Nitric oxide is required for hydrogen gas-induced adventitious root formation in cucumber

Accepted Manuscript Title: Nitric oxide is required for hydrogen gas-induced adventitious root formation in cucumber Author: Yongchao Zhu Weibiao Liao Meng Wang Lijuan Niu Qingqing Xu Xin Jin PII: DOI: Reference:

S0176-1617(16)00063-8 http://dx.doi.org/doi:10.1016/j.jplph.2016.02.018 JPLPH 52323

To appear in: Received date: Revised date: Accepted date:

8-7-2015 16-2-2016 17-2-2016

Please cite this article as: Zhu Yongchao, Liao Weibiao, Wang Meng, Niu Lijuan, Xu Qingqing, Jin Xin.Nitric oxide is required for hydrogen gasinduced adventitious root formation in cucumber.Journal of Plant Physiology http://dx.doi.org/10.1016/j.jplph.2016.02.018 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Nitric oxide is required for hydrogen gas-induced adventitious root formation in cucumber Yongchao Zhu, Weibiao Liao* [email protected], Meng Wang, Lijuan Niu, Qingqing Xu, Xin Jin College of Horticulture, Gansu Agricultural University, Lanzhou 730070, PR China *

Corresponding author. Fax:+86 931 7632155.

1

ABSTRACT Hydrogen gas (H2) is involved in plant development and stress responses. Cucumber explants were used to study whether nitric oxide (NO) is involved in H2-induced adventitious root development. The results revealed that 50% and 100% hydrogen-rich water (HRW) apparently promoted the development of adventitious root in cucumber. While, the responses of HRW-induced adventitious rooting

were

blocked

by

a

specific

NO

scavenger

2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide potassium salt (cPTIO), NO synthase (NOS) enzyme inhibitor NG –nitro-L-arginine methylester hydrochloride (L-NAME) and nitrate reductase (NR) inhibitor NaN3. HRW also increased NO content and NOS and NR activity both in a dose- and time-dependent fashion. Moreover, molecular evidence showed that HRW up-regulated NR genes expression in explants. The results indicate the importance of NOS and NR enzymes, which might be responsible for NO production in explants during H2-induced root organogenesis. Additionally, peroxidase (POD) and indoleacetic acid oxidase (IAAO) activity was significantly decreased in the explants treated with HRW, while HRW treatment significantly increased polyphenol oxidase (PPO) activity. In addition, cPTIO, L-NAME and NaN3 inhibited the actions of HRW on the activity of these enzymes. Together, NO may be involved in H2-induced adventitious rooting, and NO may be acting downstream in plant H2 signaling cascade.

Keywords: Hydrogen-rich water; Nitric oxide (NO); NO synthase (NOS); Nitrate reductase (NR); NR genes; Enzyme

2

1. Introduction The past decade has seen the rapid development of research on plant nitric oxide (NO). NO, a ubiquitous signal molecule is involved in root organogenesis and growth. The involvement of NO in inducing root development was firstly observed in Zea mays (Gouvěa et al., 1997). Pagnussat et al. (2002) reported significant function of NO in the auxin-induced adventitious rooting. Subsequent reports showed that cyclic guanosine monophosphate and mitogen-activated protein kinase signaling cascades were involved in NO-mediated adventitious rooting (Pagnussat et al., 2004). In addition, NO was shown to participate in lateral root development and root hair formation (Lombardo et al., 2006). Hu et al., (2005) found an asymmetric accumulation of NO in soybean (Glycine max) primary root in response to gravistimulation. Our previous research found that hydrogen peroxide (H2O2), Ca2+/CaM and Ca2+-dependent protein kinase were involved in adventitious rooting induced by NO (Liao et al., 2009, 2012). Xuan et al. (2012) reported that NO operated downstream of adventitious root development promoted by hemin. The mechanism of NO-induced adventitious rooting has mainly been attributed to signal transduction. In plants, there are two major NO production pathways, one enzymatic and other non-enzymic. Nitrate reductase (NR) and NO synthase (NOS)-like enzyme are the NO-producing enzymes identified in plants (Desikan et al., 2002). It is known that a major source of NO in plants originates from nitrite regulated by NR. The expression of NR for NO generation in ABA-induced stomatal closure has been evidenced in Arabidopsis (Desikan et al., 2002). Moreover, NO accumulation in the root apex matched with the colocalization of NR genes in Arabidopsis (Stöhr et al., 2006). Trevisan et al., (2001) found that the nitrate-regulated expression of NR played an important role during the early perception and signaling of nitrate in maize roots. On the other hand, NOS-mediated NO generation has also been demonstrated during root organogenesis with a potential physiological role (Liao et al., 2009). Although no cloned NOS has been identified in plants until now, NOS activity has been detected in plant development and response to stress. Molecular hydrogen (H2) has aroused worldwide attention because of its selective reduction. It has been demonstrated that H2 acted as a therapeutic agent in biomedical fields and clinical and experimental models of many diseases (Hong et al., 2010). At the same time, the physiological roles of H2 and its mechanisms were studied in higher plants. Recent results revealed that H 2 could act as an important signal with multiple functions in plant responses to salt stress (Xie et al., 2012; Xu et al., 3

