- Email: [email protected]
Nicotinic acetylcholine receptor subunit mRNA expression and channel function in medial habenula neurons
Neuropharmacology 39 (2000) 2591–2603 www.elsevier.com/locate/neuropharm
Nicotinic acetylcholine receptor subunit mRNA expression and channel function in medial habenula neurons Elise B. Sheffield, Michael W. Quick, Robin A.J. Lester
*
Department of Neurobiology, CIRC room 560, 1719 Sixth Avenue South, University of Alabama at Birmingham, Birmingham, AL 35294-0021, USA Accepted 28 July 2000
Abstract Relationships between nicotinic acetylcholine receptor (nAChR) channel function and nAChR subunit mRNA expression were explored in acutely isolated rat medial habenula (MHb) neurons using a combination of whole-cell recording and single cell RT– PCR techniques. Following amplification using subunit-specific primers, subunits could be categorized in one of three ways: (i) present in 95–100% cells: α3, α4, α5, β2 and β4; (ii) never present: α2; and (iii) sometimes present (⬇40% cells): α6, α7 and β3. These data imply that α2 subunits do not participate in nAChRs on MHb cells, that α6, α7 and β3 subunits are not necessary for functional channels but may contribute in some cells, and that nAChRs may require combinations of all or subsets of α3, α4, α5, β2 and β4 subunits. Little difference in the patterns of subunit expression between nicotine-sensitive and insensitive cells were revealed based on this qualitative analysis, implying that gene transcription per se may be an insufficient determinant of nAChR channel function. Normalization of nAChR subunit levels to the amount of actin mRNA, however, revealed that cells with functional channels were associated with high levels (⬎0.78 relative to actin; 11/12 cells) of all of the category (i) subunits: α3, α4, α5, β2 and β4. Conversely, one or more of these subunits was always low (⬍0.40 relative to actin) in all cells with no detectable response to nicotine. Thus the formation of functional nAChR channels on MHb cells may require critical levels of several subunit mRNAs. 2000 Elsevier Science Ltd. All rights reserved. Keywords: Nicotinic receptor subtypes; Xenopus oocytes; Nicotine addiction; Ion channel; CNS; Single cell RT–PCR
1. Introduction Specification of the subunit composition of multimeric receptor-gated ion channels is one mechanism through which neurons can regulate their function. Inclusion of certain key subunits within one such family of channels, the neuronal nicotinic acetylcholine receptors (nAChRs), likely controls many important aspects of these receptors including their specific synaptic targeting (Williams et al., 1998) and relative Ca2+ permeability (Mulle et al., 1992; Vernino et al., 1992; Seguela et al., 1993). Thus, in order to understand fully the physiological roles of these receptors it will be essential to define their subunit compositions. The large number of potential nAChR subunit combinations, together with an incomplete set of
* Corresponding author. Tel.: +1-205-934-4483; fax: +1-205-9346571. E-mail address: [email protected] (R.A.J. Lester).
pharmacological tools, has so far prevented a definitive assessment of the subunit composition of particular native nAChRs (Role, 1992; Colquhoun and Patrick, 1997a; Jones et al., 1999). However, the discrete expression patterns of individual subunit mRNAs expression in the nervous system imply that the formation of nAChR channels in specific brain regions may be related, at least in part, to the levels of gene transcripts (Boyd, 1997). Despite the abundance of numerous types of nAChR subunit mRNAs in the media habenula (MHb), previous molecular (Duvoisin et al., 1989; Wada et al., 1989), biochemical (Zoli et al., 1998) and electrophysiological (Mulle and Changeux, 1990; Quick et al., 1999) analyses suggest that α3 and β4 subunits likely contribute to the major type of functional channel in this region. This leaves the role of other nAChR subunits (e.g., α4, α5, α6, α7, β3 and β2) expressed in this nucleus uncertain (Deneris et al., 1989; Wada et al., 1989; Boulter et al., 1990; Dineley-Miller and Patrick, 1992; Seguela et al.,
0028-3908/00/$ - see front matter 2000 Elsevier Science Ltd. All rights reserved. PII: S 0 0 2 8 - 3 9 0 8 ( 0 0 ) 0 0 1 3 8 - 6
2592
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
1993; Le Novere et al., 1996). Are these subunits sometimes or always included in receptors along with the minimal functional set of α3 and β4 subunits described above? Do they form receptors that are not functionally detected and perhaps awaiting biochemical activation? Are they used to form additional types of nAChRs targeted to other parts of the cell? Evidence exists for all these possibilities. β2 and α5 subunits can coassemble with α3β4 nAChRs (Wang et al., 1996; Colquhoun and Patrick, 1997b; Fucile et al., 1997) and could add to the functional diversity of nAChR channels on cell bodies (see Brussaard et al., 1994; Connolly et al., 1995). High affinity α4β2-like [3H]-nicotine binding sites are lost from the MHb in β2 knockout mice (Zoli et al., 1998), but have not so far been classified functionally in this region. Finally, α-BTX-sensitive nAChRs exist in the IPN (Clarke et al., 1986), where MHb axons terminate and suggest a potential presynaptic function for α7nAChRs. Single cell RT–PCR studies from other areas of the nervous system have provided strong evidence that functional nAChRs on cell bodies of individual neurons are related to the underlying subunit mRNA expression (Lena et al., 1999; Porter et al., 1999). Thus, in order to assess further the potential diversity in the subunit compositions of nAChRs in the CNS, we have examined how the patterns of subunit mRNA expression in MHb cells reflect their sensitivity to nicotine.
2. Materials and methods 2.1. Isolated medial habenula cells Neurons were isolated from the habenula region of 7–21 day-old rats using methods described previously (Quick et al., 1999). A single rat was anesthetized under halothane and decapitated. Following removal of the brain, both habenula nuclei (with as little surrounding tissue as possible) were microdissected in ice-cold saline. Following a 30 min incubation at 37°C in a PIPES buffered solution containing 60–90 U papain (Worthington Biochemical Corporation, Freehold, NJ), the tissue was washed with fresh PIPES-buffer and triturated in a low glucose DMEM (Gibco BRL, Grand Island, NY) with a fire-polished Pasteur pipette. Dissociated neurons were plated onto sterile glass coverslips coated with 2–4 µg ml⫺1 of poly-D-lysine (Collaborative Biomedical Products, Bedford, MA). The incubation media was supplemented with 1–2% fetal bovine serum (Atlanta Biologicals, Norcross, GA). Neurons were maintained at 37°C for at least 1 h and used up to 8 h following isolation. Unless stated otherwise, chemicals were obtained from Sigma–Aldrich (St. Louis, MO).
2.2. a4b2 cell line Human embryonic kidney (HEK-293) cells that stably express functional rat α4β2 receptors were a generous gift from J. Zhang and J.H. Steinbach (Washington University, St. Louis, MO). These cells were maintained as described previously (Sabey et al., 1999). For electrophysiological recording, cells were plated on glass coverslips coated with poly-L-ornithine. Cells were recorded from 1–2 days after plating. 2.3. Recording and drug-application in isolated cells Whole-cell recordings were obtained from α4β2 HEK cells (Sabey et al., 1999) and presumed MHb neurons (see Quick et al., 1999) using fire-polished, Sylgardcoated glass pipettes (#7052; Garner Glass, Clairmont, CA). Pipettes were filled with a filtered and autoclaved sterile internal solution containing (in mM): NaCl, 140; HEPES, 10; EGTA, 10; pH 7.4). Pipettes had resistances of 2–5 M⍀. Control and drug-containing solutions were gravity fed into a linear array of glass barrels (Garner Glass) positioned close (⬍100 µm) to the neuron. The barrels were attached to a piezo-electric bimorph (Piezo Systems, Cambridge, MA) connected to a variable 0– 120 V DC-power source under computer control. Complete exchange of solutions occurred in ⬇50 ms (Lester and Dani, 1995). Perfusion medium contained (in mM): NaCl, 150; HEPES, 10; CaCl2, 2; pH 7.4. Currents induced by nicotinic agonists were recorded using an Axopatch 1-D amplifier (Axon Instruments, Foster City, CA), low-pass filtered at 500 Hz, digitized at 1 kHz and captured on an 80486-based computer using Axobasic software (Axon Instruments). Nicotine was used in the form of the tartrate salt (Sigma–Aldrich). To preserve nAChR subunit mRNAs the durations of whole-cell recordings were restricted to under 10 min (see Poth et al., 1997). 2.4. Injection of nAChR subunit mRNAs into xenopus oocytes Procedures for preparation of oocytes have been described in detail elsewhere (Quick and Lester, 1994). Briefly, oocytes were defolliculated and maintained at 18°C in incubation medium containing ND96 (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM HEPES, pH 7.4), 1.8 or 3.6 mM CaCl2, 50 µg/ml gentamicin, and 5% horse serum. Subunit cRNAs were synthesized in vitro (Message Machine; Ambion Inc., Austin, TX) from linearized plasmid templates of rat cDNA clones. Oocytes were injected with 5–25 ng/subunit/oocyte. Extraction of cell contents for RT–PCR was achieved by homogenization in buffer containing 50 mM Tris-Cl, 1 mM EDTA, 200 µM PMSF, 10 µg ml⫺1 aprotinin, and 10 µg/ml leupeptin.
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
2.5. Single-cell RT–PCR Following collection of electrophysiological data, gentle suction was applied to the recording pipette and the cell contents were transferred into the pipette tip. The pipette was removed from the head-stage holder and its contents (⬇10 µl) expelled into clean autoclaved 0.5 ml Ependorf tubes. On occasion either the whole cell was sucked into the pipette or would become so firmly attached that it would be transferred in its entirety. Negative cell-free controls were obtained by aspirating the extracellular solution close to cells into identically handled pipettes. The tubes were color-coded and immediately placed on ice and stored at ⫺80°C for periods up to 10 days. The methods employed for determination of nAChR subunit mRNA in single neurons has been described previously (Poth et al., 1997). In brief, isolated neuronal cytoplasm and pipette solution (approx. 6 µl) was reverse transcribed in a 20 µl reaction (1 h at 37°C) containing 1 mM each dNTP, 100 pmol 18-mer poly(T), 20 U RNAse inhibitor, and 40 U AMV reverse transcriptase. Following transcription, the sample was divided into a number of individual aliquots in preparation for the individual PCR reactions. The PCR was performed using non-degenerate primer pairs that were designed to be unique for a single type of nAChR subunit mRNA. The sequences of these subunit-specific primers are shown in Table 1. All primers were chosen such that the annealed products cross at least one intron/exon boundary and rule out the possibility of amplification of genomic DNA. PCR reactions (50 µl) contained aliquots of the RT product, 1 mM dNTPs, 2.5 mM MgCl2, 10 pmol of each forward and reverse primer, and 5 U Taq polymerase. The PCR cycling parameters were: 5 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 2 min followed by 35 cycles of 94°C for 1 min, 65°C for 1 min, and 72°C for 2 min. The reaction products were then spun through CentriSep columns to remove excess primers and subjected to re-amplification using 35 cycles of 94°C for 1
min, 65°C for 1 min, and 72°C for 2 min. Final reaction products were purified by phenol/chloroform extraction. In initial experiments, two sets of degenerate primers were used as described previously (Poth et al., 1997). One set of primers was designed to anneal to α2, α3, and α4 cDNAs; a second set of primers was constructed to anneal to β2 and β4 cDNAs. Following RT–PCR, the degenerate PCR products were subjected to restriction digests using subunit-specific endonucleases (see Poth et al., 1997) that produced unique digestion fragments. In our preliminary experiments on MHb neurons we were only able to detect α4 and β2 subunit product (data not shown) using the degenerate primers. Where tested using samples derived from Xenopus oocytes (α2, α3, α4, β2 and β4 subunits), the non-degenerate primer pairs were shown to selectively amplify appropriate subunits (Fig. 1(A)). Therefore, all subsequent experiments described in the Results section were performed using these subunit-specific primers. In all cases, final products were analyzed on 2% agarose gels. Gels were scanned into Adobe PhotoShop (Adobe Systems Company, Tokyo, Japan) and the contrast adjusted to enhance visualization of product bands. In qualitative experiments, product was judged to be present on a purely visual basis. In order to quantify the amount of product, the optical density of the band was estimated as the product of the number of pixels occupied by the band and the average pixel density. In all these quantitative comparisons the optical density of a band was expressed relative to the optical density of the actin product band in the same lane under the same contrast conditions. The experimenter performing the RT– PCR reactions was completely unaware of cell-type or whether the particular sample was from a cell that responded or not to nicotine. 2.6. RT-PCR controls In order to be sure that the appearance of a product correctly reflects the expression of an mRNA species in
Table 1 Primer sequences
alpha2 alpha3 alpha4 alpha5 alpha6 alpha7 beta2 beta3 beta4 ChAT Actin
2593
Acc #
Sense (5⬘–3⬘)
Antisense (5⬘–3⬘)
M20295 L31621 L31620 J05231 L08227 L31619 L31622 J04636 U42976 L02952 L08165
GATCTGGATCCCAGACATTG GGAGAAGTGACTTGGATCC CCTCTACAACAATGCGG CGAATGTCTGGCTGAAGC GCTTCATCCGGCCAGTGG GGAGTGAAGAATGTTCG GCTGACGGCATGTACGAAG GCTGAACACGAAGACGC GGTTGCCTGACATCGTGTTG GCCACTTGCATAGGTGAGGGC ATCTTTCTTGGGTATGGA
CGCCGATGAGTGGGATGACC CAAGTGGGCATGGGTGTG CCGATGAGCGGGATGTCC CACCATAATGGATAGGG GCAAAGAGTCACTTTCTCG GCAAGAATACCAGCAGAGC GGAGGTGGGAGGCACAATC GCAAAGACAGTCACC GCCAATGAGCGGTATGTC GCCACTAGTCAGTTGGGC ACATCTGCTGGAAGGTGG
2594
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 1. Subunit-specific primer verification and detection of appropriate subunits in a stable cell line. (A) Agarose gels each representing cDNA fragments amplified from the cytoplasmic contents of a Xenopus oocyte injected with the single subunit mRNA indicated underneath, and probed with each of five subunit-specific primer pairs (Table 1). (B) Examples of currents in response to nicotine (right traces) in three different α4β2 nAChR expressing HEK cells and their corresponding patterns of nAChR subunit mRNA expression (left). In addition to testing each of nine fractions for the nine subunit mRNAs, the agarose gels show consistent bands in each lane confirming the presence of actin mRNA. (C) A gel probed for all nAChR subunit and actin mRNAs taken from an aspirated “cell-free” recording.
