCR (Christophe et al., 2002; Klink et al., 2001; Porter et al., 1999; Sudweeks and Yakel, 2000) studies suggest that the a2 mRNA is expressed in extremely few regions in the rat brain. Potentially, molecules targeting a2* nAChRs could activate spinal neurons (mostly inhibitory interneurons) with few supra-spinal effects. It should be noted that the a2 mRNA was also detected by RT-PCR in embryonic and adult human SC (Keiger et al., 2003). When studied in oocytes, a2b2 is the combination of rat nicotinic subunits on which the potent analgesic epibatidine elicits the larger current (normalized to the ACh response), although with a relatively high EC50 (290 nM; Papke et al., 1997). Our results suggest that both the affinity and the efficacy of epibatidine for various a2* nAChRs deserves a careful evaluation in order to understand their implication in the in vivo effects of epibatidine. Consistent with the in situ hybridization data (DineleyMiller and Patrick, 1992), we detected few b4 transcripts. The transcript for a3 was detected in 18% of neurons, suggesting that in the SC, as in certain regions of the isocortex, hippocampus or thalamus, it is not co-expressed with b4. However, a3 was associated to a7 and b2. On the other hand, the transcript for a6 was detected in 12% of neurons, whereas the one for b3 was detected only once. Therefore, the a6 subunit is also expressed out of

316

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

catecholaminergic nuclei, but in this case (like in the IPN) is not co-expressed with b3 (Changeux et al., 1996). However, it was strongly associated with the a2 transcript. Finally, consistent with the fact that most a5 expressing nuclei in the brain also express a4 (Wada et al., 1990), we co-detected these subunits in our spinal sample. We therefore found preferential combinations of nicotinic subunits: a4&a5(b2), a2&a6, and a7&a3(b2). We thus analyzed the distribution of these combinations among different functional classes of neurons defined according to molecular markers. 4.3. nAChRs expressed by inhibitory neurons The two GAD isoforms were strongly associated, defining unambiguously the GABAergic population. They were associated with GlyT2, a selective marker for glycinergic neurons (Todd, 1996), which form a subpopulation of inhibitory cells (Todd and Sullivan, 1990). Cholinergic neurons, defined by the expression of ChAT, were linked to this population as suggested by immunocytochemistry (Todd and Sullivan, 1990). Although the experiments by Todd et al. suggested that cholinergic and glycinergic neurons might form two exclusive sub-populations, this was not the case in our sample; this may result from species differences (mouse vs. rat), developmental stage (2nd week vs. adult) or location (whole dorsal horn vs. superficial) of the neurons under study. NPY expressing neurons, according to immunocytochemical data, also form a subpopulation of GABAergic neurons in the adult rat (Rowan et al., 1993), but were only weakly associated to them in our sample. Because NPY transcripts do not show their adult distribution pattern until after the early postnatal period (Marti et al., 1992), it is possible that the population detected in our sample differs from the one analyzed in adults. Finally, consistent with immunocytochemical studies (Antal et al., 1991), the expression of PV was associated with the inhibitory population. a4a6b2* nAChRs were strongly associated with this inhibitory population (Fig. 4). This is consistent with the previous pharmacological characterization of presynaptic effects of nicotinic agonists on glycinergic transmission in the SC, that suggested the implication of a4b2* nAChRs (Kiyosawa et al., 2001). Moreover, functional a4a6b2* nAChRs have recently been demonstrated on dopaminergic neurons of the basal ganglia (Champtiaux et al., 2003; Klink et al., 2001). These receptors do not contain b3 (see above), but may also contain (i) a2 as it preferentially linked to GAD67 and a6, and (ii) a5 as it is associated with NPY and a4. 4.4. nAChRs expressed by excitatory neurons CA and NK1-R transcripts are markers of excitatory neurons (Antal et al., 1991; Littlewood et al., 1995); moreover, they are expressed in most supra-spinally