2013), cadmium toxicity (Cui et al., 2013), mercury toxicity (Cui et al., 2014), paraquat-induced oxidative stress (Jin et al., 2013) and aluminum toxicity (Chen et al., 2013). Up to date evidence found that H2 reestablished ROS homeostasis but exerted differential effects on anthocyanin synthesis in two varieties of radish sprouts under UV-A irradiation (Su et al., 2014). H2 was also shown to delay fruit ripening and senescence of kiwifruit by regulating antioxidant defence (Hu et al., 2014). Recent research has indicated that H2-induced cucumber adventitious rooting might be correlated with the heme oxygenase-1/carbon monoxide-mediated responses (Lin et al., 2014). In animals, H2 has been reported to induce inhibition of NO production through modulation of signal transduction and ameliorate inflammatory arthritis in mice (Itoh et al., 2011). Kashiwagi et al., (2014) found that H2 significantly suppressed NO-induced cytotoxicity in primary cells. Although, the biological roles of H2 and NO in plants have received worldwide interest due to their function as a signaling molecule. However, little reports have been published to support the interaction between H2 and NO in plants. The decreasing of NO production was involved in the alleviation of aluminum-induced inhibition of root elongation by H2 (Chen et al., 2013). Recently, there has also been some evidence that NO production may contribute to H2-promoted stomatal closure in Arabidopsis (Xie et al., 2014). Some enzymes such as peroxidase (POD), polyphenol oxidase (PPO), and indoleacetic acid oxidase (IAAO) are known to be intimately involved in indole-3-acetic acid (IAA) catabolism to modify the hormonal balance in plants, and they have different functions during root organogenesis (Smart et al., 2003). The increase of POD activity has been known to be a rooting signal during root primordium formation (Nordstrom et al., 1991). The importance of PPO in the induction of rooting is due to its effect on phenolic metabolism (Liao et al., 2010). It has been proposed that IAAO and POD had a similar effect on the occurrence of adventitious roots by changing IAA levels (Rama et al., 1996). Considering the fact that H2 may mediate adventitious root development (Lin et al., 2014), it would be noteworthy to identify how H2 induces downstream signaling cascades and regulates rooting. In this study, we try to determine whether NO is a second messengers involved in H2-induced adventitious rooting. The results may provide an important foundation for future signaling pathway studies of H2 in plants.

4

2. Materials and methods 2.1. Chemicals NG-nitro-L-arginine methyl ester hydrochloride (L-NAME, Sigma, USA) was used as NO synthase

(NOS)

inhibitor.

NaN3 was

used

as

the

nitrate

reductase

(NR)

inhibitor.

2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide potassium salt (cPTIO, Sigma, USA)

was

used

as

a

specific

NO-scavenger.

NO

fluorescent

probe

4-amino-5-methylamino-2’,7’-diaminofluorescein diacetate (DAF-FM DA) was used as NO specific fluorophore (San Diego, CA, USA). The solutions were prepared in complete darkness, and immediately diluted to the demanded concentrations. Unless stated otherwise, the remaining chemicals were of analytical grade which were obtained from Chinese companies.

2.2. Preparation of hydrogen-rich water (HRW) Purified H2 gas (99.99%, v/v) generated from a hydrogen gas generator (QL-300, Saikesaisi Hydrogen Energy Co., Ltd., China) was bubbled into 1 L distilled water at a rate of 300 mL min-1 for 30 min. Then, the corresponding hydrogen-rich water (HRW) was rapidly diluted to the required saturations [1%, 10% 50% and 100%, (v/v)]. H2 concentration in freshly prepared HRW was determined with a “Dissolved hydrogen portable meter” (Trustlex Co., Led, ENH-1000, Japan), and it remained at a relative constant level in 25℃ for at least for 12 h (Fig.1).