the cell, the incidence of both false-positives and falsenegatives must be known. To address the accuracy of our mRNA detection, we used a control cell line stably expressing functional α4β2 receptors (Sabey et al., 1999), in which we could replicate the exact conditions used for patch-clamp recording and RT-PCR reactions from MHb cells. Figure 1(B) shows currents in response to 100 µM applications of nicotine in α4β2 subunitexpressing cells and their respective nAChR subunit expression patterns. As predicted, only α4 and β2 subunit mRNAs were detected (3/3 cells), although for
unknown reasons only 2/3 cells responded to nicotine. In addition, we could successfully RT–PCR a region of actin mRNA in all 27 samples from the same cells (Fig. 1(B)). Thus, for this limited data set the accuracy of mRNA detection was 100%. If the α4, β2 and actin amplification are representative of nAChR subunits in general, then we can put a conservative limit on detection failure. Given that the detection process worked in 33/33 cases but that it could fail the next time, the probability that we will successfully detect a product when it is present is ⱖ33/34 (or ⬎0.97). We note that there
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
was a complete failure to detect product for both actin and nAChR subunits in 5/53 total experiments on MHb cells. We believe that these cases arose because of incomplete transfer of the pipette contents to the storage tube. (In this respect, we note that in one of these cases the pipette tip was clearly broken during the transfer.) Conversely, to ensure against the detection of falsepositives as a result of contamination during the recording/RT–PCR procedure, solution was aspirated into a pipette from the vicinity of cells and tested for all nAChR subunits, actin and choline acetyltransferase (ChAT) mRNAs. Figure 1(C) and Fig. 5(C) show that no products were detected in 57/57 cases from these control experiments (n=3 cells). Moreover, we did not obtain products in whole-cell experiments from α4β2 cells for the seven nAChR subunits (α2, α3, α5, α6, α7, β3, β4), expected to be absent in 21/21 cases (Fig. 1(B)). Thus, we never observed a product in cases where it should have been absent and therefore the overall probability of false-positive detection is ⱕ1/79 (or ⬍0.02). These data imply that the procedures are both sensitive and accurate enough to be reasonably confident that the patterns of nAChR subunits in individual MHb cells are real. 2.7. Immunohistochemistry in brain slices Rat brains were removed as described above, and a block of tissue containing the habenula was placed into an ice-cold control artificial cerebrospinal fluid (ACSF) containing (in mM) NaCl, 155; NaHCO3, 26; KCl, 2; MgSO4, 2; KH2PO4 1.25; CaCl2, 2; glucose, 10, and bubbled with 95% CO2/5% O2. The tissue was glued adjacent to an agar-supportive block on the slicing platform of an Oxford Vibratome sectioning system (Ted Pella, Redding, CA), immersed with sucrose-substituted ACSF (250 mM sucrose in place of NaCl), and 200 µm thick brain slices were prepared. Usually between 4 and 6 slices containing the MHb could be obtained. For immunostaining, slices of MHb tissue were fixed for 3 h between 2 coverslips in a 0.1 M Na-phosphate buffer (PBS) containing 2% paraformaldehyde at 4°C. After 3×15 min rinses in PBS, slices were stored overnight in PBS containing 25% sucrose. Slices were rinsed for 30 min in PBS, permeablized with 0.5% triton-X in PBS for 1–2 h. Tissue was blocked with 1% goat serum (Amersham, Buckinghamshire, England). The primary antibody directed at choline acetyl transferase (ChAT; Mab305; Chemicon International Inc., Temecula, CA) was applied to slices at a dilution of 1:200 in PBS containing 0.5% triton-X and 1% goat serum for an initial period at room temperature (⬇2 h) and then overnight at 4°C. Slices were washed briefly with PBS and incubated with a secondary fluorescein-conjugated goat antimouse IgG (Pierce, Rockford, IL) for 1.5 h. During all the above steps slices were continuously agitated on an orbital shaker to ensure antibody penetration. Slices
2595
received 3×15 min final washes in PBS and are mounted on slides and left overnight at 4°C. Staining was visualized with a Leica microscope equipped with fluorescence. Controls were performed in the absence of the primary antibody. Data are shown as the mean±SEM. Statistical significance was calculated using Student’s t-tests.
3. Results 3.1. Nicotine-sensitive and insensitive cells express a similar complement of nAChR subunit mRNAs Comprehensive in situ analyses of nAChR subunit mRNAs indicate that at least eight individual messages [α3, α4, β2 (Wada et al., 1989), α5, α6 (Le Novere et al., 1996), α7 (Seguela et al., 1993), β3 (Duvoisin et al., 1989) and β4 (Deneris et al., 1989)] are expressed in rat MHb. To test whether the expression of these subunits is uniform amongst MHb neurons that have functional nAChR channels, we performed single cell RT–PCR using an extensive range of primer sets. For completeness α2 mRNA was also probed, although primers for α9 mRNA were not included because of the known highly restricted distribution of this subunit (Elgoyhen et al., 1994). In total, we examined the expression pattern of mRNAs for five subunits (α2–α4, β2 and β3) in 12 cells and nine subunits (α2–α7; β2–β4) in a further 13 cells. A representative example of the current induced by nicotine (30 µM) and the PCR products are shown for one of the MHb cells (Fig. 2(A), (B), left). For comparison, the mRNA subunit expression pattern is shown for a non-responsive cell (Fig. 2(A), (B), right). The PCR data from all cells were then pooled and in general show that nAChR subunit expression was similar irrespective of whether cells responded (17/25) or not (8/25) to nicotine (Fig. 2(C)). Assuming that our procedure was sensitive enough to detect all subunits (see discussion), the potential contributions that individual nAChRs subunits make to functional nicotinic responses can be gauged from the fraction of cells in which they were visibly present. Considering for now only the cells with functional nAChRs, Fig. 2(C) shows that four subunits (α3, α5, β2 and β4) were present in all these cells, α4 was present in 16/17 cells and the other three subunits (α6, α7 and β3) were present in fewer than 40% of the same cells. These data are consistent with the hypothesis that α3, α5, β2, β4 and possibly α4 subunits may be required for functional nAChRs in MHb neurons, whereas α6, α7 and β3 subunits are not absolute requirements for function but may participate in channels on some cells. However, in order to reconcile specific subunits with functional nAChRs, we need to account for the high occurrence of mRNAs in cells that do not respond to nicotine (Fig. 2(C)).
2596
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 2. Qualitative single cell subunit mRNA analysis in MHb neurons. (A) A single agarose gel indicating the presence or absence of cDNA fragments for various α and β nAChR subunits using specific primers for α2, α3, α4, α5, α6, α7, β2, β3 and β4 subunits in two cells. (B) Wholecell currents in response to nicotine (1 s; 30 µM) show that the subunit expression patterns in (A) resulted from a nicotine-sensitive cell (left) and nicotine-insensitive cell (right). (C) Histogram showing the relative fraction of cells with visibly detectable cDNA products for each of the nine subunits in the two populations of MHb cells: α2, α3, α4, β2 and β4 were examined in 17 responsive and 8 non-responsive cells; α5, α6, α7 and β3 were examined in 9 responsive and 4 non-responsive cells.
3.2. MHb cells with functional channels express high levels of particular nAChR subunit mRNAs In our qualitative comparison (see Fig. 2(A)), we note that the levels (relative brightness of the bands) of certain mRNAs were often apparently lower in cells not expressing functional channels, implying that there may be quantitative differences in mRNA expression. If production of functional nAChRs depends on a critical level of mRNA (i.e., a certain number of gene transcripts) for subunits comprising the channels, then nicotine-responsive cells should express relatively high levels of these
particular mRNAs. We have therefore compared the relative levels of mRNA expression between responsive and non-responsive MHb cells. In order to quantify differences in mRNA expression levels we compared the brightness of the nAChR bands to those for actin within the same lane. We assume that actin mRNA levels will be reasonably consistent across a population of cells and that comparison within lanes will reduce any differences due to variable gel loading. Two examples of mRNA levels from MHb cells that responded to nicotine (10 µM) are shown in Fig. 3(A) and (B). In both cases mRNA levels for α3, α4, α5, β2 and β4 subunits were
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
2597
Fig. 3. Analysis of nAChR subunit mRNA levels in nicotine-sensitive MHb neurons. Examples of nAChR subunit mRNA patterns in two cells responding to brief applications of nicotine (A), (B). The agarose gels show products for various subunit mRNAs (⬇400 bp) in addition to actin mRNA (⬇250 bp) product in each lane. An example of the current response induced by nicotine is shown under each gel. Histograms of the relative expression of each subunit (optical density normalized to the actin band in each lane). Filled bars show the level of α3, α4, α5, β2 and β4 mRNA expression and open bars indicate the levels of the remaining subunits. (C) Plot of the relative levels of subunit mRNA expression in each cell (open circles) and the mean expression (filled circles; n=12).
approximately equal to actin levels (filled bars in the histograms), and lower amounts of α7 and α6 were found in cell (A) and cell (B), respectively (open bars in the histograms). The apparent high levels of each of five subunit mRNAs (α3, α4, α5, β2 and β4) were conserved in all cells that responded to nicotine (Fig. 3(C)). In 12 responding MHb neurons, the level of these five subunits relative to actin was ⬎0.78 in 59/60 cases (α5=0.15 actin in one cell). As expected from the earlier experiments, three other subunits, α6, α7 and β3, were sometimes also expressed but at lower levels (Fig. 3(C)).