projecting neurons (Menetrey et al., 1992; Todd, 2002; Todd et al., 2000), and NK1-R expressing neurons receive a monosynaptic input from primary afferents (Todd et al., 2002), and have been shown (in lamina I) to be essential components of nociceptive transmission (Mantyh et al., 1997). The CA or NK1-R expressing neurons detected in our study are therefore most probably excitatory interneurons or projection neurons. Neurons expressing CA in our sample are less numerous (compared to those expressing GAD or PV) than in Antal et al. study using adults rats; this difference could be due to a species or developmental stage issue. Both CA and NK1-R were associated with the a3 transcript; CA was also strongly associated with a7, and NK1-R with b2. As a3, a7 and b2 are preferentially expressed in the same neurons, these results suggest that excitatory neurons express a3b2a7* nAChRs. a7 and b2 have been shown to form functional heteromers in vitro (Khiroug et al., 2002). We cannot determine from these data whether there is a single (a3b2a7*) or two (a3b2* and a7*) types of nAChRs expressed in these neurons. 4.5. Intrinsic membrane properties We classified neurons according to their firing pattern in response to incremental current steps as in previous studies on the dorsal SC (Hochman et al., 1997; Jo et al., 1998; Lopez-Garcia and King, 1994; Prescott and De Koninck, 2002; Thomson et al., 1989). The proportion of neurons among these classes, as well as their properties, resembles previously observations, especially those involving young rats (Lopez-Garcia and King, 1994). One study on cultured neurons has suggested that firing classes were not linked to GAD immunoreactivity (Jo et al., 1998). Our technical approach had the advantage of allowing the analysis of 17 molecular markers for each recorded neuron. However, none of these classes could be related to the inhibitory or excitatory markers detected by single-cell RT-PCR, or to the expression of nicotinic transcripts. This result strongly suggests that, in young animals, firing patterns and classically measured membrane properties are not reliable markers of the function of the recorded neuron within the spinal dorsal horn network. 4.6. Physiological implications The vast majority of projecting neurons have been shown to be excitatory (Kechagias and Broman, 1995, but see Gamboa-Esteves et al., 2001), thus the inhibitory neurons we recorded are most probably interneurons. Previous data suggested the existence of functional nAChRs on inhibitory interneurons in the SC (Cordero-Erausquin and Changeux, 2001; Kiyosawa et al., 2001; Rashid and Ueda, 2002; Takeda et al., 2003) and our physiological and molecular evidence supports these observations. We also show that the a2 subunit contributes to these nAChRs, suggesting that

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

agonists targeting a2* nAChRs might prove to be analgesics with minor secondary effects. We also show for the first time to our knowledge that nicotinic agonists can directly activate excitatory neurons. Moreover, the nAChR subunits expressed by these neurons (a3, b2 and a7) differ from those expressed by inhibitory neurons (except for b2). Studies to determine how these excitatory neurons contribute to the analgesic vs. algogenic effects of nicotine as well as secondary effects will depend on agonists differentially activating these distinct nAChRs. In addition, during the analgesic use of nicotinic drugs, nAChRs are exposed to agonists for long periods that may result in their desensitization. Potentially, the two nAChR types under study might have different sensitivities to desensitization, leading to a differential activation of inhibitory and excitatory neurons in the long term, as suggested in other regions (Mansvelder et al., 2002). Overall, our evidence that the inhibitory and excitatory populations preferentially express different types of nAChRs, provides a unique tool to evaluate how these two cell types contribute to the spinal effects of nicotine.

Acknowledgements We thank Richard Miles for comments on the manuscript, Anne Devillers-Thierry for technical advices and Bruno Cauli for the donation of starting material. This work was supported by research grants from the Institut Pasteur, Colle`ge de France, Centre national de la Recherche Scientifique, Association pour la Recherche Contre le Cancer and CEE contracts.

