Nitric oxide and cyclic GMP regulate early events in agrin signaling in skeletal muscle cells

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 9 3 5– 1 94 5

available at www.sciencedirect.com

www.elsevier.com/locate/yexcr

Research Article

Nitric oxide and cyclic GMP regulate early events in agrin signaling in skeletal muscle cells Earl W. Godfrey⁎, Russell C. Schwarte 1 Department of Pathology and Anatomy, Eastern Virginia Medical School, PO Box 1980, Norfolk, Virginia 23501, USA

A R T I C L E I N F O R M A T I O N

AB S TR AC T

Article Chronology:

Agrin released from motor nerve terminals directs differentiation of the vertebrate neuromuscular

Received 20 January 2010

junction (NMJ). Activity of nitric oxide synthase (NOS), guanylate cyclase (GC), and cyclic GMP-

Revised version received

dependent protein kinase (PKG) contributes to agrin signaling in embryonic frog and chick muscle

16 March 2010

cells. Stimulation of the NO/cyclic GMP (cGMP) pathway in embryos potentiates agrin's ability to

Accepted 16 March 2010

aggregate acetylcholine receptors (AChRs) at NMJs. Here we investigated the timing and mechanism

Available online 24 March 2010

of NO and cGMP action. Agrin increased NO levels in mouse C2C12 myotubes. NO donors potentiated agrin-induced AChR aggregation during the first 20 min of agrin treatment, but overnight treatment

Keywords:

with NO donors inhibited agrin activity. Adenoviruses encoding siRNAs against each of three NOS

Agrin

isoforms reduced agrin activity, indicating that these isoforms all contribute to agrin signaling.

Muscle cells

Inhibitors of NOS, GC, or PKG reduced agrin-induced AChR aggregation in mouse muscle cells by

Nitric oxide

∼50%. However, increased activation of the GTPase Rac1, an early step in agrin signaling, was

Cyclic GMP

dependent on NOS activity and was mimicked by NO donors and a cGMP analog. Our results indicate

Neuromuscular junction

that stimulation of the NO/cGMP pathway is important during the first few minutes of agrin signaling

Rac1

and is required for agrin-induced Rac1 activation, a key step leading to reorganization of the actin cytoskeleton and subsequent aggregation of AChRs on the surface of skeletal muscle cells. © 2010 Elsevier Inc. All rights reserved.

Introduction Neuronal agrin is released from motor nerve terminals, where it associates with the synaptic basal lamina and directs the formation of the neuromuscular junction (NMJ). Agrin binds to a cell surface receptor, LRP4, and activates muscle-specific kinase (MuSK), a tyrosine kinase in the muscle cell membrane, leading to the

aggregation of acetylcholine receptors (AChRs) and associated proteins to form the postsynaptic apparatus of the NMJ [1–4]. Although a number of intracellular molecules and pathways have been implicated in agrin signaling in muscle cells, the sequence of events and the relationship of these molecules and pathways are still only partially understood. Recent studies indicate that nitric oxide (NO) produced by nitric oxide synthase (NOS) contributes to the

⁎ Corresponding author. Department of Pathology and Anatomy, Eastern Virginia Medical School, PO Box 1980, Norfolk, VA 23501, USA. Fax: +1 757 446 5719. E-mail address: [email protected] (E.W. Godfrey). Abbreviations: NMJ, neuromuscular junction; NOS, nitric oxide synthase; GC, guanylate cyclase; PKG, cyclic GMP-dependent protein kinase; AChRs, acetylcholine receptors; 7-NI, 7-nitroindazole; ODQ, 1H-[1,2,4]oxadiazolo[4,3a]quinoxaline-1-one; SNAP, S-nitroso-N-acetylpenicillamine; Rp-8-pCPT-cGMP, cyclic GMP monophosphorothiate 8-(4-chlorophenylthio)- Rp-isomer triethylammonium salt; NOC-9, 6-(2-hydroxy-1-methyl2-nitrosohydrazino)-N-methyl-1-hexanamine; 8-Br-cGMP, 8-bromo cyclic GMP; FM, fusion medium; DAF-FM, diamino-fluorescein FM; PBS, phosphate-buffered saline; GST-PBD, fusion protein of glutathione-S-transferase and the p21-binding domain of PAK1; PAK1, p21-activated kinase 1; GEF, guanine nucleotide exchange factor 1 Present address: Department of Natural Sciences, Indiana Wesleyan University, 4201 South Washington Street, Marion, Indiana 46953, USA. 0014-4827/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2010.03.016

1936

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 9 35 – 1 94 5

agrin signaling cascade [5]. NO diffuses within cells and across membranes to mediate intra- and intercellular effects, often by activating soluble guanylate cyclase (GC) to produce cyclic GMP, which subsequently activates cGMP-dependent protein kinase (PKG [6]). Both NOS1 and NOS2 are localized to the postsynaptic apparatus of the mammalian neuromuscular junction (NMJ) [7,8], as are GC [9] and PKG [10,11]. Activity of NOS, GC, and PKG is required for both aggregation of AChRs at the developing neuromuscular junction (NMJ) of Xenopus embryos and agrin-induced AChR clustering in cultured Xenopus and chick embryo skeletal muscle cells [12–15]. Furthermore, stimulation of the NO/cGMP pathway in vivo potentiates agrin's ability to aggregate AChRs at NMJs in developing frog embryos. Specifically, overexpression of NOS, GC, or PKG or treatment of embryos with a cGMP analog significantly increased the area of AChR aggregates at the embryonic frog NMJ, more than doubling it in many cases [14,15]. Finally, agrin-independent induction of the NO/cGMP pathway using NO donors was sufficient to aggregate AChRs in muscle cells cultured from Xenopus embryos [14]. These studies clearly demonstrated the importance of the NO/ cGMP pathway in agrin signaling, both in vivo and in culture, and suggested that NO and cGMP are mediators of agrin signaling. In this study, we investigated the timing and mechanism of NO and cGMP involvement in agrin signaling, using mammalian (mouse) muscle cells. Agrin treatment resulted in increased NO levels in myotubes. Our results indicated that all three known isoforms of NOS contributed to agrin signaling in these cells, complementing our previous findings that each NOS isoform potentiates the effects of agrin when overexpressed in vivo [14]. Pretreatment or cotreatment of cells with NO donors prior to or during the first 20 min of agrin treatment potentiated agrin-induced AChR aggregation. However, overnight cotreatment of cells with agrin and NO donors almost completely abolished agrin activity. Interestingly, increases in activation of the GTPase Rac1 by agrin, which leads to reorganization of the actin cytoskeleton and has been considered necessary for AChR aggregation, was completely dependent on NOS activity. Together, our results indicate that the NO/cGMP pathway is important for agrin signaling of AChR aggregation, especially in the first few minutes of exposure of muscle cells to agrin, when NO is required for agrininduced activation of Rac1 and subsequent cytoskeletal rearrangement.