If functional nAChRs fail to form because of insufficient mRNA, then non-responsive cells should express little or no mRNA for one or more crucial contributing subunits. To determine whether this idea is valid we examined subunit mRNA levels in a population of presumed MHb cells (see below) that had no detectable functional nAChR channels. The results show that in all cells (n=11), one or more of the five presumed functionally important subunits were either absent or expressed at levels ⬍0.40 compared with actin (Fig. 4). Figure 4(A) illustrates that in different cells, different
2598
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 4. Analysis of nAChR subunit mRNA levels in nicotine-insensitive MHb neurons. Examples of nAChR subunit mRNA patterns in four cells that showed no detectable response to brief applications of nicotine (A [i–iv]). The agarose gels show products for various subunit mRNAs in addition to actin mRNA product in each lane (top). Histograms of the relative expression of each subunit (middle). Filled bars show the level of α3, α4, α5, β2 and β4 mRNA expression and open bars indicate the level of the remaining subunits. Example of the lack of current response induced by nicotine is shown under each histogram (bottom). (B) Histogram of the mean relative levels of subunit mRNA expression in nicotinesensitive (filled bars; n=12) and nicotine-insensitive (open bars; n=11) cells. * p⬍0.05.
sets of subunits were expressed at reduced levels. Thus, the major difference in expression patterns in nonresponsive cells compared to responsive cells is the apparent randomness of both the occurrence and expression level of these five subunits. Despite the large degree of variability between cells, the mean levels of mRNA for four of the five critical subunits are significantly lowered in non-functional MHb cells (p⬍0.05; Fig. 4(B)). The cell-to-cell variability may explain why β2 subunit mRNA was not significantly different when the entire population of cells is considered (Fig. 4(B)),
even though it was clearly expressed at reduced levels in some cells (Fig. 4(A)). Interestingly, the expression patterns and levels of α6, α7 and β3 subunits were variable in all cells irrespective of function (Fig. 4(B)). We have no reason to think that the reduced levels and less common detection of these latter three subunit mRNAs arose from differences in the ability of their primer pairs to induce amplification because in some cells we observe high levels of these subunits (see Fig. 3(A) and Fig. 4(A)[ii]). In addition, the overall similarity in maximal levels of actin and nAChR products implies that our RT–
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
PCR assay may be close to saturation, and therefore should be sensitive enough to detect relatively low levels of mRNA. 3.3. Choline acetyl transferase and MHb cells Cholinergic cells in the ventral two thirds of the MHb provide a major input to the interpeduncular nucleus and can be identified by choline acetyl transferase (ChAT) immunoreactivity (Woolf and Butcher, 1985; Contestabile et al., 1987; Semba and Fibiger, 1989), as shown here (Fig. 5(A), (B)), or ChAT mRNA (Oh et al., 1992). Thus, in order to confirm the origin of the nicotine sensitive and insensitive cells in the present study, ChAT mRNA was assayed a subset of cells using RT–PCR. The first six lanes in Fig. 5(C) show that as expected ChAT mRNA is absent in the α4β2 subunit expressing HEK cells and in “cell-free” controls, indicating that ChAT product is not an artifact of contamination and is confined to neurons. ChAT mRNA was, however, detected in the majority of presumed MHb cells (Fig. 5(C); last seven lanes). In total, all cells (6/6) sensitive to nicotine and the majority of non-responsive cells (5/6) expressed ChAT mRNA. These data are consistent with the suggestion that the cells used in this study were obtained from the MHb.
4. Discussion 4.1. MHb neurons express a subset of nAChR mRNAs Although the precise molecular composition of any known native nAChR is at present uncertain, the highly localized distributions of nAChR subunit mRNAs in the CNS in situ (e.g. Wada et al., 1989) imply that the subtypes of nAChR expressed in a given cell may be largely predetermined by which genes are transcribed (see Boyd, 1997). The results of the single cell RT–PCR experiments performed here have confirmed and extended our knowledge of the potential subunit composition of nAChRs in the MHb. As expected on the basis of subunit-selective agonist and α-conotoxin pharmacology (Mulle and Changeux, 1990; Quick et al., 1999), high levels of mRNAs for α3, β4 and β2 subunits are present in all MHb cells possessing functional nAChRs. These data fulfill a prediction resulting from our previous suggestion that α3 and β4 subunits are a prerequisite to all functional nAChRs on MHb cells, with the optional involvement of β2 subunits in some cases (Quick et al., 1999). Thus the uniformly strong distribution of α3, β4 (and slightly less so β2) subunit mRNAs in MHb autoradiographs in situ reflects a relatively homogenous population of MHb neurons with respect to these three subunits (Duvoisin et al., 1989; Wada et al., 1989; Winzer-Serhan and Leslie, 1997). The finding that α2
2599
subunit mRNA is never detected in MHb neurons, irrespective of responsiveness to nicotine, is in agreement with the absence of in situ staining for α2 mRNA in this region (Wada et al., 1989) and in addition serves as a good negative control. With respect to MHb, the cellular expression patterns of the other less well characterized subunits reveal that α6, α7 and β3 are sporadically detected (⬇40% cells). For α6 subunits this is somewhat expected based on the weak staining for α6 mRNA in MHb in situ (Le Novere et al., 1996). The restricted localization of mRNA for both α7 and β3 subunits to a subset of neurons, despite relatively uniform and strong expression of these subunits throughout the ventral portions of the MHb is more surprising (Deneris et al., 1989; Seguela et al., 1993). For α7, however, the lack of mRNA in most cells is in accordance with the insensitivity of MHb neurons to αBTX (Mulle and Changeux, 1990) while still consistent with a potential presynaptic role of α7 subunit containing nAChRs on MHb axon terminals in the IPN (Sastry et al., 1979; Clarke et al., 1986; McGehee et al., 1995). The final two subunits assayed in the present study, α4 and α5, were unexpectedly expressed in a high percentage (⬍95%) of cells examined; although mRNA for these two subunits is present in MHb (Wada et al., 1989; Le Novere et al., 1996), their relevance to functional nAChRs in this region is not known. Overall, these data are consistent with the suggestion that, because of uniform cellular mRNA expression, α3, α4, α5, β2 and β4 subunits could contribute to functional nAChRs in the majority of MHb neurons. Conversely, α2 nAChR subunits do not participate, and α6, α7 and β3 subunits are not absolutely necessary for function but may add an as yet unknown diversity to nAChR channels in some cells. 4.2. Is the level of mRNA expression important for nAChR function in MHb? Neuronal control of the expression of plasma membrane channels is likely to be a complex process that involves several levels of control including gene transcription and translation, multimeric subunit assembly, protein maturation, targeting and functional regulation of membrane channels. Because we find that the levels of certain subunit mRNAs, compared to actin mRNA, correlate with nAChR functionality it is suggested that the number of mRNA transcripts may have an important role in the regulation of surface channel expression on MHb cells (see Boyd, 1997). Overall, the same five subunits that we detected routinely in the majority of neurons, α3, α4, α5, β2 and β4, were consistently expressed at relatively high levels in MHb cells that possessed functional nAChRs. Conversely, although all members of this subset of subunit mRNAs were not consistently expressed at reduced amounts in all unresponsive cells (see Fig. 4), the mean level of expression of four of these
2600
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 5. Choline acetyltransferase mRNA and protein in MHb neurons. (A) and (B) ChAT immunoreactivity in the ventral portion of MHb slices. The same tissue slice is shown under phase contrast (A) and fluorescent illumination (B). LHb, lateral habenula; MHb, medial habenula; sm, stria medullaris. (C) Agarose gel showing ChAT mRNA product in MHb cells but not α4β2 HEK cells or cell-free recordings. + and ⫺ indicate sensitivity and insensitivity to nicotine, respectively. (D) Sample whole-cell current recordings in response to 10 µM nicotine in representative MHb cells as indicated in (C).
subunits, α3, α4, α5 and β4, was significantly lower than in responsive cells. It should be noted that although β2 subunit expression was not significantly different between nicotine-sensitive and insensitive cell populations, it was low (⬍0.7 relative to actin) in ⬇50% insensitive cells compared to a invariably high expression (⬎0.8) in 100% cells with functional nAChRs.
Based upon differences in the relative amounts of certain nAChR subunit mRNAs (α3, α4, α5, β2 and β4), we suggest that a critical level of gene transcription of one or more of these subunits may be required for production of fully functional plasma membrane nAChR channels on MHb neurons. Although the details of how such a mechanism would work are unknown to us, it is possible that a sufficient number of gene transcripts is
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
necessary for protein synthesis to overcome the effects of degradation, and thus provide an adequate supply of stable subunit (Kassner and Berg, 1997). It likely follows that if nAChR subunit mRNA level is a primary determinant of function, then the number of activatable nAChR channels on the cell surface should be related to the number of gene transcripts. Although we have not directly addressed this question here, innervation and target-specific cell-to-cell interactions have been shown to regulate the number of functional α3β4-like nAChRs on chick ganglion cells via a mechanism dependent on gene transcription (Levey et al., 1995; Devay et al., 1999). Of particular relevance is the finding that the amplitude of whole-cell currents in these cells can be correlated with the number of α3 and β4 transcripts (Levey et al., 1995), implying that in principle, the strong presence of these two subunit mRNAs in MHb neurons may drive functional expression. Indeed, it is interesting to note that in 10/11 unresponsive cells, either one or both of α3 or β4 was expressed at reduced levels. Because the α3 and β4 genes are localized together with the α5 gene in a cluster (Boulter et al., 1990) and may all participate in one subtype of nAChR in the autonomic nervous system (Vernallis et al., 1993), it is possible that their transcriptions are coordinated (Henderson et al., 1994). However, during development of chick ciliary ganglion synapses, a strong correlation was observed between changes in the amplitude of nicotine-induced currents and α3 and β4, but not α5 subunits (Levey et al., 1995). Thus, although the regulation of nicotinic gene transcription is not fully understood, there are likely to be multiple pathways through which independent and concerted transcription can be initiated in a neuron-specific manner (Boyd, 1996; McDonough and Deneris, 1997; Liu et al., 1999). Independence of transcription would be necessary to account for the differential expression of these three genes in unresponsive MHb neurons (see Fig. 4(A)). Although gene transcription is a necessary step towards function, it need not be the rate-limiting process in the regulation of nAChR channels. In the present study some MHb cells that did not respond functionally to nicotine contain relatively high levels of certain subunits that are known to form nAChR channels when expressed in heterologous expression systems (Luetje and Patrick, 1991). For example, in the cell shown in Fig. 4(A)[i], both α3 and β4 subunit mRNAs are expressed at relatively high levels but do not produce functional channels, at least not on cell body regions. These data imply that either simple heterodimer combinations of subunits, including α4β2 nAChRs, do not form channels in MHb neurons, either because an additional subunit mRNA is not well expressed or that other post-transcriptional mechanisms are important (Blumenthal et al., 1997).
2601
4.3. Subunit composition of nAChRs in MHb neurons The fact that the nicotinic sensitivity of neurons is correlated with the level of five species of mRNA implies that a pentameric nAChR in MHb may contain up to five different subunits (Role, 1992; Colquhoun and Patrick, 1997a; Jones et al., 1999). We have previously suggested that nAChRs in these cells possibly have either two α3–β4 subunit interfaces or both a single α3β4 and a single α3β2 subunit interface. If nAChRs are pentamers (Cooper et al., 1991), this leaves a single opening for an additional subunit. The RT–PCR data in the present work points towards either α5 or α4 subunits, since their respective relative mRNA levels also correlate with function. There is support for inclusion of both of these subunits with a basic α3β4(β2) subunitcontaining receptor (Conroy and Berg 1995, 1998). Variations on these themes could allow for the inclusion of the other less frequently expressed subunits such as β3 (Forsayeth and Kobrin, 1997), α6 (Gerzanich et al., 1996; Lena et al., 1999) and possibly α7 (Listerud et al., 1991; Yu and Role, 1998).
Acknowledgements This work was supported by United States Public Health Service Grant NS-31669 (R.A.J.L.) and the W.M. Keck Foundation #931360. We thank Hafeeza Anchrum for technical assistance with the immunohistochemistry and Alexis Turner for help with the RT–PCR assays. The α4β2 cells were a generous gift from J. Zhang and J.H. Steinbach.