References Antal M, Polgar E, Chalmers J, Minson JB, Llewellyn-Smith I, Heizmann CW, Somogyi P. Different populations of parvalbumin- and calbindinD28k-immunoreactive neurons contain GABA and accumulate 3H-D aspartate in the dorsal horn of the rat spinal cord. J Comp Neurol 1991; 314:114–24. Bannon AW, Gunther KL, Decker MW. Is epibatidine really analgesic? Dissociation of the activity, temperature, and analgesic effects of (þ/2)-epibatidine. Pharmacol Biochem Behav 1995;51:693–8. Boyce S, Webb JK, Shepheard SL, Russell MG, Hill RG, Rupniak NM. Analgesic and toxic effects of ABT-594 resemble epibatidine and nicotine in rats. Pain 2000;85:443 –50. Champtiaux N, Gotti C, Cordero-Erausquin M, David DJ, Przybylski C, Lena C, Clementi F, Moretti M, Rossi FM, Le Novere N, McIntosh JM, Gardier AM, Changeux JP. Subunit composition of functional nicotinic receptors in dopaminergic neurons investigated with knock-out mice. J Neurosci 2003;23:7820 –9. Changeux JP, Bessis A, Bourgeois JP, Corringer PJ, Devillers-Thiery A, Eisele JL, Kerszberg M, Lena C, Le Novere N, Picciotto M, Zoli M. Nicotinic receptors and brain plasticity. Cold Spring Harbor Symp Quant Biol 1996;61:343– 62. Christophe E, Roebuck A, Staiger JF, Lavery DJ, Charpak S, Audinat E. Two types of nicotinic receptors mediate an excitation of neocortical layer I interneurons. J Neurophysiol 2002;88:1318–27.

317

Cordero-Erausquin M, Changeux JP. Tonic nicotinic modulation of serotoninergic transmission in the spinal cord. Proc Natl Acad Sci USA 2001;98:2803–7. Corringer PJ, Le Novere N, Changeux JP. Nicotinic receptors at the amino acid level. Annu Rev Pharmacol Toxicol 2000;40:431 –58. Damaj MI, Fei-Yin M, Dukat M, Glassco W, Glennon RA, Martin BR. Antinociceptive responses to nicotinic acetylcholine receptor ligands after systemic and intrathecal administration in mice. J Pharmacol Exp Ther 1998;284:1058–65. Davis L, Pollock LJ, Stone TT. Visceral pain. Surg Gynecol Obstet 1932; 55:418–27. Decker MW, Bannon AW, Buckley MJ, Kim DJ, Holladay MW, Ryther KB, Lin NH, Wasicak JT, Williams M, Arneric SP. Antinociceptive effects of the novel neuronal nicotinic acetylcholine receptor agonist, ABT-594, in mice. Eur J Pharmacol 1998;346:23–33. Dineley-Miller K, Patrick J. Gene transcripts for the nicotinic acetylcholine receptor subunit, beta4, are distributed in multiple areas of the rat central nervous system. Brain Res Mol Brain Res 1992;16:339–44. Flores CM. The promise and pitfalls of a nicotinic cholinergic approach to pain management. Pain 2000;88:1–6. Fucile S, Lax P, Eusebi F. Nicotine modulates the spontaneous synaptic activity in cultured embryonic rat spinal cord interneurons. J Neurosci Res 2002;67:329–36. Gamboa-Esteves FO, Kaye JC, McWilliam PN, Lima D, Batten TF. Immunohistochemical profiles of spinal lamina I neurones retrogradely labelled from the nucleus tractus solitarii in rat suggest excitatory projections. Neuroscience 2001;104:523– 38. Genzen JR, McGehee DS. Short and long-term enhancement of excitatory transmision in the spinal cord dorsal horn by nicotinic acetylcholine receptors. Proc Natl Acad Sci USA 2003;100(11):6807–12. Hochman S, Garraway SM, Pockett S. Membrane properties of deep dorsal horn neurons from neonatal rat spinal cord in vitro. Brain Res 1997;767: 214– 9. Jo YH, Stoeckel ME, Schlichter R. Electrophysiological properties of cultured neonatal rat dorsal horn neurons containing GABA and metenkephalin-like immunoreactivity. J Neurophysiol 1998;79:1583–6. Kechagias S, Broman J. Immunocytochemical evidence for vesicular storage of glutamate in cat spinocervical and cervicothalamic tract terminals. Brain Res 1995;675:316– 20. Keiger CJ, Prevette D, Conroy WG, Oppenheim RW. Developmental expression of nicotinic receptors in the chick and human spinal cord. J Comp Neurol 2003;455:86– 99. Khiroug SS, Harkness PC, Lamb PW, Sudweeks SN, Khiroug L, Millar NS, Yakel JL. Rat nicotinic ACh receptor alpha7 and beta2 subunits coassemble to form functional heteromeric nicotinic receptor channels. J Physiol 2002;540:425–34. Kiyosawa A, Katsurabayashi S, Akaike N, Pang ZP. Nicotine facilitates glycine release in the rat spinal dorsal horn. J Physiol 2001;536: 101– 10. Klink R, de Kerchove d’Exaerde A, Zoli M, Changeux JP. Molecular and physiological diversity of nicotinic acetylcholine receptors in the midbrain dopaminergic nuclei. J Neurosci 2001;21:1452–63. Lambolez B, Audinat E, Bochet P, Crepel F, Rossier J. AMPA receptor subunits expressed by single Purkinje cells. Neuron 1992;9:247–58. Le´na C, d’Exaerde AD, Cordero-Erausquin M, Le Nove`re N, ArroyoJimenez MD, Changeux JP. Diversity and distribution of nicotonic acetylcholine receptors in the locus ceruleus neurons. Proc Natl Acad Sci USA 1999;96:12126–31. Littlewood NK, Todd AJ, Spike RC, Watt C, Shehab SA. The types of neuron in spinal dorsal horn which possess neurokinin-1 receptors. Neuroscience 1995;66:597–608. Lopez-Garcia JA, King AE. Membrane properties of physiologically classified rat dorsal horn neurons in vitro: correlation with cutaneous sensory afferent input. Eur J Neurosci 1994;6:998–1007. Mansvelder HD, Keath JR, McGehee DS. Synaptic mechanisms underlie nicotine-induced excitability of brain reward areas. Neuron 2002;33: 905– 19.