Materials and methods Chemicals The following inhibitors of NOS, GC, and PKG were used to test the dependence of agrin signaling in mouse skeletal myotubes on the activity of these enzymes: 7-nitroindazole (7-NI) and 1400 W (NOS inhibitors; EMD Biosciences); ODQ (GC inhibitor; Biomol); Rp-8-pCPT-cGMPs (PKG inhibitor; EMD Biosciences or Biomol). The NO donors used were SNAP (S-nitroso-N-acetylpenicillamine, Sigma) and NOC-9 (EMD Biosciences). The cGMP analog 8-bromo cyclic GMP (8-Br-cGMP; Axxora) was also used. All stock solutions were stored at − 20 °C and diluted immediately before use.

Culture of C2C12 muscle cells Mouse C2C12 muscle cells were plated onto 6-well tissue culture plates (Corning; coated with gelatin; Sigma) for AChR aggregation

assays. Cultures were incubated at 37 °C with 8% CO2 in growth medium (DMEM [Invitrogen], 20% (v/v) fetal bovine serum [Hyclone], 0.5% chick embryo extract, 100 μg/ml penicillin, 100 U/ml streptomycin, and 2.5 μg/ml fungizone [Invitrogen]). Three days after plating, when cells reached 80–100% confluence, growth medium was replaced with fusion medium (FM: DMEM, 5% horse serum [Invitrogen], 100 μg/ml penicillin, 100 U/ml streptomycin, 2.5 μg/ml fungizone). After 3 days, FM was replaced with serum-free DMEM overnight to accelerate fusion. The cultures were used the following day when ∼70–90% of the cells had fused into multinucleated myotubes. For AChR aggregation assays, serumfree DMEM was replaced with FM.

AChR aggregation assay C2C12 mouse myotubes were treated with NO donors or 8-BrcGMP (without agrin) for 5, 10, and 15 min, and cells were rinsed two times with FM before overnight incubation in FM. For inhibitor experiments, C2C12 mouse myotubes were also treated with NOS, GC, or PKG inhibitors for 2–3 h before and during overnight (16– 18 h) incubation with a dose of agrin (usually 5 ng/ml) that causes half-maximal AChR aggregation. AChRs were labeled with Alexa 594-α-bungarotoxin in medium 1 h at 37 °C, and cultures were rinsed with PBS and fixed 10 min in 95% ethanol at −20 °C. Coverslips were mounted with a glycerol-based medium [16]. AChR aggregates were visualized with a 40× objective on an Olympus fluorescence microscope, and aggregates ≥ 2 μm diameter were counted in 10–20 fields per well.

Bioimaging of NO with DAF-FM Agrin-induced changes in NO levels in C2C12 muscle cells were visualized using diaminofluorescein-FM diacetate (DAF-FM; Invitrogen), a fluorescent probe specific for NO [17–19]. Cells were cultured in 8-chamber wells on glass coverslips (Lab-Tek II Chamber #1.5 German coverglass, Nalge Nunc) coated with gelatin (Sigma) and were used 2–3 days after initiating differentiation with serum-free DMEM. Cells were loaded with DAF-FM (2.7 μM final concentration) in the dark for 15–30 min at 37 °C in serum-free DMEM, rinsed, and treated with 5 nM agrin in serum-free DMEM for 30 or 60 min. After overnight fixation in 4% paraformaldehyde, DAF-FM fluorescence was imaged in a minimum of ten fields from each culture using a Zeiss LSM 510 confocal microscope with the META attachment in the online fingerprinting configuration. The emission fingerprint used to measure the reaction product of NO and DAF-FM was obtained using a mixture of dye and the NO donor, NOC-9. Intensity of this fluorescence was selectively measured with Zeiss LSM Physiology software in at least 10 myotubes per field.

Rac activation assay C2C12 myotubes grown as stated above on uncoated 100 mm cell culture dishes were treated with bovine serum albumin (BSA, 25 μg/ml; control), agrin plus BSA (5 nM agrin, 25 μg/ml BSA; R&D Systems), agrin plus BSA plus inhibitors, or activators of the NO/ cGMP pathway. Cells were pretreated with inhibitors 1 h before addition of agrin and during agrin treatment. Following a 15- to 30-min treatment at 37 °C, cells were rinsed once with ice-cold PBS, 1 ml lysis buffer (50 mM Tris–HCl, pH 7.4, 10 mM MgCl2, 1%

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 9 3 5– 1 94 5

NP-40, 10% glycerol, 100 mM NaCl, 1 mM benzamidine, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 μg/ml aprotinin, 0.5% sodium deoxycholate, 1 mM EDTA, 1 mM EGTA) was added, and cells were kept on ice 5 min. The lysate was centrifuged 5 min at ∼ 21,000 ×g, 4 °C. Activated Rac in cell lysates was measured by a pulldown assay using a portion of PAK1 [20]. Duplicate aliquots of supernatants were incubated with GST-human p21-binding domain of PAK1 (GST-PBD) fusion protein bound to glutathione-coupled agarose beads (Sigma). Beads were washed three times with icecold lysis buffer, eluted with an equal volume of 2× SDS sample buffer [21] with 200 mM DTT, and analyzed by Western blotting with a mouse monoclonal antibody against Rac1 (Pierce, 1:1000) and goat anti-mouse secondary antibody (ImmunoPure; Pierce, 1:20,000) coupled to horseradish peroxidase. To reveal a ∼ 22-kDa Rac1 band by enhanced chemiluminescence, blots were incubated in SuperSignal West Femto substrate (Pierce) and exposed to X-ray film. Films were scanned into Adobe Photoshop; the relative amount of activated Rac was quantitated using Metamorph image analysis software (MDS Molecular Devices) and expressed as integrated intensity. Corresponding values for total Rac (input) were determined by Western blotting lysate samples and used to normalize values for activated Rac (pulldown). For quantitative comparison, the mean of duplicate values (normalized) for each condition is shown relative to control, which was assigned a value of one.

PAK1 activation assay The activation of p21-activated kinase 1 (PAK1), a downstream effector of Rac, was measured by Western blotting using an antibody against phospho-PAK (gift of Dr. Johnathan Chernoff, Fox Chase Cancer Center). Proteins in total cell lysates from Rac activation assays were separated by SDS-PAGE, transfered to Immun-Blot PVDF membrane (Bio-Rad), and labeled with rabbit-anti phospho-PAK (1:1000 dilution) followed by goat anti-rabbit IgG coupled to horseradish peroxidase (Cappel MP Biochemicals, 1:20,000 dilution). As a loading control, total PAK1 in the lysates was determined by Western blotting using rabbit anti-PAK1 antibody (Cell Signaling). Reactive PAK bands were detected as described above.