References Boyd, R.T., 1996. Transcriptional regulation and cell specificity determinants of the rat nicotinic acetylcholine receptor α3 gene. Neuroscience Letters 208, 73–76. Boyd, R.T., 1997. The molecular biology of neuronal nicotinic acetylcholine receptors. Critical Reviews in Toxicology 27, 299–318. Boulter, J., O’Shea-Greenfield, A., Duvoisin, R.M., Connolly, J.G., Wada, E., Jensen, A., Gardner, P.D., Ballivet, M., Deneris, E.S., McKinnon, D., Heinemann, S., Patrick, J., 1990. α3, α5, and β4: three members of the rat neuronal nicotinic acetylcholine receptorrelated gene family form a gene cluster. Journal of Biological Chemistry 265, 4472–4482. Blumenthal, E.M., Conroy, W.G., Romano, S.J., Kassner, P.D., Berg, D.K., 1997. Detection of functional nicotinic receptors blocked by alpha-bungarotoxin on PC12 cells and dependence of their expression on post-translational events. Journal of Neuroscience 17, 6094–6104. Brussaard, A.B., Yang, X., Doyle, J.P., Huck, S., Role, L.W., 1994. Developmental regulation of multiple nicotinic AChR channel subtypes in embryonic chick habenula neurons: contributions of both the α2 and α4 subunit genes. Pflugers Archives 429, 27–43. Clarke, P.B., Hamill, G.S., Nadi, N.S., Jacobowitz, D.M., Pert, A., 1986. 3H-nicotine- and 125I-α-bungarotoxin-labeled nicotinic recep-
2602
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
tors in the interpeduncular nucleus of rats—II. Effects of habenular deafferentation. Journal of Comparative Neurology 251, 407–413. Colquhoun, L.M., Patrick, J.W., 1997a. Pharmacology of neuronal nicotinic acetylcholine receptor subtypes. Advances in Pharmacology 39, 191–220. Colquhoun, L.M., Patrick, J.W., 1997b. α3, β2, and β4 form heterotrimeric neuronal nicotinic acetylcholine receptors in Xenopus oocytes. Journal of Neurochemistry 69, 2355–2362. Cooper, E., Couturier, S., Ballivet, M., 1991. Pentameric structure and subunit stoichiometry of a neuronal nicotinic acetylcholine receptor. Nature 350, 235–238. Connolly, J.G., Gibb, A.J., Colquhoun, D., 1995. Heterogeneity of neuronal nicotinic acetylcholine receptors in thin slices of rat medial habenula. Journal of Physiology 484, 87–105. Conroy, W.G., Berg, D.K., 1995. Neurons can maintain multiple classes of nicotinic acetylcholine receptors distinguished by different subunit compositions. Journal of Biological Chemistry 270, 4424–4431. Conroy, W.G., Berg, D.K., 1998. Nicotinic receptor subtypes in the developing chick brain: appearance of a species containing the α4, β2, and α5 gene products. Molecular Pharmacology 53, 392–401. Contestabile, A., Villani, L., Fasolo, A., Franzoni, M.F., Gribaudo, L., Oktedalen, O., Fonnum, F., 1987. Topography of cholinergic and substance P pathways in the habenulo-interpeduncular system of the rat. An immunocytochemical and microchemical approach. Neuroscience 21, 253–270. Deneris, E.S., Boulter, J., Swanson, L.W., Patrick, J., Heinemann, S., 1989. Beta 3: a new member of nicotinic acetylcholine receptor gene family is expressed in brain. Journal of Biological Chemistry 264, 6268–6272. Devay, P., McGehee, D.S., Yu, C.R., Role, L.W., 1999. Target-specific control of nicotinic receptor expression at developing interneuronal synapses in chick. Nature Neuroscience 2, 528–534. Dineley-Miller, K., Patrick, J., 1992. Gene transcripts for the nicotinic acetylcholine receptor subunit, β4, are distributed in multiple areas of the rat central nervous system. Molecular Brain Research 16, 339–344. Duvoisin, R.M., Deneris, E.S., Patrick, J., Heinemann, S., 1989. The functional diversity of the neuronal nicotinic acetylcholine receptor is increased by a novel subunit β4. Neuron 3, 487–496. Elgoyhen, A.B., Johnson, D.S., Boulter, J., Vetter, D.E., Heinemann, S., 1994. α9: an acetylcholine receptor with novel pharmacological properties expressed in rat cochlear hair cells. Cell 79, 705–715. Forsayeth, J.R., Kobrin, E., 1997. Formation of oligomers containing the β3 and β4 subunits of the rat nicotinic receptor. Journal of Neuroscience 17, 1531–1538. Fucile, S., Barabino, B., Palma, E., Grassi, F., Limatola, C., Mileo, A.M., Alema, S., Ballivet, M., Eusebi, F., 1997. α5 subunit forms functional α3β4α5 nAChRs in transfected human cells. Neuroreport 8, 2433–2436. Gerzanich, V., Kuryatov, A., Anand, R., Lindstrom, J., 1996. “Orphan” alpha6 nicotinic AChR subunit can form a functional heteromeric acetylcholine receptor. Molecular Pharmacology 51, 320–327. Henderson, L.P., Gdovin, M.J., Liu, C., Gardner, P.D., Maue, R.A., 1994. Nerve growth factor increases nicotinic ACh receptor gene expression and current density in wild-type and protein kinase Adeficient PC12 cells. Journal of Neuroscience 14, 1153–1163. Jones, S., Sudweeks, S., Yakel, J.L., 1999. Nicotinic receptors in the brain: correlating physiology with function. Trends in Neurosciences 22, 555–561. Kassner, P.D., Berg, D.K., 1997. Differences in the fate of neuronal acetylcholine receptor protein expressed in neurons and stably transfected cells. Journal of Neurobiology 33, 968–982. Lena, C., de Kerchove D’Exaerde, A., Cordero-Erausquin, M., Le Novere, N., del Mar Arroyo-Jimenez, M., Changeux, J.P., 1999. Diversity and distribution of nicotinic acetylcholine receptors in the
locus ceruleus neurons. Proceedings of the National Academy of Sciences of the USA 96, 12126–12131. Le Novere, N., Zoli, M., Changeux, J.P., 1996. Neuronal nicotinic receptor α6 subunit mRNA is selectively concentrated in catecholaminergic nuclei of the rat brain. European Journal of Neuroscience 8, 2428–2439. Lester, R.A.J., Dani, J.A., 1995. Acetylcholine receptor desensitization induced by nicotine in rat medial labenula neurons. Journal of Neurophysiology 74, 195–206. Levey, M.S., Brumwell, C.L., Dryer, S.E., Jacob, M.H., 1995. Innervation and target tissue interactions differentially regulate acetylcholine receptor subunit mRNA levels in developing neurons in situ. Neuron 14, 153–162. Listerud, M., Brussaard, A.B., Devay, P., Colman, D.R., Role, L.W., 1991. Functional contribution of neuronal AChR subunits revealed by antisense oligonucleotides. Science 254, 1518–1521. Liu, Q., Melnikova, I.N., Hu, M., Gardner, P.D., 1999. Cell type-specific activation of neuronal nicotinic acetylcholine receptor subunit genes by Sox10. Journal of Neuroscience 19, 9747–9755. Luetje, C.W., Patrick, J.P., 1991. Both α- and β-subunits contribute to the agonist sensitivity of neuronal nicotinic acetylcholine receptors. Journal of Neuroscience 11, 837–845. McDonough, J., Deneris, E., 1997. β43⬘: An enhancer displaying neural-restricted activity is located in the 3⬘-untranslated exon of the rat nicotinic acetylcholine receptor β4 gene. Journal of Neuroscience 17, 2273–2283. McGehee, D.S., Heath, M.J., Gelber, S., Devay, P., Role, L.W., 1995. Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269, 1692–1696. Mulle, C., Changeux, J.P., 1990. A novel type of nicotinic receptor in the rat central nervous system characterized by patch-clamp techniques. Journal of Neuroscience 10, 169–175. Mulle, C., Choquet, D., Korn, H., Changeux, J.P., 1992. Calcium influx through nicotinic receptor in rat central neurons: its relevance to cellular regulation. Neuron 8, 135–143. Oh, J.D., Woolf, N.J., Roghani, A., Edwards, R.H., Butcher, L.L., 1992. Cholinergic neurons in the rat central nervous system demonstrated by in situ hybridization of choline acetyltransferase mRNA. Neuroscience 47, 807–822. Porter, J.T., Cauli, B., Tsuzuki, K., Lambolez, B., Rossier, J., Audinat, E., 1999. Selective excitation of subtypes of neocortical interneurons by nicotinic receptors. Journal of Neuroscience 19, 5228– 5235. Poth, K., Nutter, T.J., Cuevas, J., Parker, M.J., Adams, D.J., Luetje, C.W., 1997. Heterogeneity of nicotinic receptor class and subunit mRNA expression among individual parasympathetic neurons from rat intracardiac ganglia. Journal of Neuroscience 17, 586–596. Quick, M.W., Lester, H.A., 1994. Methods for expression of excitability proteins in Xenopus oocytes. In: Conn, P.M. (Ed.), Methods in Neurosciences. Academic Press, San Diego, pp. 261–279. Quick, M.W., Ceballos, R.M., Kasten, M., McIntosh, J.M., Lester, R.A.J., 1999. α3β4 subunit-containing nicotinic receptors dominate function in rat medial habenula neurons. Neuropharmacology 38, 769–783. Role, L.W., 1992. Diversity in primary structure and function of neuronal nicotinic acetylcholine receptor channels. Current Opinion in Neurobiology 2, 254–262. Sabey, K., Paradiso, K., Zhang, J., Steinbach, J.H., 1999. Ligand binding and activation of rat nicotinic α4β2 receptors stably expressed in HEK293 cells. Molecular Pharmacology 55, 58–66. Sastry, B.R., Zialkowski, S.E., Hansen, L.M., Kavanagh, J.P., Evoy, E.M., 1979. Acetylcholine release in interpeduncular nucleus following the stimulation of habenula. Brain Research 164, 334–337. Seguela, P., Wadiche, J., Dineley-Miller, K., Dani, J.A., Patrick, J.W., 1993. Molecular cloning, functional properties, and distribution of rat brain α7: a nicotinic cation channel highly permeable to calcium. Journal of Neuroscience 13, 596–604.
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Semba, K., Fibiger, H.C., 1989. Organization of central cholinergic systems. Progress in Brain Research 79, 37–63. Vernallis, A.B., Conroy, W.G., Berg, D.K., 1993. Neurons assemble acetylcholine receptors with as many as three kinds of subunits while maintaining subunit segregation among receptor subtypes. Neuron 10, 451–464. Vernino, S., Amador, M., Luetje, C.W., Patrick, J., Dani, J.A., 1992. Calcium modulation and high calcium permeability of neuronal nicotinic acetylcholine receptors. Neuron 8, 127–134. Wada, E., Wada, K., Boulter, J., Deneris, E., Heinemann, S., Patrick, J., Swanson, L.W., 1989. Distribution of alpha 2, alpha 3, alpha 4, and beta 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat. Journal of Comparative Neurology 284, 314–355. Wang, F., Gerzanich, V., Wells, G.B., Anand, R., Peng, X., Keyser, K., Lindstrom, J., 1996. Assembly of human neuronal nicotinic receptor α5 subunits with α3, β2, and β4 subunits. Journal of Bio-
2603
logical Chemistry 271, 17656–17665. Williams, B.M., Temburni, M.K., Levey, M.S., Bertrand, S., Bertrand, D., Jacob, M.H., 1998. The long internal loop of the alpha 3 subunit targets nAChRs to subdomains within individual synapses on neurons in vivo. Nature Neuroscience 1, 557–562. Winzer-Serhan, U.H., Leslie, F.M., 1997. Codistribution of nicotinic acetylcholine receptor subunit α3 and β4 mRNAs during rat brain development. Journal of Comparative Neurology 386, 540–554. Woolf, N.J., Butcher, L.L., 1985. Cholinergic systems in the rat brain—II. Projections to the interpeduncular nucleus. Brain Research Bulletin 14, 63–83. Yu, C.R., Role, L.W., 1998. Functional contribution of the alpha7 subunit to multiple subtypes of nicotinic receptors in embryonic chick sympathetic neurones. Journal of Physiology 509, 651–665. Zoli, M., Lena, C., Picciotto, M.R., Changeux, J.P., 1998. Identification of four classes of brain nicotinic receptors using β2 mutant mice. Journal of Neuroscience 18, 4461–4472.