318

M. Cordero-Erausquin et al. / Pain 109 (2004) 308–318

Mantyh PW, Rogers SD, Honore P, Allen BJ, Ghilardi JR, Li J, Daughters RS, Lappi DA, Wiley RG, Simone DA. Inhibition of hyperalgesia by ablation of lamina I spinal neurons expressing the substance P receptor. Science 1997;278:275–9. Marti E, Biffo S, Fasolo A. Neuropeptide Y m-RNA and peptide are transiently expressed in the developing rat spinal cord. NeuroReport 1992;3:401–4. Marubio LM, del Mar Arroyo-Jimenez M, Cordero-Erausquin M, Lena C, Le Novere N, de Kerchove d’Exaerde A, Huchet M, Damaj MI, Changeux JP. Reduced antinociception in mice lacking neuronal nicotinic receptor subunits. Nature 1999;398:805– 10. Menetrey D, De Pommery J, Thomasset M, Baimbridge KG. CalbindinD28K (CaBP28k)-like immunoreactivity in ascending projections. Eur J Neurosci 1992;4:70–6. Papke RL, Thinschmidt JS, Moulton BA, Meyer EM, Poirier A. Activation and inhibition of rat neuronal nicotinic receptors by ABT-418. Br J Pharmacol 1997;120:429 –38. Porter JT, Cauli B, Tsuzuki K, Lambolez B, Rossier J, Audinat E. Selective excitation of subtypes of neocortical interneurons by nicotinic receptors. J Neurosci 1999;19:5228 –35. Prescott SA, De Koninck Y. Four cell types with distinctive membrane properties and morphologies in lamina I of the spinal dorsal horn of the adult rat. J Physiol 2002;539:817–36. Rashid MH, Ueda H. Neuropathy-specific analgesic action of intrathecal nicotinic agonists and its spinal GABA-mediated mechanism. Brain Res 2002;953:53–62. Rowan S, Todd AJ, Spike RC. Evidence that neuropeptide Y is present in GABAergic neurons in the superficial dorsal horn of the rat spinal cord. Neuroscience 1993;53:537–45. Sargent PB. The diversity of neuronal nicotinic acetylcholine receptors. Ann Rev Neurosci 1993;16:403–43. Spande TF, Garraffo HM, Edwards MW, Yeh HJC, Pannel L, Daly JW. Epibatidine: a novel (chloropyridyl)azabicycloheptaine with potent analgesic activity from an Ecuadoran poison frog. J Am Chem Soc 1992;114:3475–8. Stuart G, Schiller J, Sakmann B. Action potential initiation and propagation in rat neocortical pyramidal neurons. J Physiol 1997;505(Pt 3):617– 32. Sudweeks SN, Yakel JL. Functional and molecular characterization of neuronal nicotinic ACh receptors in rat CA1 hippocampal neurons. J Physiol 2000;527(Pt 3):515–28.