Primary muscle cell culture Primary mouse skeletal muscle cells were cultured from hindlimb muscles of 3- to 4-week-old mice [22–24] from the following strains (Jackson Laboratories): wild-type (B6129PF2/J; stock #100903), NOS1 null (B6;129 S4-Nos1tm1Plh/J; stock #00633), and NOS2 null (B6;129P2-Nos2tm1Lau/J; stock #002596). Briefly, muscles were dissected, rinsed in sterile saline, minced, and digested with 0.2% collagenase type 1A (Sigma) 60–90 min at 37 °C in DMEM (Dulbecco's modified Eagle's medium, Invitrogen). Medium (DMEM, 10% horse serum, 20% fetal bovine serum, 1% chick embryo extract, with antibiotics as for C2C12 cell medium) was added and tissue was passed through a Pasteur pipet to dissociate cells. The cell suspension was filtered through a 100-μm pore size cell strainer (BD Falcon); cells were counted and plated on Matrigel (BD Biosciences)-coated 6 well plates at a density of 1.5 × 105 cells per well. Culture medium was exchanged every 2 days; after fusion of myotubes began, medium with 10% horse serum was used. To prevent overgrowth of fibroblasts, cells were treated for 2 days with the mitotic inhibitor 5-fluoro-deoxyuridine (20 μg/ml)

1937

and uridine (50 μg/ml) when myotube fusion was nearly complete. Cultures were used for bioassays of agrin activity at 9–10 days.

Recombinant adenoviruses expressing siRNAs against NOS isoforms Recombinant, replication-defective adenoviruses expressing small interfering RNAs (siRNA) against coding sequences of mouse NOS1, NOS2, NOS3, and a scrambled control against mouse GAPDH sequence were created using the pSilencer-adeno CMV-1.0 kit (Ambion). The 21 nucleotide siRNA sequences against mouse NOS isoforms used were purchased from Ambion or obtained from the Dharmacon website (www.dharmacon.com). Sequences partially identical to other mouse cDNA sequences were eliminated from consideration. The siRNAs targeted these cDNA sequences: human GAPDH scrambled control sequence from the Ambion kit (sequence not given); mouse NOS1 nt 2444–2464 (TGCCAAGGCTATGTCCATGGA); mouse NOS2 nt 117–137 (GAGTAGCCTAGTCAACTGCAA); and mouse NOS3 nt 3096–3176 (AGACAGACTACAGCACATTGA). Oligonucleotides encoding both sense and antisense DNA strands, with appropriate restriction sites added, were purchased from Operon, hybridized, and subcloned into the shuttle vector provided with the kit. The resulting constructs were linearized, mixed with the linearized adenoviral backbone provided, and transfected into CRL-173 HEK cells. After several days, rounded cells detaching from the substrate were collected by centrifugation and lysed with 3 rounds of freezing and thawing. Cell lysates were used to infect larger cultures; virus was prepared and titers were determined according to Ambion kit protocols. Some virus preparations were purified using CsCl gradients. Cultures of C2C12 cells were infected overnight with adenovirus preparations (diluted 1:10 or 1:100; titers adjusted to same value) when cells were confluent but not yet fused. When cells began to fuse, medium without serum was added to cells overnight to accelerate fusion. Two to three days after addition of virus, when fusion into large myotubes was extensive, agrin (5 ng/ml, which induced half-maximal AChR aggregation) was added to medium overnight. The AChRs were labeled, cells were fixed with 4% paraformaldehyde in 0.18 M Na phosphate, pH 7.4; blocked in PBS, 0.2% gelatin, 0.2% triton X-100; and Escherichia coli β-galactosidase encoded by virus was labeled with a monoclonal antibody (Sigma, 1:500) and Alexa 488–goat anti-mouse IgG (Invitrogen, 1:300) to mark infected cells. Aggregates of AChRs ≥ 2 μm in diameter were counted only in myotubes with significant β-galactosidase immunofluorescence.

Results NO donors and a cGMP analog partially mimic the AChR-aggregating activity of agrin The ability of NOS inhibitors to block agrin activity in embryonic muscle cells indicated that NO is necessary for agrin-induced clustering of AChRs. We tested whether increased NO was sufficient for AChR aggregation by adding the NO donors NOC-9 or SNAP to the culture medium of C2C12 mouse myotubes. The cyclic GMP analog 8-Br-cGMP was also included to determine if it would aggregate AChRs in mammalian muscle cells, as it did in Xenopus embryo muscles [15]. An overnight treatment with SNAP significantly

1938

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 9 35 – 1 94 5

increased the number of AChR aggregates (Table 1), but the increase in the number of AChR clusters (to 2.6-fold control levels) was much smaller than that produced by agrin (23-fold control levels with a maximal dose). The clusters induced by NO donors and 8-Br-cGMP were often smaller than those induced by agrin (Fig. 1). Length of treatment was varied to indicate when NO might function during agrin signaling. Cells were treated with an NO donor or 8-Br-cGMP for various times, rinsed, incubated in culture medium for 16–19 h, and AChR aggregates were counted. A 20min treatment with SNAP (100 μM) or NOC-9 (10 μM), followed by overnight incubation without NO donor, increased the number of AChR aggregates per cell to 1.9- to 3.2-fold control levels (Table 1; Fig. 1C and D). However, the AChR clustering effect of NO donors in myotubes was much less robust than agrin's. A 5-min treatment with 8-Br-cGMP (250 μM) increased the number of AChR aggregates ≥2 μm in diameter by 2.6-fold (Table 1; Fig. 1B). Although many of the aggregates induced by NO donors or 8-BrcGMP were “microclusters” smaller than those induced by overnight agrin treatment (Fig. 1E) and thus were not counted, a 5- to 20-min exposure to NO or cGMP was sufficient to cause an increase in larger AChR aggregates as well, providing a possible clue to the timing of NO function during agrin signaling.

NO donors potentiate or inhibit agrin-induced AChR aggregation, depending on the timing of treatment To further investigate when NO functions during agrin signaling in C2C12 myotubes, we varied the timing of NO donor exposure relative to the onset of agrin treatment and determined the effect on agrin's ability to cluster AChRs 16–19 h later. A 10- to 20-min pretreatment or cotreatment with the NO donor SNAP potentiated

Table 1 – Nitric oxide donors induce AChR aggregation in C2C12 myotube cultures. Treatment Control Agrin (25 ng/ml) NOC-9 (10 μM) SNAP (100 μM) SNAP (100 μM) 8-Br-cGMP (250 μM) 8-Br-cGMP (250 μM) 8-Br-cGMP (250 μM)

Incubation

AChR Ratio Aggregates Exptl./Control

p vs. Control

– 23.5

– 2.1 × 10− 16

9 ± 2.3

1.9

0.05

20 min

15.3 ± 2.1

3.2

0.0035

Overnight

12.6 ± 1.8

2.6

0.01

5 min

12.4 ± 2.4

2.6

0.03

20 min

20 ± 2.5

4.2

0.0001

Overnight

11 ± 3.1

2.2

0.01

Overnight Overnight ∼15 min

4.7 ± 0.8 110 ± 4.1

Cultures of mouse C2C12 myotubes were treated with NO donors (NOC-9 or SNAP: S-nitroso-N-acetylpenicillamine) or with the cyclic GMP analog 8-Br-cGMP, then incubated overnight without these agents. AChR aggregates were labeled with fluorescent α-bungarotoxin; aggregates ≥ 2 μm in diameter were counted in twenty 40× microscopic fields. Data are shown as AChR aggregates per field. A 5- to 20-min treatment with NOC-9 (2 experiments), SNAP (2 experiments), and 8-Br-cGMP (4 experiments) significantly increased the number of AChR aggregates on the surface of the myotubes.