Nicotinic acetylcholine receptor subunit mRNA expression and channel function in medial habenula neurons Elise B. Sheffield, Michael W. Quick, Robin A.J. Lester
*
Department of Neurobiology, CIRC room 560, 1719 Sixth Avenue South, University of Alabama at Birmingham, Birmingham, AL 35294-0021, USA Accepted 28 July 2000
Abstract Relationships between nicotinic acetylcholine receptor (nAChR) channel function and nAChR subunit mRNA expression were explored in acutely isolated rat medial habenula (MHb) neurons using a combination of whole-cell recording and single cell RT– PCR techniques. Following amplification using subunit-specific primers, subunits could be categorized in one of three ways: (i) present in 95–100% cells: α3, α4, α5, β2 and β4; (ii) never present: α2; and (iii) sometimes present (⬇40% cells): α6, α7 and β3. These data imply that α2 subunits do not participate in nAChRs on MHb cells, that α6, α7 and β3 subunits are not necessary for functional channels but may contribute in some cells, and that nAChRs may require combinations of all or subsets of α3, α4, α5, β2 and β4 subunits. Little difference in the patterns of subunit expression between nicotine-sensitive and insensitive cells were revealed based on this qualitative analysis, implying that gene transcription per se may be an insufficient determinant of nAChR channel function. Normalization of nAChR subunit levels to the amount of actin mRNA, however, revealed that cells with functional channels were associated with high levels (⬎0.78 relative to actin; 11/12 cells) of all of the category (i) subunits: α3, α4, α5, β2 and β4. Conversely, one or more of these subunits was always low (⬍0.40 relative to actin) in all cells with no detectable response to nicotine. Thus the formation of functional nAChR channels on MHb cells may require critical levels of several subunit mRNAs. 2000 Elsevier Science Ltd. All rights reserved. Keywords: Nicotinic receptor subtypes; Xenopus oocytes; Nicotine addiction; Ion channel; CNS; Single cell RT–PCR
1. Introduction Specification of the subunit composition of multimeric receptor-gated ion channels is one mechanism through which neurons can regulate their function. Inclusion of certain key subunits within one such family of channels, the neuronal nicotinic acetylcholine receptors (nAChRs), likely controls many important aspects of these receptors including their specific synaptic targeting (Williams et al., 1998) and relative Ca2+ permeability (Mulle et al., 1992; Vernino et al., 1992; Seguela et al., 1993). Thus, in order to understand fully the physiological roles of these receptors it will be essential to define their subunit compositions. The large number of potential nAChR subunit combinations, together with an incomplete set of
* Corresponding author. Tel.: +1-205-934-4483; fax: +1-205-9346571. E-mail address: [email protected] (R.A.J. Lester).
pharmacological tools, has so far prevented a definitive assessment of the subunit composition of particular native nAChRs (Role, 1992; Colquhoun and Patrick, 1997a; Jones et al., 1999). However, the discrete expression patterns of individual subunit mRNAs expression in the nervous system imply that the formation of nAChR channels in specific brain regions may be related, at least in part, to the levels of gene transcripts (Boyd, 1997). Despite the abundance of numerous types of nAChR subunit mRNAs in the media habenula (MHb), previous molecular (Duvoisin et al., 1989; Wada et al., 1989), biochemical (Zoli et al., 1998) and electrophysiological (Mulle and Changeux, 1990; Quick et al., 1999) analyses suggest that α3 and β4 subunits likely contribute to the major type of functional channel in this region. This leaves the role of other nAChR subunits (e.g., α4, α5, α6, α7, β3 and β2) expressed in this nucleus uncertain (Deneris et al., 1989; Wada et al., 1989; Boulter et al., 1990; Dineley-Miller and Patrick, 1992; Seguela et al.,
0028-3908/00/$ - see front matter 2000 Elsevier Science Ltd. All rights reserved. PII: S 0 0 2 8 - 3 9 0 8 ( 0 0 ) 0 0 1 3 8 - 6
2592
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
1993; Le Novere et al., 1996). Are these subunits sometimes or always included in receptors along with the minimal functional set of α3 and β4 subunits described above? Do they form receptors that are not functionally detected and perhaps awaiting biochemical activation? Are they used to form additional types of nAChRs targeted to other parts of the cell? Evidence exists for all these possibilities. β2 and α5 subunits can coassemble with α3β4 nAChRs (Wang et al., 1996; Colquhoun and Patrick, 1997b; Fucile et al., 1997) and could add to the functional diversity of nAChR channels on cell bodies (see Brussaard et al., 1994; Connolly et al., 1995). High affinity α4β2-like [3H]-nicotine binding sites are lost from the MHb in β2 knockout mice (Zoli et al., 1998), but have not so far been classified functionally in this region. Finally, α-BTX-sensitive nAChRs exist in the IPN (Clarke et al., 1986), where MHb axons terminate and suggest a potential presynaptic function for α7nAChRs. Single cell RT–PCR studies from other areas of the nervous system have provided strong evidence that functional nAChRs on cell bodies of individual neurons are related to the underlying subunit mRNA expression (Lena et al., 1999; Porter et al., 1999). Thus, in order to assess further the potential diversity in the subunit compositions of nAChRs in the CNS, we have examined how the patterns of subunit mRNA expression in MHb cells reflect their sensitivity to nicotine.
2. Materials and methods 2.1. Isolated medial habenula cells Neurons were isolated from the habenula region of 7–21 day-old rats using methods described previously (Quick et al., 1999). A single rat was anesthetized under halothane and decapitated. Following removal of the brain, both habenula nuclei (with as little surrounding tissue as possible) were microdissected in ice-cold saline. Following a 30 min incubation at 37°C in a PIPES buffered solution containing 60–90 U papain (Worthington Biochemical Corporation, Freehold, NJ), the tissue was washed with fresh PIPES-buffer and triturated in a low glucose DMEM (Gibco BRL, Grand Island, NY) with a fire-polished Pasteur pipette. Dissociated neurons were plated onto sterile glass coverslips coated with 2–4 µg ml⫺1 of poly-D-lysine (Collaborative Biomedical Products, Bedford, MA). The incubation media was supplemented with 1–2% fetal bovine serum (Atlanta Biologicals, Norcross, GA). Neurons were maintained at 37°C for at least 1 h and used up to 8 h following isolation. Unless stated otherwise, chemicals were obtained from Sigma–Aldrich (St. Louis, MO).
2.2. a4b2 cell line Human embryonic kidney (HEK-293) cells that stably express functional rat α4β2 receptors were a generous gift from J. Zhang and J.H. Steinbach (Washington University, St. Louis, MO). These cells were maintained as described previously (Sabey et al., 1999). For electrophysiological recording, cells were plated on glass coverslips coated with poly-L-ornithine. Cells were recorded from 1–2 days after plating. 2.3. Recording and drug-application in isolated cells Whole-cell recordings were obtained from α4β2 HEK cells (Sabey et al., 1999) and presumed MHb neurons (see Quick et al., 1999) using fire-polished, Sylgardcoated glass pipettes (#7052; Garner Glass, Clairmont, CA). Pipettes were filled with a filtered and autoclaved sterile internal solution containing (in mM): NaCl, 140; HEPES, 10; EGTA, 10; pH 7.4). Pipettes had resistances of 2–5 M⍀. Control and drug-containing solutions were gravity fed into a linear array of glass barrels (Garner Glass) positioned close (⬍100 µm) to the neuron. The barrels were attached to a piezo-electric bimorph (Piezo Systems, Cambridge, MA) connected to a variable 0– 120 V DC-power source under computer control. Complete exchange of solutions occurred in ⬇50 ms (Lester and Dani, 1995). Perfusion medium contained (in mM): NaCl, 150; HEPES, 10; CaCl2, 2; pH 7.4. Currents induced by nicotinic agonists were recorded using an Axopatch 1-D amplifier (Axon Instruments, Foster City, CA), low-pass filtered at 500 Hz, digitized at 1 kHz and captured on an 80486-based computer using Axobasic software (Axon Instruments). Nicotine was used in the form of the tartrate salt (Sigma–Aldrich). To preserve nAChR subunit mRNAs the durations of whole-cell recordings were restricted to under 10 min (see Poth et al., 1997). 2.4. Injection of nAChR subunit mRNAs into xenopus oocytes Procedures for preparation of oocytes have been described in detail elsewhere (Quick and Lester, 1994). Briefly, oocytes were defolliculated and maintained at 18°C in incubation medium containing ND96 (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM HEPES, pH 7.4), 1.8 or 3.6 mM CaCl2, 50 µg/ml gentamicin, and 5% horse serum. Subunit cRNAs were synthesized in vitro (Message Machine; Ambion Inc., Austin, TX) from linearized plasmid templates of rat cDNA clones. Oocytes were injected with 5–25 ng/subunit/oocyte. Extraction of cell contents for RT–PCR was achieved by homogenization in buffer containing 50 mM Tris-Cl, 1 mM EDTA, 200 µM PMSF, 10 µg ml⫺1 aprotinin, and 10 µg/ml leupeptin.
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
2.5. Single-cell RT–PCR Following collection of electrophysiological data, gentle suction was applied to the recording pipette and the cell contents were transferred into the pipette tip. The pipette was removed from the head-stage holder and its contents (⬇10 µl) expelled into clean autoclaved 0.5 ml Ependorf tubes. On occasion either the whole cell was sucked into the pipette or would become so firmly attached that it would be transferred in its entirety. Negative cell-free controls were obtained by aspirating the extracellular solution close to cells into identically handled pipettes. The tubes were color-coded and immediately placed on ice and stored at ⫺80°C for periods up to 10 days. The methods employed for determination of nAChR subunit mRNA in single neurons has been described previously (Poth et al., 1997). In brief, isolated neuronal cytoplasm and pipette solution (approx. 6 µl) was reverse transcribed in a 20 µl reaction (1 h at 37°C) containing 1 mM each dNTP, 100 pmol 18-mer poly(T), 20 U RNAse inhibitor, and 40 U AMV reverse transcriptase. Following transcription, the sample was divided into a number of individual aliquots in preparation for the individual PCR reactions. The PCR was performed using non-degenerate primer pairs that were designed to be unique for a single type of nAChR subunit mRNA. The sequences of these subunit-specific primers are shown in Table 1. All primers were chosen such that the annealed products cross at least one intron/exon boundary and rule out the possibility of amplification of genomic DNA. PCR reactions (50 µl) contained aliquots of the RT product, 1 mM dNTPs, 2.5 mM MgCl2, 10 pmol of each forward and reverse primer, and 5 U Taq polymerase. The PCR cycling parameters were: 5 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 2 min followed by 35 cycles of 94°C for 1 min, 65°C for 1 min, and 72°C for 2 min. The reaction products were then spun through CentriSep columns to remove excess primers and subjected to re-amplification using 35 cycles of 94°C for 1
min, 65°C for 1 min, and 72°C for 2 min. Final reaction products were purified by phenol/chloroform extraction. In initial experiments, two sets of degenerate primers were used as described previously (Poth et al., 1997). One set of primers was designed to anneal to α2, α3, and α4 cDNAs; a second set of primers was constructed to anneal to β2 and β4 cDNAs. Following RT–PCR, the degenerate PCR products were subjected to restriction digests using subunit-specific endonucleases (see Poth et al., 1997) that produced unique digestion fragments. In our preliminary experiments on MHb neurons we were only able to detect α4 and β2 subunit product (data not shown) using the degenerate primers. Where tested using samples derived from Xenopus oocytes (α2, α3, α4, β2 and β4 subunits), the non-degenerate primer pairs were shown to selectively amplify appropriate subunits (Fig. 1(A)). Therefore, all subsequent experiments described in the Results section were performed using these subunit-specific primers. In all cases, final products were analyzed on 2% agarose gels. Gels were scanned into Adobe PhotoShop (Adobe Systems Company, Tokyo, Japan) and the contrast adjusted to enhance visualization of product bands. In qualitative experiments, product was judged to be present on a purely visual basis. In order to quantify the amount of product, the optical density of the band was estimated as the product of the number of pixels occupied by the band and the average pixel density. In all these quantitative comparisons the optical density of a band was expressed relative to the optical density of the actin product band in the same lane under the same contrast conditions. The experimenter performing the RT– PCR reactions was completely unaware of cell-type or whether the particular sample was from a cell that responded or not to nicotine. 2.6. RT-PCR controls In order to be sure that the appearance of a product correctly reflects the expression of an mRNA species in
Table 1 Primer sequences
alpha2 alpha3 alpha4 alpha5 alpha6 alpha7 beta2 beta3 beta4 ChAT Actin
2593
Acc #
Sense (5⬘–3⬘)
Antisense (5⬘–3⬘)
M20295 L31621 L31620 J05231 L08227 L31619 L31622 J04636 U42976 L02952 L08165
GATCTGGATCCCAGACATTG GGAGAAGTGACTTGGATCC CCTCTACAACAATGCGG CGAATGTCTGGCTGAAGC GCTTCATCCGGCCAGTGG GGAGTGAAGAATGTTCG GCTGACGGCATGTACGAAG GCTGAACACGAAGACGC GGTTGCCTGACATCGTGTTG GCCACTTGCATAGGTGAGGGC ATCTTTCTTGGGTATGGA
CGCCGATGAGTGGGATGACC CAAGTGGGCATGGGTGTG CCGATGAGCGGGATGTCC CACCATAATGGATAGGG GCAAAGAGTCACTTTCTCG GCAAGAATACCAGCAGAGC GGAGGTGGGAGGCACAATC GCAAAGACAGTCACC GCCAATGAGCGGTATGTC GCCACTAGTCAGTTGGGC ACATCTGCTGGAAGGTGG
2594
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 1. Subunit-specific primer verification and detection of appropriate subunits in a stable cell line. (A) Agarose gels each representing cDNA fragments amplified from the cytoplasmic contents of a Xenopus oocyte injected with the single subunit mRNA indicated underneath, and probed with each of five subunit-specific primer pairs (Table 1). (B) Examples of currents in response to nicotine (right traces) in three different α4β2 nAChR expressing HEK cells and their corresponding patterns of nAChR subunit mRNA expression (left). In addition to testing each of nine fractions for the nine subunit mRNAs, the agarose gels show consistent bands in each lane confirming the presence of actin mRNA. (C) A gel probed for all nAChR subunit and actin mRNAs taken from an aspirated “cell-free” recording.