Takeda D, Nakatsuka T, Papke R, Gu JG. Modulation of inhibitory synaptic activity by a non-alpha4beta2, non-alpha7 subtype of nicotinic receptors in the substantia gelatinosa of adult rat spinal cord. Pain 2003;101:13–23. Thomson AM, West DC, Headley PM. Membrane characteristics and synaptic responsiveness of superficial dorsal horn neurons in a slice preparation of adult rat spinal cord. Eur J Neurosci 1989;1:479– 88. Todd AJ. GABA and glycine in synaptic glomeruli of the rat spinal dorsal horn. Eur J Neurosci 1996;8:2492 –8. Todd AJ. Anatomy of primary afferents and projection neurones in the rat spinal dorsal horn with particular emphasis on substance P and the neurokinin 1 receptor. Exp Physiol 2002;87:245–9. Todd AJ, Sullivan AC. Light microscope study of the coexistence of GABA-like and glycine-like immunoreactivities in the spinal cord of the rat. J Comp Neurol 1990;296:496– 505. Todd AJ, McGill MM, Shehab SA. Neurokinin 1 receptor expression by neurons in laminae I, III and IV of the rat spinal dorsal horn that project to the brainstem. Eur J Neurosci 2000;12:689 –700. Todd AJ, Puskar Z, Spike RC, Hughes C, Watt C, Forrest L. Projection neurons in lamina I of rat spinal cord with the neurokinin 1 receptor are selectively innervated by substance p-containing afferents and respond to noxious stimulation. J Neurosci 2002;22:4103–13. Urban L, Willetts J, Murase K, Randic M. Cholinergic effects on spinal dorsal horn neurons in vitro: an intracellular study. Brain Res 1989;500: 12 –20. Wada E, Wada K, Boulter J, Deneris E, Heinemann S, Patrick J, Swanson LW. Distribution of alpha 2, alpha 3, alpha 4, and beta 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat. J Comp Neurol 1989;284: 314 –35. Wada E, McKinnon D, Heinemann S, Patrick J, Swanson LW. The distribution of mRNA encoded by a new member of the neuronal nicotinic acetylcholine receptor gene family (alpha 5) in the rat central nervous system. Brain Res 1990;526:45– 53. Woodbury CJ, Ritter AM, Koerber HR. On the problem of lamination in the superficial dorsal horn of mammals: a reappraisal of the substantia gelatinosa in postnatal life. J Comp Neurol 2000;417:88– 102. Zoli M, Le Novere N, Hill Jr JA, Changeux JP. Developmental regulation of nicotinic ACh receptor subunit mRNAs in the rat central and peripheral nervous systems. J Neurosci 1995;15:1912 –39.