Fig. 1 – Treatment with an NO donor or a cGMP analog increases the formation of agrin-independent AChR aggregates. Representative images from the experiment presented in Table 1 in which C2C12 myotubes were treated with 8-Br-cGMP (B; 250 μM; 5 min), NOC-9 (C; 100 μM; 15 min), SNAP (D, 100 μM; 20 min), or agrin (E; 5 ng/ml, overnight), respectively. Each treatment resulted in a significant increase in the number of AChR clusters/cell compared with untreated (control) cells (A). Scale bar, 5 μm.

the overnight AChR aggregation response to a 20-min pulse of agrin by 50–100% (Table 2, Fig. 2). Our protocol reflected the previous finding that a 5-min pulse of agrin is sufficient to cause overnight aggregation of AChRs [25]. Similar results to the effect of SNAP on agrin's activity were seen with another NO donor, NOC-9 (data not shown). However, reversing the order of treatment (20-min agrin first, then 10-min SNAP) did not increase the effectiveness of agrin (Table 2, Expt. 2). When a 20-min treatment with agrin was followed by a 30-min treatment with SNAP, agrin signaling was inhibited 50% (Table 2, Expt. 1). Likewise, overnight cotreatment with SNAP and agrin dramatically reduced the number of agrin-induced AChR aggregates by about 90% (Fig. 2), even though SNAP alone produced a significant increase in the number of AChR clusters (Table 1, Fig. 1). Thus, NO potentiated agrin signaling during the first 20 min of agrin treatment but subsequently became inhibitory. Interestingly, 8-Br-cGMP pretreatment or cotreatment with agrin did not potentiate agrin-induced AChR clustering (Table 2, Expt. 1). Our results indicate that NO potentiates the activity of agrin in a timedependent manner and suggest that NO-induced AChR aggregation may utilize some of the same signaling pathways as agrin.

Agrin increases NO levels in differentiated myotubes To determine the effect of agrin on NO levels, we used the NOselective probe, DAF-FM, in C2C12 cell cultures that contained

1939

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 9 3 5– 1 94 5

Table 2 – Nitric oxide pretreatment potentiates the AChR aggregating activity of agrin. Expt. 1

2

Treatment

AChR Aggregates per Field

Net Aggregates per Field

Percentage of Aggregates vs. Agrin 20 min

p vs. Agrin 20 min

None a Agrin 20 min SNAP 10 min, then Agrin 20 min Agrin 20 min, then SNAP 30 min Agrin overnight Agrin + 8-Br-cGMP 20 min 8-Br-cGMP 10 min, then agrin 20 min None Agrin 20 min SNAP 10 min, then Agrin 20 min Agrin 20 min, then SNAP, 10 min Agrin plus SNAP 20 min

4.1 ± 0.7 34 ± 1.9 59 ± 3.1

0 30 55

0 100 180

1.5 × 10− 11 – 6.0 × 10− 8

21 ± 2.6

16

54

1.3 × 10− 4

102 ± 5.6 28 ± 2.9 33 ± 3.3

98 24 29

324 80 97

3.5 × 10− 11 0.027 0.60

33 ± 2.9 80 ± 5.2 127 ± 3.2

0 47 94

0 100 199

4.3 × 10− 12 – 9.1 × 10− 9

74 ± 3.4

41

87

106 ± 2.4

73

154

0.18 1.3 × 10− 9

C2C12 myotube cultures were treated with agrin (20 ng/ml), with the nitric oxide donor SNAP (1 mM) or with 8-Br-cGMP (250 μM) before, after, or concurrently with agrin treatment. After each 10- or 20-min treatment, medium was exchanged and cultures were incubated overnight without agrin or SNAP before AChR aggregates were labeled with fluorescent α-bungarotoxin. The average number of AChR aggregates (≥ 2.5 μm in diameter) in ten 40× fields is shown. Pretreatment with the NO donor potentiated agrin activity in three separate experiments. a The medium used for all groups of cells contained 1% DMSO, the same amount added in SNAP-treated cultures.

both myoblasts and myotubes. Changes in NO levels in individual myotubes were measured using the cell-permeable NO probe, DAF-FM. Cultures in which approximately 70% of the cells had fused into myotubes were loaded with DAF-FM, treated with agrin for 30–75 min, and fixed with 4% paraformaldehyde. Mature myotubes were imaged by confocal microscopy (Fig. 3A and B). The relative fluorescence intensity of DAF-FM was used as a measure of the NO level in each myotube. Agrin treatment increased DAF-FM fluorescence to 1.9- to 3.5-fold control values in four experiments (Fig. 3C). The agrin-induced increase in the intracellular NO level was completely blocked by the NOS inhibitor 7-nitroindazole (data not

Fig. 2 – NO can potentiate or inhibit agrin-induced AChR aggregation, depending on the timing of treatment. The NO donor SNAP (1 mM) significantly inhibited agrin-induced AChR clustering in mouse C2C12 myotubes in an overnight cotreatment. In contrast, cotreatment with 1 mM SNAP and agrin for 20 min significantly potentiated the effects of agrin (3 experiments). *p < 0.05 vs. agrin 16 h; **p < 0.05 vs. agrin 20 min. Scale bars = SEM.

shown). These results suggest that agrin increases NOS activity in mature muscle cells and show that the increase in NO is measurable within the first 30 min of agrin treatment.

Inhibitors of NOS, GC, and PKG reduce but do not eliminate agrin-induced AChR aggregation in mouse myotubes The results just described and previous studies suggest that the NOcGMP pathway may mediate agrin signaling. To test whether NO and cGMP are required for agrin-induced AChR aggregation in mammalian muscle cells, we preincubated C2C12 myotubes with inhibitors of NOS, GC, and PKG and added agrin 2–3 h later for overnight coincubation. In contrast to results of previous studies, in which the same inhibitors completely blocked agrin-induced AChR aggregation in muscle cells from frog or chick embryos [12,14,15], the inhibitors reduced agrin-induced AChR aggregation in mouse myotubes by only about 50% (Fig. 4, Table 3). This was the case even at very high concentrations of NOS inhibitors 1400 W and 7-NI (200 μM; Table 3), at which activity of all three NOS isoforms is blocked [26,27]. In one experiment, the NOS inhibitor 7-nitroindazole completely blocked AChR aggregation at very high doses (above 100 μM; Fig. 4B). This concentration is several times higher than the Ki for NOS3 and much higher than Kis for NOS1 and NOS2 [26,27], so this result may reflect non-specific effects of the inhibitor. These results indicate that the activity of NOS, GC, and PKG is important in agrin signaling in mammalian muscle cells, but activity of these enzymes may not be an absolute requirement for agrin-induced AChR aggregation in these cells, as it is in frog embryo and chick muscle cells.