2.3. Plant material and growth conditions Selected identical seeds of cucumber (Cucumis sativus ‘Xinchun 4’; Gansu Academy of Agricultural Sciences, Lanzhou, China) were soaked in distilled water for 5 h. The germination of seeds occurred in an illuminating incubator with a 14-h photoperiod at 200 μmol m-2s-1 intensity and 25±1℃ for 5 days. The hypocotyls of 5-d-old cucumber seedlings were excised 2 cm below the cotyledonary node to remove primary roots. The explants were placed in petri dishes containing water or different indicated chemicals under the same conditions of temperature and photoperiod described above for another 5 days.

2.4. Explants treatments 5

Cucumber explants were placed in Petri dish containing 6 mL of test solutions and kept at 25±1℃. The test solutions were different concentration of HRW (0, 1%, 10%, 50% and 100%), 50 μM SNP, 10 μM IBA, 200 μM cPTIO, 30 μM L-NAME and 10 μM NaN3 alone or together with optimum concentration of HRW. The concentration of these chemicals was selected based on the results of a preliminary experiment.

2.5. Determination of the endogenous production of NO NO content from excised cucumber hypocotyls was determined using the Greiss reagent method (Liao et al., 2011). Hypocotyls (0.2 g) were frozen in liquid nitrogen, then ground in a mortar and pestle in 4 mL of 50 mM ice-cold acetic acid buffer, pH 3.6, containing 4% (w/v) zinc diacetate. The homogenates were centrifuged at 10,000×g for 15 min at 4℃, and the supernatants were collected. For each sample, 0.1 g charcoal (Shanghai Chemical Reagent Co. Ltd.) was added. After vortex mixing and filtration, the filtrate was leached and collected. A mixture of 1 mL of filtrate and 1 mL of Greiss reagent was incubated for 30 min at room temperature to concert nitrite into a purple azo-dye. The absorbance was then determined at 540 nm.

2.6. Imaging of endogenous NO by fluorescence microscope To image NO production in hypocotyls, hypocotyls of cucumber explants grown on plates were loaded with 20 μM 4-Amino-5-methylamino-2’7’-diaminofluorescein (DAF-FM) DA in 50 mM Tris-HCl, pH 7.5, for 2 h in Petri dishes in the dark. Then, hypocotyls were washed three times with distilled water to wash off excessive fluorophore. DAF-FM DA fluorescence was visualized using a fluorescence microscope (Leica 400×, Planapo, Wetzlar, Germany). Ten hypocotyls were analyzed for each condition, and the experiment was repeated three times.

2.7. NOS and NR activity determination NOS and NR activity from excised cucumber hypocotyls was analyzed using the NOS and NR determination Kit (Nanjing Jiancheng Biological Engineering Co., China) according to the

6

manufacturer’s instructions. The OD of NOS and NR was monitored at 540 nm and 530nm, respectively.

2.8. RNA extraction Total RNA was extracted from about 200 mg (fresh-weight) excised cucumber hypocotyl (5 mm) 24 h after treatment using TRIZOL reagent (Sangon, China) according to the manufacturer’s instructions.

2.9. Transcript level estimation with qRT-PCR Quantitative Real-time PCR (ABI stepone plus, California, The United States) (qRT-PCR) assays were used to determine the relative transcript level of each cDNA after 24 h of treatment. Gene-specific primers of NR gene for qRT-PCR were amplified using the following primers: For NR (accession number: JQ692875.1), forward 5ˊ - AAACCCTACATCCTTCACTCTCG -3ˊ and reverse 5ˊ -

GGTCCATTGCCATTTCTCTTCT

-3ˊ ,

5ˊ -CCCATCTATGAGGGTTACGCC-3ˊ

for

actin and

(DQ641117),

forward reverse

5ˊ -TGAGAGCATCAGTAAGGTCACGA-3ˊ . Each reaction (20 μL total volume) consisted of 10 μL iQ SYBR Gree Supermix, 1 μL of diluted cDNA and 0.1 μM of forward and reserve primers. PCR cycling conditions were as follows: 5 min at 95℃ followed by 40 cycles of 10 sec at 95℃ and 30 sec at 60 ℃ with data collection at the annealing step. After the 40 cycles, we included a dissociation/melting curve stage with 15 sec at 95℃, 60 sec at 60℃, and 15 sec at 95℃. The cucumber actin gene was used as an internal control. The calculation of relative gene expression was conducted as described by Livak and Schmittgen (Livak et al., 2001).

2.10. Enzyme Assays Cucumber explants were measured at 4 h after treatment to determine enzyme activity. For the enzyme extraction, 0.5 g fresh cucumber explants were homogenized in 0.05 M potassium phosphate buffer containing 1% polyvinylpyrrolidone (v/v). Enzyme activity was measured according to the method of Liao et al. (2010).