the cell, the incidence of both false-positives and falsenegatives must be known. To address the accuracy of our mRNA detection, we used a control cell line stably expressing functional α4β2 receptors (Sabey et al., 1999), in which we could replicate the exact conditions used for patch-clamp recording and RT-PCR reactions from MHb cells. Figure 1(B) shows currents in response to 100 µM applications of nicotine in α4β2 subunitexpressing cells and their respective nAChR subunit expression patterns. As predicted, only α4 and β2 subunit mRNAs were detected (3/3 cells), although for
unknown reasons only 2/3 cells responded to nicotine. In addition, we could successfully RT–PCR a region of actin mRNA in all 27 samples from the same cells (Fig. 1(B)). Thus, for this limited data set the accuracy of mRNA detection was 100%. If the α4, β2 and actin amplification are representative of nAChR subunits in general, then we can put a conservative limit on detection failure. Given that the detection process worked in 33/33 cases but that it could fail the next time, the probability that we will successfully detect a product when it is present is ⱖ33/34 (or ⬎0.97). We note that there
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
was a complete failure to detect product for both actin and nAChR subunits in 5/53 total experiments on MHb cells. We believe that these cases arose because of incomplete transfer of the pipette contents to the storage tube. (In this respect, we note that in one of these cases the pipette tip was clearly broken during the transfer.) Conversely, to ensure against the detection of falsepositives as a result of contamination during the recording/RT–PCR procedure, solution was aspirated into a pipette from the vicinity of cells and tested for all nAChR subunits, actin and choline acetyltransferase (ChAT) mRNAs. Figure 1(C) and Fig. 5(C) show that no products were detected in 57/57 cases from these control experiments (n=3 cells). Moreover, we did not obtain products in whole-cell experiments from α4β2 cells for the seven nAChR subunits (α2, α3, α5, α6, α7, β3, β4), expected to be absent in 21/21 cases (Fig. 1(B)). Thus, we never observed a product in cases where it should have been absent and therefore the overall probability of false-positive detection is ⱕ1/79 (or ⬍0.02). These data imply that the procedures are both sensitive and accurate enough to be reasonably confident that the patterns of nAChR subunits in individual MHb cells are real. 2.7. Immunohistochemistry in brain slices Rat brains were removed as described above, and a block of tissue containing the habenula was placed into an ice-cold control artificial cerebrospinal fluid (ACSF) containing (in mM) NaCl, 155; NaHCO3, 26; KCl, 2; MgSO4, 2; KH2PO4 1.25; CaCl2, 2; glucose, 10, and bubbled with 95% CO2/5% O2. The tissue was glued adjacent to an agar-supportive block on the slicing platform of an Oxford Vibratome sectioning system (Ted Pella, Redding, CA), immersed with sucrose-substituted ACSF (250 mM sucrose in place of NaCl), and 200 µm thick brain slices were prepared. Usually between 4 and 6 slices containing the MHb could be obtained. For immunostaining, slices of MHb tissue were fixed for 3 h between 2 coverslips in a 0.1 M Na-phosphate buffer (PBS) containing 2% paraformaldehyde at 4°C. After 3×15 min rinses in PBS, slices were stored overnight in PBS containing 25% sucrose. Slices were rinsed for 30 min in PBS, permeablized with 0.5% triton-X in PBS for 1–2 h. Tissue was blocked with 1% goat serum (Amersham, Buckinghamshire, England). The primary antibody directed at choline acetyl transferase (ChAT; Mab305; Chemicon International Inc., Temecula, CA) was applied to slices at a dilution of 1:200 in PBS containing 0.5% triton-X and 1% goat serum for an initial period at room temperature (⬇2 h) and then overnight at 4°C. Slices were washed briefly with PBS and incubated with a secondary fluorescein-conjugated goat antimouse IgG (Pierce, Rockford, IL) for 1.5 h. During all the above steps slices were continuously agitated on an orbital shaker to ensure antibody penetration. Slices
2595
received 3×15 min final washes in PBS and are mounted on slides and left overnight at 4°C. Staining was visualized with a Leica microscope equipped with fluorescence. Controls were performed in the absence of the primary antibody. Data are shown as the mean±SEM. Statistical significance was calculated using Student’s t-tests.
3. Results 3.1. Nicotine-sensitive and insensitive cells express a similar complement of nAChR subunit mRNAs Comprehensive in situ analyses of nAChR subunit mRNAs indicate that at least eight individual messages [α3, α4, β2 (Wada et al., 1989), α5, α6 (Le Novere et al., 1996), α7 (Seguela et al., 1993), β3 (Duvoisin et al., 1989) and β4 (Deneris et al., 1989)] are expressed in rat MHb. To test whether the expression of these subunits is uniform amongst MHb neurons that have functional nAChR channels, we performed single cell RT–PCR using an extensive range of primer sets. For completeness α2 mRNA was also probed, although primers for α9 mRNA were not included because of the known highly restricted distribution of this subunit (Elgoyhen et al., 1994). In total, we examined the expression pattern of mRNAs for five subunits (α2–α4, β2 and β3) in 12 cells and nine subunits (α2–α7; β2–β4) in a further 13 cells. A representative example of the current induced by nicotine (30 µM) and the PCR products are shown for one of the MHb cells (Fig. 2(A), (B), left). For comparison, the mRNA subunit expression pattern is shown for a non-responsive cell (Fig. 2(A), (B), right). The PCR data from all cells were then pooled and in general show that nAChR subunit expression was similar irrespective of whether cells responded (17/25) or not (8/25) to nicotine (Fig. 2(C)). Assuming that our procedure was sensitive enough to detect all subunits (see discussion), the potential contributions that individual nAChRs subunits make to functional nicotinic responses can be gauged from the fraction of cells in which they were visibly present. Considering for now only the cells with functional nAChRs, Fig. 2(C) shows that four subunits (α3, α5, β2 and β4) were present in all these cells, α4 was present in 16/17 cells and the other three subunits (α6, α7 and β3) were present in fewer than 40% of the same cells. These data are consistent with the hypothesis that α3, α5, β2, β4 and possibly α4 subunits may be required for functional nAChRs in MHb neurons, whereas α6, α7 and β3 subunits are not absolute requirements for function but may participate in channels on some cells. However, in order to reconcile specific subunits with functional nAChRs, we need to account for the high occurrence of mRNAs in cells that do not respond to nicotine (Fig. 2(C)).
2596
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 2. Qualitative single cell subunit mRNA analysis in MHb neurons. (A) A single agarose gel indicating the presence or absence of cDNA fragments for various α and β nAChR subunits using specific primers for α2, α3, α4, α5, α6, α7, β2, β3 and β4 subunits in two cells. (B) Wholecell currents in response to nicotine (1 s; 30 µM) show that the subunit expression patterns in (A) resulted from a nicotine-sensitive cell (left) and nicotine-insensitive cell (right). (C) Histogram showing the relative fraction of cells with visibly detectable cDNA products for each of the nine subunits in the two populations of MHb cells: α2, α3, α4, β2 and β4 were examined in 17 responsive and 8 non-responsive cells; α5, α6, α7 and β3 were examined in 9 responsive and 4 non-responsive cells.
3.2. MHb cells with functional channels express high levels of particular nAChR subunit mRNAs In our qualitative comparison (see Fig. 2(A)), we note that the levels (relative brightness of the bands) of certain mRNAs were often apparently lower in cells not expressing functional channels, implying that there may be quantitative differences in mRNA expression. If production of functional nAChRs depends on a critical level of mRNA (i.e., a certain number of gene transcripts) for subunits comprising the channels, then nicotine-responsive cells should express relatively high levels of these
particular mRNAs. We have therefore compared the relative levels of mRNA expression between responsive and non-responsive MHb cells. In order to quantify differences in mRNA expression levels we compared the brightness of the nAChR bands to those for actin within the same lane. We assume that actin mRNA levels will be reasonably consistent across a population of cells and that comparison within lanes will reduce any differences due to variable gel loading. Two examples of mRNA levels from MHb cells that responded to nicotine (10 µM) are shown in Fig. 3(A) and (B). In both cases mRNA levels for α3, α4, α5, β2 and β4 subunits were
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
2597
Fig. 3. Analysis of nAChR subunit mRNA levels in nicotine-sensitive MHb neurons. Examples of nAChR subunit mRNA patterns in two cells responding to brief applications of nicotine (A), (B). The agarose gels show products for various subunit mRNAs (⬇400 bp) in addition to actin mRNA (⬇250 bp) product in each lane. An example of the current response induced by nicotine is shown under each gel. Histograms of the relative expression of each subunit (optical density normalized to the actin band in each lane). Filled bars show the level of α3, α4, α5, β2 and β4 mRNA expression and open bars indicate the levels of the remaining subunits. (C) Plot of the relative levels of subunit mRNA expression in each cell (open circles) and the mean expression (filled circles; n=12).
approximately equal to actin levels (filled bars in the histograms), and lower amounts of α7 and α6 were found in cell (A) and cell (B), respectively (open bars in the histograms). The apparent high levels of each of five subunit mRNAs (α3, α4, α5, β2 and β4) were conserved in all cells that responded to nicotine (Fig. 3(C)). In 12 responding MHb neurons, the level of these five subunits relative to actin was ⬎0.78 in 59/60 cases (α5=0.15 actin in one cell). As expected from the earlier experiments, three other subunits, α6, α7 and β3, were sometimes also expressed but at lower levels (Fig. 3(C)).