Agrin-induced activation of Rac1 requires NOS activity; NO and cGMP activate Rac1 and PAK1 with a similar time course to activation by agrin The strong effect of NO donors during the early phases of agrin signaling raises the question of how NO interacts with other

1940

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 9 35 – 1 94 5

GC and PKG, is required for agrin-induced Rac activation, and that generation of NO and cGMP is important in early stages of agrin signaling, consistent with our results showing that early treatment with NO potentiates the AChR-aggregating activity of agrin.

All three isoforms of NOS contribute to agrin signaling

Fig. 3 – Agrin increases NO in mature C2C12 myotubes. (A, B) Representative images from an experiment presented in Table 3. Myotubes were loaded with the NO probe DAF-FM, treated with or without agrin for 75 min, fixed, and imaged with the confocal microscope. Agrin treatment (B) significantly increased NO-associated fluorescence compared with the control (A). Scale bar, 50 μm. (C) Quantitative comparison of mean fluorescence intensity of untreated control cells and cells treated 30 or 75 min with 5 nM agrin (4 experiments). Agrin treatment resulted in an 88% increase in NO-specific fluorescence compared with control. NO-associated fluorescence was blocked by the NOS inhibitor 7-nitroindazole (7-NI, 200 μm; data not shown). Relative NO levels are expressed as the mean fluorescence intensity of DAF-FM in imaged myotubes. Fluorescence intensity of agrin-treated myotubes was significantly greater than control (p < 0.05) in all four experiments. Error bars indicate SEM.

signaling molecules to potentiate AChR aggregation. An important early event in agrin signaling in mammalian muscle cells is the activation of the Rho GTPase, Rac1, leading to polymerization of actin microfilaments [28,29]. Both Rac1 and Rho GTPases are activated during agrin signaling [28], but Rac1 is activated first, about 5–10 min after agrin treatment begins [29,30]. Dominant negative Rac1 has been reported to completely block agrininduced AChR aggregation [28], and co-expression of constitutively active forms of both GTPases Rac1 and Rho mimics agrin activity by inducing AChR aggregates on C2C12 myotubes [29]. We tested the dependence of agrin-induced Rac activation on NOS activity. The NOS inhibitor 1400 W completely blocked Rac activation by agrin in C2C12 myotubes (Fig. 5A). A few minutes' exposure of the cells to an NO donor (NOC-9) or 8-Br-cGMP increased Rac activation 6- to 8-fold (Fig. 5B), similar to the effect of short-term treatment with agrin (Fig. 5A). Brief treatment with these agents also activated PAK1, an effector kinase of Rac1, to a similar extent as agrin (Fig. 5C). Together, these results indicate that activity of NOS, and possibly also of

Our results indicate that NOS activity is an important factor contributing to agrin's clustering of postsynaptic AChRs in mammalian myotubes. We therefore asked which isoform(s) of NOS contribute to agrin activity in these cells. First, we assayed the response to agrin in myotubes cultured from knockout mice lacking expression of either NOS1 or NOS2, both of which are localized postsynaptically at the NMJ. Agrin elicited about half the number of AChR aggregates per myotube from NOS1 or NOS2 null myotubes, compared to myotubes from wild-type control mice (Table 4), indicating that both NOS1 and NOS2 contribute to agrin signaling in myotubes. Second, we used recombinant adenoviruses to express siRNAs directed against NOS1, NOS2, or NOS3 in myotubes and tested the ability of virus-infected myotubes to respond to agrin. Infection with individual viruses expressing siRNA against NOS1, NOS2, or NOS3 reduced agrin-induced AChR aggregation by 44–79%, and co-infection with viruses expressing siRNAs against two different NOS isoforms inhibited aggregation by 60–74%, compared to 4–25% inhibition when a scrambled control siRNA was expressed by the virus (Fig. 6). Infection with a cocktail of viruses against all 3 isoforms inhibited agrin activity by 72% (data not shown), suggesting that NOS activity is very important, but that a small portion of agrin-induced AChR clustering may be independent of NOS activity in mammalian muscle cells.

Discussion Agrin signaling of AChR aggregation is regulated by intracellular NO Here we demonstrate for the first time that NO potentiates agrin signaling. For example, increasing intracellular NO with a 10- to 20-min pretreatment with an NO donor almost doubled the number of AChR aggregates induced by a subsequent pulse of agrin. Lowering endogenous levels of intracellular NO with NOS inhibitors reduced the number of AChR aggregates induced by agrin in mouse C2C12 myotubes by about 50%. Inhibiting NOS isoforms with virally encoded siRNAs reduced agrininduced AChR aggregation by as much as 70–80%. These results are similar to those previously described in Xenopus and chick embryo muscle cells [12–15], except that inhibitors of NOS, GC, or PKG incompletely blocked agrin-induced AChR aggregation in mouse myotubes. Our results confirm the previous conclusion that the level of intracellular NO in myotubes influences the magnitude of the AChR aggregation effect of agrin. Taken together, our results demonstrate that the influence of intracellular NO is extensive, ranging from almost complete elimination of agrin activity in some experiments using siRNAs against NOS isoforms to doubling the number of AChR aggregates formed in response to agrin when cells were pretreated with an NO donor.

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 9 3 5– 1 94 5

1941

Fig. 4 – Inhibitors of nitric oxide synthase, guanylate cyclase, and cGMP-dependent protein kinase reduce agrin-induced AChR aggregation in C2C12 myotubes by ∼50% but do not completely block agrin activity. Myotube cultures were pretreated with inhibitors for 1 h and agrin (5 ng/ml) was added overnight in the presence of inhibitors. After labeling AChRs with Alexa 594-α-bungarotoxin, the number of aggregates (≥2.5 μm diameter) per 40× field was counted in 10 fields in each of 2 wells. The number of aggregates in control cultures was subtracted from the mean values, and the resulting net AChR aggregates per field was plotted as a percent of control. Error bars indicate range of the average percentages in the 2 wells counted.

Table 3 – Inhibitors of nitric oxide synthase (NOS), guanylate cyclase (GC), and cyclic GMP-dependent protein kinase (PKG) partially block agrin-induced AChR aggregation in C2C12 mouse myotubes. Inhibitor None 7-Nitroindazole (7-NI, 200 μM) 1400 W (200 μM) 7-NI + 1400 W (200 μM each) ODQ (10− 4 M) Rp-8-pCPT-cGMPS (500 μM)

Net AChR Aggregates/Field

% Inhibition

p vs. Control

63 ± 4.1 32 ± 2.2

0 49

– 4.8 × 10− 9

34 ± 2.3

46

1.1 × 10− 6

32 ± 1.9

49

2.5 × 10− 7

31 ± 2.5 31 ± 1.5

51 50

2.2 × 10− 7 4.8 × 10− 8

Cultures of C2C12 myotubes in 24-well plates were pretreated 3 h with the indicated inhibitors. Agrin (5 ng/ml) was then added to the medium in the presence of inhibitors for an additional 16 h. After labeling AChRs with Alexa 594-α-bungarotoxin, the number of aggregates (≥2.5 μm diameter) per 40× field was counted in 10 fields in each of 2 wells. The background level of AChR aggregates in untreated cultures (7/field) was subtracted. The average number of agrin-induced AChR aggregates is shown.