7

For peroxidase (POD) activity determination, 15 μL of the enzyme extract was added to 3 mL of substrate mixture containing 0.05 M potassium phosphate buffer, 50 μL of 0.02 M guaiacol, and 19 μL of 30% H2O2. The formation of the oxidized tetraguaiacol polymer was monitored at 470 nm for 3 min. The levels of enzyme activity were expressed as the optical density (OD) difference per minute per milligram protein. Polyphenol oxidase (PPO) activity was measured in 3 mL of substrate mixture containing 0.05 M potassium phosphate buffer, 100 μL of 25 mM pyrogallic acid by the addition of the 100 μL enzyme extract at 30℃ for 15 min. Then the OD was monitored at 420 nm. To determine indoleacetic acid oxidase (IAAO) activity, the reaction mixture [1 mL enzyme extracts, 5 mL of 0.05 M potassium phosphate buffer (pH 6.0), 1 mL of 1 mM MnCl2, 1 mL of 1 mM 2, 4-dichlorophenol, and 2 mL of 1mM IAA] was incubated at 30℃ for 30 min. The perchloric acid (2 mL) was then added and the destruction of IAA was determined by measuring the absorbance at 530 nm after 30 min. One unit of IAA oxidase activity was equivalent to an OD530 of 1.0 for 1 µg of protein in 30 min.

2.11 Statistical analysis Where indicated, results were expressed as mean values ± SE from at least three independent experiments. Statistical analysis was performed using SPSS Statistics 17.0 software. For statistical analysis, Duncan’s multiple test (P < 0.05) was chosen as appropriate.

3. Results 3.1. The effect of different concentrations of HRW on adventitious root development HRW at concentrations of 0, 1, 10, 50, and 100% was applied to cucumber explants. There was no significant difference in root number and root length among the control, 1% and 10% HRW treatments. The cucumber explants treated with 50% and 100% HRW produced more and longer adventitious roots than the control explants (Table 1 and Fig. 2), showing that HRW promoted adventitious rooting. Among the different concentrations, the maximum root number and root length were observed at 50% or 100% concentration of HRW (Table 1). Subsequently, 50% HRW was used to test the role of H2 on adventitious root development. 8

3.2. The involvement of NOS and NR in HRW-induced adventitious root development Cucumber explants treated with 50% HRW, 50 μM SNP or 10 μM IBA for 5 d showed significant increase in root number and length (Table 2). The application of cPTIO, L-NAME and NaN3 alone brought about a significant decrease of adventitious root number and length, in comparison with the control sample. Moreover, the increase in root number and length induced by HRW were inhibited by specific NO scavenger cPTIO, NOS inhibitor L-NAME, or NR inhibitor NaN3 (Table 2), indicating that exogenous NO generated from NOS and NR activity might be required for H2-induced adventitious root formation.

3.3. HRW dose-dependently induced NO content, NOS activity and NR activity Using NO content analysis, we found that HRW induced NO production in a dose-dependent manner in cucumber explants (Fig. 3A). NO contents firstly increased and then decreased with the increase of HRW concentrations, reaching the peak when HRW level was 50%. NO content in 50% HRW treatment increased by 45% compared with the control. The NO content has no significantly difference between 100% and 50% HRW treatments (Fig. 3A). To determine the synthesis pathways responsible for HRW-induced NO production, the effects of different concentrations of HRW on NOS and NR activity were tested in this study. HRW induced NOS and NR activity in a dose-dependent manner, with a maximal response at 50% HRW (Figs. 3B and 3C). Thus, NOS and NR activity might be related to NO production during adventitious rooting induced by H2.

3.4. HRW induced the increase of endogenous NO content, NOS and NR activity in a time-dependent manner There was a significant increase of NO content in explants treated with HRW from 6 to 24 h, followed by a gradual decrease until 36 h (Fig. 4A) The highest levels of NO were detected at 24 h after treatment, being about 2.31-fold at 0 h. The NO content in the control explants changed almost coordinately with that in HRW treatment. However, the NO levels were higher in HRW-treated explants than in the control explants (Fig. 4A).

9

To assess if NOS and NR are associated with the HRW response leading to adventitious rooting, a detailed study on the HRW-induced activity of these enzymes was undertaken. Fig 4 showed the time course of NOS and NR activity as affected by 50% HRW treatment. NOS activity increased rapidly after HRW treatment, and reached the highest levels at about 24 h, then showed a gradual decrease until 48h (Fig. 4B). HRW induced higher NOS activity in comparison with the control (Fig. 4B). As shown in Fig 4C, NR activity in HRW treatment increased from 6 to 24 h, reached its highest level at about 24 h, and then decreased up to about 36 h. However, NR levels in the control explants increased slightly from 6 to 24 h and then decreased sharply. The NR activity in the HRW-treated explants was higher than that in the control, especially at 24 h (Fig. 4C).