If functional nAChRs fail to form because of insufficient mRNA, then non-responsive cells should express little or no mRNA for one or more crucial contributing subunits. To determine whether this idea is valid we examined subunit mRNA levels in a population of presumed MHb cells (see below) that had no detectable functional nAChR channels. The results show that in all cells (n=11), one or more of the five presumed functionally important subunits were either absent or expressed at levels ⬍0.40 compared with actin (Fig. 4). Figure 4(A) illustrates that in different cells, different
2598
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 4. Analysis of nAChR subunit mRNA levels in nicotine-insensitive MHb neurons. Examples of nAChR subunit mRNA patterns in four cells that showed no detectable response to brief applications of nicotine (A [i–iv]). The agarose gels show products for various subunit mRNAs in addition to actin mRNA product in each lane (top). Histograms of the relative expression of each subunit (middle). Filled bars show the level of α3, α4, α5, β2 and β4 mRNA expression and open bars indicate the level of the remaining subunits. Example of the lack of current response induced by nicotine is shown under each histogram (bottom). (B) Histogram of the mean relative levels of subunit mRNA expression in nicotinesensitive (filled bars; n=12) and nicotine-insensitive (open bars; n=11) cells. * p⬍0.05.
sets of subunits were expressed at reduced levels. Thus, the major difference in expression patterns in nonresponsive cells compared to responsive cells is the apparent randomness of both the occurrence and expression level of these five subunits. Despite the large degree of variability between cells, the mean levels of mRNA for four of the five critical subunits are significantly lowered in non-functional MHb cells (p⬍0.05; Fig. 4(B)). The cell-to-cell variability may explain why β2 subunit mRNA was not significantly different when the entire population of cells is considered (Fig. 4(B)),
even though it was clearly expressed at reduced levels in some cells (Fig. 4(A)). Interestingly, the expression patterns and levels of α6, α7 and β3 subunits were variable in all cells irrespective of function (Fig. 4(B)). We have no reason to think that the reduced levels and less common detection of these latter three subunit mRNAs arose from differences in the ability of their primer pairs to induce amplification because in some cells we observe high levels of these subunits (see Fig. 3(A) and Fig. 4(A)[ii]). In addition, the overall similarity in maximal levels of actin and nAChR products implies that our RT–
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
PCR assay may be close to saturation, and therefore should be sensitive enough to detect relatively low levels of mRNA. 3.3. Choline acetyl transferase and MHb cells Cholinergic cells in the ventral two thirds of the MHb provide a major input to the interpeduncular nucleus and can be identified by choline acetyl transferase (ChAT) immunoreactivity (Woolf and Butcher, 1985; Contestabile et al., 1987; Semba and Fibiger, 1989), as shown here (Fig. 5(A), (B)), or ChAT mRNA (Oh et al., 1992). Thus, in order to confirm the origin of the nicotine sensitive and insensitive cells in the present study, ChAT mRNA was assayed a subset of cells using RT–PCR. The first six lanes in Fig. 5(C) show that as expected ChAT mRNA is absent in the α4β2 subunit expressing HEK cells and in “cell-free” controls, indicating that ChAT product is not an artifact of contamination and is confined to neurons. ChAT mRNA was, however, detected in the majority of presumed MHb cells (Fig. 5(C); last seven lanes). In total, all cells (6/6) sensitive to nicotine and the majority of non-responsive cells (5/6) expressed ChAT mRNA. These data are consistent with the suggestion that the cells used in this study were obtained from the MHb.
4. Discussion 4.1. MHb neurons express a subset of nAChR mRNAs Although the precise molecular composition of any known native nAChR is at present uncertain, the highly localized distributions of nAChR subunit mRNAs in the CNS in situ (e.g. Wada et al., 1989) imply that the subtypes of nAChR expressed in a given cell may be largely predetermined by which genes are transcribed (see Boyd, 1997). The results of the single cell RT–PCR experiments performed here have confirmed and extended our knowledge of the potential subunit composition of nAChRs in the MHb. As expected on the basis of subunit-selective agonist and α-conotoxin pharmacology (Mulle and Changeux, 1990; Quick et al., 1999), high levels of mRNAs for α3, β4 and β2 subunits are present in all MHb cells possessing functional nAChRs. These data fulfill a prediction resulting from our previous suggestion that α3 and β4 subunits are a prerequisite to all functional nAChRs on MHb cells, with the optional involvement of β2 subunits in some cases (Quick et al., 1999). Thus the uniformly strong distribution of α3, β4 (and slightly less so β2) subunit mRNAs in MHb autoradiographs in situ reflects a relatively homogenous population of MHb neurons with respect to these three subunits (Duvoisin et al., 1989; Wada et al., 1989; Winzer-Serhan and Leslie, 1997). The finding that α2
2599
subunit mRNA is never detected in MHb neurons, irrespective of responsiveness to nicotine, is in agreement with the absence of in situ staining for α2 mRNA in this region (Wada et al., 1989) and in addition serves as a good negative control. With respect to MHb, the cellular expression patterns of the other less well characterized subunits reveal that α6, α7 and β3 are sporadically detected (⬇40% cells). For α6 subunits this is somewhat expected based on the weak staining for α6 mRNA in MHb in situ (Le Novere et al., 1996). The restricted localization of mRNA for both α7 and β3 subunits to a subset of neurons, despite relatively uniform and strong expression of these subunits throughout the ventral portions of the MHb is more surprising (Deneris et al., 1989; Seguela et al., 1993). For α7, however, the lack of mRNA in most cells is in accordance with the insensitivity of MHb neurons to αBTX (Mulle and Changeux, 1990) while still consistent with a potential presynaptic role of α7 subunit containing nAChRs on MHb axon terminals in the IPN (Sastry et al., 1979; Clarke et al., 1986; McGehee et al., 1995). The final two subunits assayed in the present study, α4 and α5, were unexpectedly expressed in a high percentage (⬍95%) of cells examined; although mRNA for these two subunits is present in MHb (Wada et al., 1989; Le Novere et al., 1996), their relevance to functional nAChRs in this region is not known. Overall, these data are consistent with the suggestion that, because of uniform cellular mRNA expression, α3, α4, α5, β2 and β4 subunits could contribute to functional nAChRs in the majority of MHb neurons. Conversely, α2 nAChR subunits do not participate, and α6, α7 and β3 subunits are not absolutely necessary for function but may add an as yet unknown diversity to nAChR channels in some cells. 4.2. Is the level of mRNA expression important for nAChR function in MHb? Neuronal control of the expression of plasma membrane channels is likely to be a complex process that involves several levels of control including gene transcription and translation, multimeric subunit assembly, protein maturation, targeting and functional regulation of membrane channels. Because we find that the levels of certain subunit mRNAs, compared to actin mRNA, correlate with nAChR functionality it is suggested that the number of mRNA transcripts may have an important role in the regulation of surface channel expression on MHb cells (see Boyd, 1997). Overall, the same five subunits that we detected routinely in the majority of neurons, α3, α4, α5, β2 and β4, were consistently expressed at relatively high levels in MHb cells that possessed functional nAChRs. Conversely, although all members of this subset of subunit mRNAs were not consistently expressed at reduced amounts in all unresponsive cells (see Fig. 4), the mean level of expression of four of these
2600
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Fig. 5. Choline acetyltransferase mRNA and protein in MHb neurons. (A) and (B) ChAT immunoreactivity in the ventral portion of MHb slices. The same tissue slice is shown under phase contrast (A) and fluorescent illumination (B). LHb, lateral habenula; MHb, medial habenula; sm, stria medullaris. (C) Agarose gel showing ChAT mRNA product in MHb cells but not α4β2 HEK cells or cell-free recordings. + and ⫺ indicate sensitivity and insensitivity to nicotine, respectively. (D) Sample whole-cell current recordings in response to 10 µM nicotine in representative MHb cells as indicated in (C).
subunits, α3, α4, α5 and β4, was significantly lower than in responsive cells. It should be noted that although β2 subunit expression was not significantly different between nicotine-sensitive and insensitive cell populations, it was low (⬍0.7 relative to actin) in ⬇50% insensitive cells compared to a invariably high expression (⬎0.8) in 100% cells with functional nAChRs.
Based upon differences in the relative amounts of certain nAChR subunit mRNAs (α3, α4, α5, β2 and β4), we suggest that a critical level of gene transcription of one or more of these subunits may be required for production of fully functional plasma membrane nAChR channels on MHb neurons. Although the details of how such a mechanism would work are unknown to us, it is possible that a sufficient number of gene transcripts is
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
necessary for protein synthesis to overcome the effects of degradation, and thus provide an adequate supply of stable subunit (Kassner and Berg, 1997). It likely follows that if nAChR subunit mRNA level is a primary determinant of function, then the number of activatable nAChR channels on the cell surface should be related to the number of gene transcripts. Although we have not directly addressed this question here, innervation and target-specific cell-to-cell interactions have been shown to regulate the number of functional α3β4-like nAChRs on chick ganglion cells via a mechanism dependent on gene transcription (Levey et al., 1995; Devay et al., 1999). Of particular relevance is the finding that the amplitude of whole-cell currents in these cells can be correlated with the number of α3 and β4 transcripts (Levey et al., 1995), implying that in principle, the strong presence of these two subunit mRNAs in MHb neurons may drive functional expression. Indeed, it is interesting to note that in 10/11 unresponsive cells, either one or both of α3 or β4 was expressed at reduced levels. Because the α3 and β4 genes are localized together with the α5 gene in a cluster (Boulter et al., 1990) and may all participate in one subtype of nAChR in the autonomic nervous system (Vernallis et al., 1993), it is possible that their transcriptions are coordinated (Henderson et al., 1994). However, during development of chick ciliary ganglion synapses, a strong correlation was observed between changes in the amplitude of nicotine-induced currents and α3 and β4, but not α5 subunits (Levey et al., 1995). Thus, although the regulation of nicotinic gene transcription is not fully understood, there are likely to be multiple pathways through which independent and concerted transcription can be initiated in a neuron-specific manner (Boyd, 1996; McDonough and Deneris, 1997; Liu et al., 1999). Independence of transcription would be necessary to account for the differential expression of these three genes in unresponsive MHb neurons (see Fig. 4(A)). Although gene transcription is a necessary step towards function, it need not be the rate-limiting process in the regulation of nAChR channels. In the present study some MHb cells that did not respond functionally to nicotine contain relatively high levels of certain subunits that are known to form nAChR channels when expressed in heterologous expression systems (Luetje and Patrick, 1991). For example, in the cell shown in Fig. 4(A)[i], both α3 and β4 subunit mRNAs are expressed at relatively high levels but do not produce functional channels, at least not on cell body regions. These data imply that either simple heterodimer combinations of subunits, including α4β2 nAChRs, do not form channels in MHb neurons, either because an additional subunit mRNA is not well expressed or that other post-transcriptional mechanisms are important (Blumenthal et al., 1997).
2601
4.3. Subunit composition of nAChRs in MHb neurons The fact that the nicotinic sensitivity of neurons is correlated with the level of five species of mRNA implies that a pentameric nAChR in MHb may contain up to five different subunits (Role, 1992; Colquhoun and Patrick, 1997a; Jones et al., 1999). We have previously suggested that nAChRs in these cells possibly have either two α3–β4 subunit interfaces or both a single α3β4 and a single α3β2 subunit interface. If nAChRs are pentamers (Cooper et al., 1991), this leaves a single opening for an additional subunit. The RT–PCR data in the present work points towards either α5 or α4 subunits, since their respective relative mRNA levels also correlate with function. There is support for inclusion of both of these subunits with a basic α3β4(β2) subunitcontaining receptor (Conroy and Berg 1995, 1998). Variations on these themes could allow for the inclusion of the other less frequently expressed subunits such as β3 (Forsayeth and Kobrin, 1997), α6 (Gerzanich et al., 1996; Lena et al., 1999) and possibly α7 (Listerud et al., 1991; Yu and Role, 1998).
Acknowledgements This work was supported by United States Public Health Service Grant NS-31669 (R.A.J.L.) and the W.M. Keck Foundation #931360. We thank Hafeeza Anchrum for technical assistance with the immunohistochemistry and Alexis Turner for help with the RT–PCR assays. The α4β2 cells were a generous gift from J. Zhang and J.H. Steinbach.