NO functions within the first 20 min of agrin signaling The activity of NOS is required for AChR aggregation at the embryonic NMJ and for agrin-induced clustering of AChRs in cultured chick and frog embryo muscle cells [12,14]. We extend these findings by providing evidence for the timing of NO and cGMP function during agrin signaling. First, it has been previously shown that a 5-min pulse of agrin is sufficient to cause overnight aggregation of AChRs [25]. We demonstrate that a brief 5- to 20-min treatment with an NO donor or 8-Br-cGMP was likewise sufficient to initiate clustering in mouse C2C12 myotubes, although to a lesser extent. Second, the potentiating effect of NO on agrin-induced clustering of AChRs only occurred when intracellular NO levels were increased prior to or during the first 20 min of agrin treatment. After this period, NO failed to potentiate agrin activity and became inhibitory. Third, an agrininduced increase in intracellular NO was detected in myotubes, indicating that NOS activity is regulated by agrin. This increase in NO was observed within 30 min of adding agrin, which correlates with the timing (5–20 min) of NO donor treatments that initiate and potentiate AChR clustering, suggesting that NO functions during the first 20 min of agrin signaling. This idea is further substantiated by our finding that Rac1, which is activated during the first 15 min of agrin signaling, is a target of the NO/cGMP pathway.

1942

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 9 35 – 1 94 5

Fig. 5 – (A) A NOS inhibitor blocks agrin-induced Rac1 activation in C2C12 myotubes. Western blot analysis of Rac activation assay (pulldown assay) samples. Cells were pretreated (or not) 1 h with the NOS inhibitor 1400 W (200 μM), then incubated 27 min with agrin (5 nM) plus BSA or with BSA alone (Control). The effect on Rac1 activation was determined as described in Materials and methods. Treatment with 1400 W inhibited agrin-induced Rac activation 100% in the experiment shown (average inhibition 87%; 3 experiments). The amount of Rac in each band was quantitated using MetaMorph image analysis software and expressed as intensity and area. Resulting values for total Rac (input) were used to normalize corresponding values for activated Rac (pulldown). For quantitative comparison (bar graph), the mean of normalized duplicate values is shown relative to control, which was assigned a value of one. Error bars in panels A and B indicate range of duplicate values. (B) A brief treatment with an NO donor and a cGMP analog induced agrin-independent activation of Rac1. C2C12 mouse muscle cells were treated with the NO donor NOC-9 (100 μM) for 25 min (added at 0, 5, and 10 min) or the cGMP analog 8-Br-cGMP (250 μM) for 10 min in the absence of agrin. Treatment with 8-Br-cGMP activated Rac1 6-fold. Likewise, treatment with NOC-9 increased Rac1 activation 7.8-fold (11-fold average increase in 3 experiments). Error bars indicate the range of duplicate values. (C) NO and cGMP activate PAK. Cultures of C2C12 myotubes were treated with 8 Br-cGMP (250 μM), NOC-9 (100 μM), or agrin (5 ng/ml). Western blot analysis of phospho-PAK, a measure of PAK activation, revealed that both NO and cGMP activated PAK. Loading controls (Western blots for PAK1) showed no difference in PAK1 protein (not shown). The optical density of each band was analyzed with Metamorph image analysis software. The relative density of bands (antilog of optical density) increased 182-fold with agrin, 219-fold with 8-Br-cGMP, and 170-fold with NOC-9, compared to control.

NO and cGMP may mediate agrin signaling through activation of Rac GTPase Table 4 – Agrin-induced AChR aggregation reduced in myotubes from NOS1 or NOS2 null mice. Myotubes From Mice AChR Aggregates/Myotube p vs. Wild Type Wild type NOS1 null NOS2 null

6.1 ± 0.77 (100%) 3.5 ± 0.03 (57%) 3.5 ± 0.30 (57%)

– 0.01 0.006

Primary myotube cultures were made from muscle cells of postnatal days 24–26 (wild type, NOS2 null) or postnatal day 1 (NOS1 null) mice, as described in Materials and methods. Agrin (5 ng/ml) was added overnight at 13 days of culture. The numbers of AChR aggregates and myotubes were counted in ten 40× fields in each type of culture. Myotube density was similar in all cultures. Data shown are average AChR aggregates per myotube ± SEM in ten fields. This experiment was done once.

In C2C12 mouse myotubes, NOS activity was required for Rac1 activation, an important step in agrin signaling. Expression of constitutively active Rac1 in these cells caused formation of AChR microclusters [29] very similar to those induced by NO donors and 8Br-cGMP (Fig. 1). Activation of Rac GTPases leads to actin microfilament polymerization [31], which is required for agrin-induced AChR aggregation [32]. Thus, the role of NO in agrin signaling is likely to include promoting assembly of the actin cytoskeleton by regulating Rac1 activation. Since inhibition of NOS, GC, or PKG partially blocks agrin-induced AChR aggregation in mammalian myotubes, the NOcGMP pathway may be necessary for some, but not all, portions of the agrin signaling network in these cells. Further investigation of the regulatory proteins that are nitrosylated by NO or phosphorylated by PKG could provide understanding of the mechanisms through which NO and cGMP

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 9 3 5– 1 94 5

Fig. 6 – Infection of C2C12 myotubes with adenoviruses expressing siRNA against NOS1, NOS2, and NOS3 reduced agrin-induced AChR aggregation up to 80%. Cultures of C2C12 myoblasts were prepared as described in Materials and methods. When cells began to fuse, they were infected overnight with adenoviruses encoding siRNAs (prepared as described in Materials and methods and used at approximately the same titer). Medium containing virus was replaced, myoblasts fused to form myotubes, and agrin (5 ng/ml) was added to the medium overnight, beginning 48 h after virus infection. Cultures were then labeled with fluorescent α-bungarotoxin to label AChRs and with anti-β-galactosidase to identify cells infected with virus (see Materials and methods). AChR aggregates (≥2.5 μm length) per beta-galactosidase-positive myotube were counted in twenty 40× microscopic fields per condition. Data are expressed as the percent reduction in number of agrin-induced AChR aggregates per myotube. Cells treated with agrin but not infected with virus were used as controls. Error bars indicate SEM. *p vs. agrin control with no virus ≤ 0.005. **p vs. agrin control with no virus ≤4 × 10− 5. Scrambled control virus-treated samples (experiments 1 and 2 from left) were not significantly different from agrin control (p > 0.05).

regulate agrin signaling. One interesting candidate is the Racguanine nucleotide exchange factor (GEF) β-PIX, which has a PKG phosphorylation consensus site (Dr. Darren Browning, personal communication) and is both necessary and sufficient for recruitment of Rac1 to the plasma membrane at membrane ruffles and focal adhesions [33]. Agrin causes formation of filopodia in neurons and non-neuronal cells in a Rac- and Cdc42-dependent manner [34–36]. Nitrosylation or phosphorylation of Rac-GEFs and other proteins regulating Rac GTPases could mediate Rac1 activation during agrin signaling.

Is an increase in activated Rac necessary for agrin to aggregate AChRs? NOS inhibitors completely blocked the increase in activated Rac caused by agrin but reduced the AChR-aggregating activity of agrin by only 50–60%. Thus, agrin-induced AChR clustering in mouse muscle cells may be partially mediated by, but not require, an increase in Rac activation. Weston et al. [28] reported that

1943

transfection of C2C12 cells with a dominant negative form of Rac1 completely blocked agrin-induced AChR aggregation in myotubes, suggesting that an increased level of activated Rac1 was essential for agrin signaling in these cells. Nizhynska et al. [37] showed that PI3 kinase inhibitors blocked the increase in Rac activation caused by agrin in C2C12 cells and reduced the length but not the number of AChR aggregates produced by agrin. In both their study and ours, a basal level of activated Rac was detected in cells treated with agrin plus inhibitor and in untreated cells. This basal level of activated Rac appears to have been sufficient to allow agrin to aggregate AChRs. Together, these studies show that activated Rac plays an important role in agrin signaling. However, agrin-induced aggregation of AChRs in mammalian muscle cells still occurs to a more limited extent when NOS or PI3 kinase is inhibited, blocking the increase in Rac activation that is usually seen 5–20 min after agrin treatment begins.

Which isoforms of NOS participate in agrin signaling? Results of two independent sets of experiments indicated that multiple isoforms of NOS are involved in agrin signaling of AChR aggregation. First, myotube cultures made from muscles of NOS1 and NOS2 null mice responded to a sub-maximal dose of agrin with about half the number of AChR aggregates per cell as in cultures of wild-type myotubes (Table 4). Second, infecting C2C12 myotubes with replication-defective adenoviruses expressing siRNAs against mouse NOS1, NOS2, or NOS3, or combinations, resulted in 60–80% inhibition of agrin-induced AChR aggregation, compared to 4–25% inhibition with a virus expressing a scrambled control siRNA (Fig. 6). Together, these results showed that loss of NOS1 or NOS2, or a likely reduction in the expression of any of the three isoforms, inhibited the cells' response to agrin, indicating that all three isoforms of NOS contribute to agrin signaling. Both NOS1 and NOS2 have been localized to the postsynaptic apparatus at the NMJ [7,10,11], whereas NOS3 has not been localized within muscle fibers. It is likely that the intracellular level of NO is more important in agrin signaling than the isoforms that produce it. Since NO levels are regulated by agrin, it will be of interest to define the mechanism by which this occurs. Activity of NOS1 and NOS3 is regulated by Ca++ [38] and may be stimulated in myotubes by an agrin-dependent increase in intracellular Ca++. Changes in intracellular Ca++ and activation of L-type calcium channels are required for agrin-induced AChR aggregation [39–41]. NOS2, which is not regulated by intracellular Ca++, may promote agrin signaling by contributing to the basal level of NO in myotubes.

Importance of the NO-cGMP pathway in agrin signaling The importance of the NO/cGMP pathway in agrin signaling has been previously established in studies of skeletal muscle cells from both Xenopus and chick embryos [5,12–15]. Our results using mouse muscle cells shed new light on the function, regulation, and timing of NO in agrin signaling. Since agrin treatment increased intracellular NO levels in myotubes, NO donors potentiated agrin signaling during the first few minutes after addition of agrin, and activation of the Rac1 GTPase was dependent on NOS activity, we propose that NO and cGMP help mediate activation of Rac1, an early event in agrin signaling that regulates polymerization of actin microfilaments and subsequent aggregation of AChRs. Taken together, results from these studies indicate that NO and cGMP function as part of the agrin signaling

1944

E XP E RI ME N T AL C E L L R E SE A RC H 31 6 ( 20 1 0) 1 9 35 – 1 94 5

network leading to postsynaptic differentiation in skeletal muscle cells of mammals, birds, and amphibians. However, further experiments will be needed to define how NO and cGMP act within this network and which functions of NO and cGMP are regulated by agrin activation of MuSK.

Acknowledgments We thank Madhuri Parasa, Kathy Sharp, and Chris Balinger for excellent technical support; Dr. Pamela Harding (Eastern Virginia Medical School) and members of Dr. Lin Mei's laboratory (Medical College of Georgia) for advice; Dr. Neel Krishna (Eastern Virginia Medical School) for helping with adenovirus purification; and Dr. Seumas McCroskery (Laboratory of Cell Biology, NHLBI, National Institutes of Health) for the advice and for providing the protocol for culturing primary mouse skeletal muscle cells. This work was supported by grants from the Muscular Dystrophy Association, the Jeffress Memorial Trust, and Eastern Virginia Medical School to E.W.G.

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21] REFERENCES [22] [1] D.J. Glass, D.C. Bowen, T.N. Stitt, C. Radziejewski, J. Bruno, T.E. Ryan, D.R. Gies, S. Shah, K. Mattsson, S.J. Burden, P.S. DiStefano, D. M. Valenzuela, T.M. DeChiara, G.D. Yancopoulos, Agrin acts via a MuSK receptor complex, Cell 85 (1996) 513–523. [2] J.R. Sanes, J.W. Lichtman, Induction, assembly and maturation of a postsynaptic apparatus, Nat. Rev. Neurosci. 2 (2001) 791–805. [3] N. Kim, A.L. Stiegler, T.O. Cameron, P.T. Hallock, A.M. Gomez, J.H. Huang, S.R. Hubbard, M.L. Dustin, S.J. Burden, Lrp4 is a receptor for agrin and forms a complex with MuSK, Cell 135 (2008) 334–342. [4] B. Zhang, S. Luo, Q. Wang, T. Suzuki, W.C. Xiong, L. Mei, LRP4 serves as a co-receptor for agrin, Neuron 60 (2008) 285–297. [5] E.W. Godfrey, R.C. Schwarte, The role of nitric oxide signaling in the formation of the neuromuscular junction, J. Neurocytol. 32 (2003) 591–602. [6] T.G. Traylor, V.S. Sharma, Why NO? Biochemistry 31 (1992) 2847–2849. [7] C.C. Yang, R.B. Alvarez, W.K. Engel, C.K. Haun, V. Askanas, Immunolocalization of nitric oxide synthases at the postsynaptic domain of human and rat neuromuscular junctions—light and electron microscopic studies, Exp. Neurol. 148 (1997) 34–44. [8] N.R. Kramarcy, R. Sealock, Syntrophin isoforms at the neuromuscular junction: developmental time course and differential localization, Mol. Cell. Neurosci. 15 (2000) 262–274. [9] B.G. Schoser, S. Behrends, Soluble guanylyl cyclase is localized at the neuromuscular junction in human skeletal muscle, NeuroReport 12 (2001) 979–981. [10] D.S. Chao, F. Silvagno, H. Xia, T.L. Cornwell, T.M. Lincoln, D.S. Bredt, Nitric oxide synthase and cyclic GMP-dependent protein kinase concentrated at the neuromuscular endplate, Neuroscience 76 (1997) 665–672. [11] V. Askanas, W.K. Engel, R.B. Alvarez, Fourteen newly recognized proteins at the human neuromuscular junctions—and their nonjunctional accumulation in inclusion-body myositis, Ann. N. Y. Acad. Sci. 841 (1998) 28–56. [12] M.A. Jones, M.J. Werle, Nitric oxide is a downstream mediator of agrin-induced acetylcholine receptor aggregation, Mol. Cell. Neurosci. 16 (2000) 649–660. [13] M.A. Jones, M.J. Werle, Agrin-induced AChR aggregate formation requires cGMP and aggregate maturation requires activation of