References Boyd, R.T., 1996. Transcriptional regulation and cell specificity determinants of the rat nicotinic acetylcholine receptor α3 gene. Neuroscience Letters 208, 73–76. Boyd, R.T., 1997. The molecular biology of neuronal nicotinic acetylcholine receptors. Critical Reviews in Toxicology 27, 299–318. Boulter, J., O’Shea-Greenfield, A., Duvoisin, R.M., Connolly, J.G., Wada, E., Jensen, A., Gardner, P.D., Ballivet, M., Deneris, E.S., McKinnon, D., Heinemann, S., Patrick, J., 1990. α3, α5, and β4: three members of the rat neuronal nicotinic acetylcholine receptorrelated gene family form a gene cluster. Journal of Biological Chemistry 265, 4472–4482. Blumenthal, E.M., Conroy, W.G., Romano, S.J., Kassner, P.D., Berg, D.K., 1997. Detection of functional nicotinic receptors blocked by alpha-bungarotoxin on PC12 cells and dependence of their expression on post-translational events. Journal of Neuroscience 17, 6094–6104. Brussaard, A.B., Yang, X., Doyle, J.P., Huck, S., Role, L.W., 1994. Developmental regulation of multiple nicotinic AChR channel subtypes in embryonic chick habenula neurons: contributions of both the α2 and α4 subunit genes. Pflugers Archives 429, 27–43. Clarke, P.B., Hamill, G.S., Nadi, N.S., Jacobowitz, D.M., Pert, A., 1986. 3H-nicotine- and 125I-α-bungarotoxin-labeled nicotinic recep-
2602
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
tors in the interpeduncular nucleus of rats—II. Effects of habenular deafferentation. Journal of Comparative Neurology 251, 407–413. Colquhoun, L.M., Patrick, J.W., 1997a. Pharmacology of neuronal nicotinic acetylcholine receptor subtypes. Advances in Pharmacology 39, 191–220. Colquhoun, L.M., Patrick, J.W., 1997b. α3, β2, and β4 form heterotrimeric neuronal nicotinic acetylcholine receptors in Xenopus oocytes. Journal of Neurochemistry 69, 2355–2362. Cooper, E., Couturier, S., Ballivet, M., 1991. Pentameric structure and subunit stoichiometry of a neuronal nicotinic acetylcholine receptor. Nature 350, 235–238. Connolly, J.G., Gibb, A.J., Colquhoun, D., 1995. Heterogeneity of neuronal nicotinic acetylcholine receptors in thin slices of rat medial habenula. Journal of Physiology 484, 87–105. Conroy, W.G., Berg, D.K., 1995. Neurons can maintain multiple classes of nicotinic acetylcholine receptors distinguished by different subunit compositions. Journal of Biological Chemistry 270, 4424–4431. Conroy, W.G., Berg, D.K., 1998. Nicotinic receptor subtypes in the developing chick brain: appearance of a species containing the α4, β2, and α5 gene products. Molecular Pharmacology 53, 392–401. Contestabile, A., Villani, L., Fasolo, A., Franzoni, M.F., Gribaudo, L., Oktedalen, O., Fonnum, F., 1987. Topography of cholinergic and substance P pathways in the habenulo-interpeduncular system of the rat. An immunocytochemical and microchemical approach. Neuroscience 21, 253–270. Deneris, E.S., Boulter, J., Swanson, L.W., Patrick, J., Heinemann, S., 1989. Beta 3: a new member of nicotinic acetylcholine receptor gene family is expressed in brain. Journal of Biological Chemistry 264, 6268–6272. Devay, P., McGehee, D.S., Yu, C.R., Role, L.W., 1999. Target-specific control of nicotinic receptor expression at developing interneuronal synapses in chick. Nature Neuroscience 2, 528–534. Dineley-Miller, K., Patrick, J., 1992. Gene transcripts for the nicotinic acetylcholine receptor subunit, β4, are distributed in multiple areas of the rat central nervous system. Molecular Brain Research 16, 339–344. Duvoisin, R.M., Deneris, E.S., Patrick, J., Heinemann, S., 1989. The functional diversity of the neuronal nicotinic acetylcholine receptor is increased by a novel subunit β4. Neuron 3, 487–496. Elgoyhen, A.B., Johnson, D.S., Boulter, J., Vetter, D.E., Heinemann, S., 1994. α9: an acetylcholine receptor with novel pharmacological properties expressed in rat cochlear hair cells. Cell 79, 705–715. Forsayeth, J.R., Kobrin, E., 1997. Formation of oligomers containing the β3 and β4 subunits of the rat nicotinic receptor. Journal of Neuroscience 17, 1531–1538. Fucile, S., Barabino, B., Palma, E., Grassi, F., Limatola, C., Mileo, A.M., Alema, S., Ballivet, M., Eusebi, F., 1997. α5 subunit forms functional α3β4α5 nAChRs in transfected human cells. Neuroreport 8, 2433–2436. Gerzanich, V., Kuryatov, A., Anand, R., Lindstrom, J., 1996. “Orphan” alpha6 nicotinic AChR subunit can form a functional heteromeric acetylcholine receptor. Molecular Pharmacology 51, 320–327. Henderson, L.P., Gdovin, M.J., Liu, C., Gardner, P.D., Maue, R.A., 1994. Nerve growth factor increases nicotinic ACh receptor gene expression and current density in wild-type and protein kinase Adeficient PC12 cells. Journal of Neuroscience 14, 1153–1163. Jones, S., Sudweeks, S., Yakel, J.L., 1999. Nicotinic receptors in the brain: correlating physiology with function. Trends in Neurosciences 22, 555–561. Kassner, P.D., Berg, D.K., 1997. Differences in the fate of neuronal acetylcholine receptor protein expressed in neurons and stably transfected cells. Journal of Neurobiology 33, 968–982. Lena, C., de Kerchove D’Exaerde, A., Cordero-Erausquin, M., Le Novere, N., del Mar Arroyo-Jimenez, M., Changeux, J.P., 1999. Diversity and distribution of nicotinic acetylcholine receptors in the
locus ceruleus neurons. Proceedings of the National Academy of Sciences of the USA 96, 12126–12131. Le Novere, N., Zoli, M., Changeux, J.P., 1996. Neuronal nicotinic receptor α6 subunit mRNA is selectively concentrated in catecholaminergic nuclei of the rat brain. European Journal of Neuroscience 8, 2428–2439. Lester, R.A.J., Dani, J.A., 1995. Acetylcholine receptor desensitization induced by nicotine in rat medial labenula neurons. Journal of Neurophysiology 74, 195–206. Levey, M.S., Brumwell, C.L., Dryer, S.E., Jacob, M.H., 1995. Innervation and target tissue interactions differentially regulate acetylcholine receptor subunit mRNA levels in developing neurons in situ. Neuron 14, 153–162. Listerud, M., Brussaard, A.B., Devay, P., Colman, D.R., Role, L.W., 1991. Functional contribution of neuronal AChR subunits revealed by antisense oligonucleotides. Science 254, 1518–1521. Liu, Q., Melnikova, I.N., Hu, M., Gardner, P.D., 1999. Cell type-specific activation of neuronal nicotinic acetylcholine receptor subunit genes by Sox10. Journal of Neuroscience 19, 9747–9755. Luetje, C.W., Patrick, J.P., 1991. Both α- and β-subunits contribute to the agonist sensitivity of neuronal nicotinic acetylcholine receptors. Journal of Neuroscience 11, 837–845. McDonough, J., Deneris, E., 1997. β43⬘: An enhancer displaying neural-restricted activity is located in the 3⬘-untranslated exon of the rat nicotinic acetylcholine receptor β4 gene. Journal of Neuroscience 17, 2273–2283. McGehee, D.S., Heath, M.J., Gelber, S., Devay, P., Role, L.W., 1995. Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269, 1692–1696. Mulle, C., Changeux, J.P., 1990. A novel type of nicotinic receptor in the rat central nervous system characterized by patch-clamp techniques. Journal of Neuroscience 10, 169–175. Mulle, C., Choquet, D., Korn, H., Changeux, J.P., 1992. Calcium influx through nicotinic receptor in rat central neurons: its relevance to cellular regulation. Neuron 8, 135–143. Oh, J.D., Woolf, N.J., Roghani, A., Edwards, R.H., Butcher, L.L., 1992. Cholinergic neurons in the rat central nervous system demonstrated by in situ hybridization of choline acetyltransferase mRNA. Neuroscience 47, 807–822. Porter, J.T., Cauli, B., Tsuzuki, K., Lambolez, B., Rossier, J., Audinat, E., 1999. Selective excitation of subtypes of neocortical interneurons by nicotinic receptors. Journal of Neuroscience 19, 5228– 5235. Poth, K., Nutter, T.J., Cuevas, J., Parker, M.J., Adams, D.J., Luetje, C.W., 1997. Heterogeneity of nicotinic receptor class and subunit mRNA expression among individual parasympathetic neurons from rat intracardiac ganglia. Journal of Neuroscience 17, 586–596. Quick, M.W., Lester, H.A., 1994. Methods for expression of excitability proteins in Xenopus oocytes. In: Conn, P.M. (Ed.), Methods in Neurosciences. Academic Press, San Diego, pp. 261–279. Quick, M.W., Ceballos, R.M., Kasten, M., McIntosh, J.M., Lester, R.A.J., 1999. α3β4 subunit-containing nicotinic receptors dominate function in rat medial habenula neurons. Neuropharmacology 38, 769–783. Role, L.W., 1992. Diversity in primary structure and function of neuronal nicotinic acetylcholine receptor channels. Current Opinion in Neurobiology 2, 254–262. Sabey, K., Paradiso, K., Zhang, J., Steinbach, J.H., 1999. Ligand binding and activation of rat nicotinic α4β2 receptors stably expressed in HEK293 cells. Molecular Pharmacology 55, 58–66. Sastry, B.R., Zialkowski, S.E., Hansen, L.M., Kavanagh, J.P., Evoy, E.M., 1979. Acetylcholine release in interpeduncular nucleus following the stimulation of habenula. Brain Research 164, 334–337. Seguela, P., Wadiche, J., Dineley-Miller, K., Dani, J.A., Patrick, J.W., 1993. Molecular cloning, functional properties, and distribution of rat brain α7: a nicotinic cation channel highly permeable to calcium. Journal of Neuroscience 13, 596–604.
E.B. Sheffield et al. / Neuropharmacology 39 (2000) 2591–2603
Semba, K., Fibiger, H.C., 1989. Organization of central cholinergic systems. Progress in Brain Research 79, 37–63. Vernallis, A.B., Conroy, W.G., Berg, D.K., 1993. Neurons assemble acetylcholine receptors with as many as three kinds of subunits while maintaining subunit segregation among receptor subtypes. Neuron 10, 451–464. Vernino, S., Amador, M., Luetje, C.W., Patrick, J., Dani, J.A., 1992. Calcium modulation and high calcium permeability of neuronal nicotinic acetylcholine receptors. Neuron 8, 127–134. Wada, E., Wada, K., Boulter, J., Deneris, E., Heinemann, S., Patrick, J., Swanson, L.W., 1989. Distribution of alpha 2, alpha 3, alpha 4, and beta 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat. Journal of Comparative Neurology 284, 314–355. Wang, F., Gerzanich, V., Wells, G.B., Anand, R., Peng, X., Keyser, K., Lindstrom, J., 1996. Assembly of human neuronal nicotinic receptor α5 subunits with α3, β2, and β4 subunits. Journal of Bio-
2603
logical Chemistry 271, 17656–17665. Williams, B.M., Temburni, M.K., Levey, M.S., Bertrand, S., Bertrand, D., Jacob, M.H., 1998. The long internal loop of the alpha 3 subunit targets nAChRs to subdomains within individual synapses on neurons in vivo. Nature Neuroscience 1, 557–562. Winzer-Serhan, U.H., Leslie, F.M., 1997. Codistribution of nicotinic acetylcholine receptor subunit α3 and β4 mRNAs during rat brain development. Journal of Comparative Neurology 386, 540–554. Woolf, N.J., Butcher, L.L., 1985. Cholinergic systems in the rat brain—II. Projections to the interpeduncular nucleus. Brain Research Bulletin 14, 63–83. Yu, C.R., Role, L.W., 1998. Functional contribution of the alpha7 subunit to multiple subtypes of nicotinic receptors in embryonic chick sympathetic neurones. Journal of Physiology 509, 651–665. Zoli, M., Lena, C., Picciotto, M.R., Changeux, J.P., 1998. Identification of four classes of brain nicotinic receptors using β2 mutant mice. Journal of Neuroscience 18, 4461–4472.