[23] [24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

cGMP-dependent protein kinase, Mol. Cell. Neurosci. 25 (2004) 195–204. R.C. Schwarte, E.W. Godfrey, Nitric oxide synthase activity is required for postsynaptic differentiation of the embryonic neuromuscular junction, Dev. Biol. 273 (2004) 276–284. E.W. Godfrey, M. Longacher, H. Nieswender, R.C. Schwarte, D.D. Browning, Guanylate cyclase and cyclic GMP-dependent protein kinase regulate agrin signaling at the developing neuromuscular junction, Dev. Biol. 307 (2007) 195–201. K. Valnes, P. Brandtzaeg, Retardation of immunofluorescence fading during microscopy, J. Histochem. Cytochem. 33 (1985) 755–761. H. Kojima, N. Nakatsubo, K. Kikuchi, S. Kawahara, Y. Kirino, H. Nagoshi, Y. Hirata, T. Nagano, Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluoresceins, Anal. Chem. 70 (1998) 2446–2453. H. Kojima, K. Sakurai, K. Kikuchi, S. Kawahara, Y. Kirino, H. Nagoshi, Y. Hirata, T. Nagano, Development of a fluorescent indicator for nitric oxide based on the fluorescein chromophore, Chem. Pharm. Bull. (Tokyo) 46 (1998) 373–375. H. Kojima, Y. Urano, K. Kikuchi, T. Higuchi, Y. Hirata, T. Nagano, Fluorescent indicators for imaging nitric oxide production, Angew. Chem. Int. Ed. Engl. 38 (1999) 3209–3212. V. Benard, G.M. Bokoch, Assay of Cdc42, Rac and Rho GTPase activation by affinity methods, Methods Enzymol. 345 (2002) 349–359. U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. R.E. Allen, C.J. Temm-Grove, S.M. Sheehan, G. Rice, Skeletal muscle satellite cell cultures, Methods Cell Biol. 52 (1997) 155–176. T.A. Partridge, Tissue culture of skeletal muscle, Methods Mol. Biol. 75 (1997) 131–144. Z. Yablonka-Reuveni, M.A. Rudnicki, A.J. Rivera, M. Primig, J.E. Anderson, P. Natanson, The transition from proliferation to differentiation is delayed in satellite cells from mice lacking MyoD, Dev. Biol. 210 (1999) 440–455. P. Mittaud, A.A. Camilleri, R. Willmann, S. Erb-Vögtli, S.J. Burden, C. Fuhrer, A single pulse of agrin triggers a pathway that acts to cluster acetylcholine receptors, Mol. Cell. Biol. 24 (2004) 7841–7854. E.P. Garvey, J.A. Oplinger, E.S. Furfine, R.J. Kiff, F. Laszlo, B.J. Whittle, R.G. Knowles, 1400 W is a slow, tight binding, and highly selective inhibitor of inducible nitric-oxide synthase in vitro and in vivo, J. Biol. Chem. 272 (1997) 4959–4963. D.J. Wolff, B.J. Gribin, The inhibition of the constitutive and inducible nitric oxide synthase isoforms by indazole agents, Arch. Biochem. Biophys. 311 (1994) 300–306. C. Weston, B. Yee, E. Hod, J. Prives, Agrin-induced acetylcholine receptor clustering is mediated by the small guanosine triphosphatases Rac and Cdc42, J. Cell Biol. 150 (2000) 205–212. C. Weston, C. Gordon, G. Teressa, E. Hod, X.D. Ren, J. Prives, Cooperative regulation by Rac and Rho of agrin-induced acetylcholine receptor clustering in muscle cells, J. Biol. Chem. 278 (2003) 6450–6455. Z.G. Luo, H.S. Je, Q. Wang, F. Yang, G.C. Dobbins, Z.H. Yang, W.C. Xiong, B. Lu, L. Mei, Implication of geranylgeranyltransferase I in synapse formation, Neuron 40 (2003) 703–717. C.D. Nobes, A. Hall, Rho GTPases control polarity, protrusion, and adhesion during cell movement, J. Cell Biol. 144 (1999) 1235–1244. Z. Dai, X. Luo, H. Xie, H.B. Peng, The actin-driven movement and formation of acetylcholine receptor clusters, J. Cell Biol. 150 (2000) 1321–1334. J.P. ten Klooster, Z.M. Jaffer, J. Chernoff, P.L. Hordijk, Targeting and activation of Rac1 are mediated by the exchange factor beta-Pix, J. Cell Biol. 172 (2006) 759–769. M. Annies, G. Bittcher, R. Ramseger, J. Löschinger, A. Wöll, E. Porten, C. Abraham, M.A. Ruegg, S. Kröger, Clustering

E XP E RI ME N T AL C E L L R E S EA RC H 31 6 ( 20 1 0) 1 9 3 5– 1 94 5

transmembrane-agrin induces filopodia-like processes on axons and dendrites, Mol. Cell. Neurosci. 31 (2006) 515–524. [35] S. McCroskery, A. Chaudry, L. Lin, M.P. Daniels, Transmembrane agrin regulates filopodia in rat hippocampal neurons in culture, Mol. Cell. Neurosci. 33 (2006) 15–28. [36] R. Ramseger, R. White, S. Kröger, Transmembrane form agrin-induced process formation requires lipid rafts and the activation of Fyn and MAPK, J. Biol. Chem. 284 (2009) 7697–7705. [37] V. Nizhynska, R. Neumueller, R. Herbst, Phosphoinositide 3-kinase acts through RAC and Cdc42 during agrin-induced acetylcholine receptor clustering, Dev. Neurobiol. 67 (2007) 1047–1058.

1945

[38] W.K. Alderton, C.E. Cooper, R.G. Knowles, Nitric oxide synthases: structure, function and inhibition, Biochem. J. 357 (2001) 593–615. [39] L.J. Megeath, J.R. Fallon, Intracellular calcium regulates agrin-induced acetylcholine receptor clustering, J. Neurosci. 18 (1998) 672–678. [40] L.J. Megeath, M.T. Kirber, C. Hopf, W. Hoch, J.R. Fallon, Calcium-dependent maintenance of agrin-induced postsynaptic specializations, Neuroscience 122 (2003) 659–668. [41] R.B. Milholland, C. Dulla, H. Gordon, L-type calcium channels mediate acetylcholine receptor aggregation on cultured muscle, Dev. Neurobiol. 67 (2007) 987–998.