3.5. The NO production induced by HRW was blocked by cPTIO, L-NAME and NaN3 Fig 5A showed endogenous NO levels in cucumber explants treated with HRW, NO, cPTIO, L-NAME and NaN3 alone or in combination. Compared with the control, treatment with HRW triggered a significant increase in NO production. Compared with HRW treatment, HRW + cPTIO, HRW + L-NAME and HRW + NaN3 markedly reduced NO content by 40.04%, 40.07% and 40.72%, respectively. Moreover, cPTIO, L-NAME and NaN3 alone were able to cause a significant reduction of NO content compared with the control (Fig. 5A). It is suggested that NOS-like and NR may be involved in HRW-mediated NO production in cucumber explants. The presence of endogenous NO exposed to the permeable and specific NO-sensitive fluorophore DAF-FM was also detected DA. Similar to the above results, the HRW-treated explants displayed more fluorescence than the control explants. Treatments with cPTIO, L-NAME or NaN3 reduced HRW-induced NO generation (Fig. 5B). Together, the pharmacological data revealed that H2 induced NO synthesis, leading to adventitious root formation.

3.6. HRW-induced NOS and NR activity was blocked by L-NAME and NaN3 Compared with the control explants, approximately 42.2% and 29.8% higher NOS activity was detected in HRW- and SNP-treated explants (Fig. 6A). However, the NOS activity in HRW+L-NAME treatment decreased by 34.1% compared with HRW treatment. The treatment of NOS inhibitor L-NAME alone could also significantly decrease NOS activity in comparison with the control (Fig. 6A). When applied alone, HRW and SNP increased NR activity (Fig. 6B). However, when NaN3 was 10

administered to HRW-treated explants, it resulted in a significant reduction of NR activity. Moreover, NR activity in NaN3-treated explants was lower than that in the control explants (Fig.6B).

3.7. HRW increased the expression levels of NR genes To investigate transcriptional regulation for HRW-induced adventitious root formation, expression of cucumber NR genes was analyzed in HRW-treated cucumber explants. During the initial 24 h after treatment, expression of NR in the control samples was very low (Fig. 7). The NR transcripts levels in HRW treatment were significant higher than those in the control, which were 696.3% higher over the control. Combined with the above results, the data indicate that NR up-regulation may be involved in HRW-induced adventitious rooting in cucumber explants.

3.8. NO was involved in HRW-induced changes in the activities of POD, PPO and IAAO enzymes Here, the effects of NO synthesis inhibitors or scavenger on the activity of POD, PPO and IAAO in HRW-treated explants were examined. Compared with the control, SNP and HRW treatments significantly decreased POD activity. However, cPTIO, L-NAME and NaN3 significantly increased the POD activity in HRW-treated explants (Fig. 8A). Treatments with HRW and SNP resulted in enhancement of PPO activity (Fig. 8B). Similarly, the promotive effects of HRW on PPO activity were prevented by cPTIO, L-NAME and NaN3. Similar to the POD activity, the IAAO activity was lower in HRW and SNP treatments than in the control (Fig. 8C). However, the effects of HRW on IAAO activity could also be reversed by cPTIO, L-NAME and NaN3. The results suggest that endogenous NO is likely to be involved in H2-induced POD，PPO and IAAO activity during adventitious rooting.

4. Discussion H2 is considered as a new gas signaling modulator with multiple biological roles in animals due to its selectively reducing cytotoxic oxygen radicals (Itoh et al., 2011). Previous study has noted the importance of H2 as anti-inflammatory agent in medical application (Itoh et al., 2011). Only a few studies have focused on the question of H2 in plant development and stress responses (Xie et al., 2012; Xu et al., 2013; Cui et al., 2013; 2014; Jin et al., 2013; Chen et al., 2013). Recently, Lin et al., (2014) 11

reported that exogenous H2 regulated cucumber adventitious root development in a heme oxygenase-1/carbon monoxide-dependent manner. No data was found on the relationship between H2 and NO during adventitious root development. Thus, our results suggested the roles of NO in H2-induced adventitious rooting. The current study found that HRW could increase adventitious root number and length in a dose-dependent manner. The applications of 50% and 100% HRW had the maximal biological response (Table 1 and Fig. 2). The results are consistent with those of Lin et al., (2014), who showed that HRW regulated adventitious root development in cucumber. Some other biological gaseous molecules such as carbon monoxide, NO and hydrogen sulfide emerged as gasotransmitters have been shown to exhibit similar hormone-like effects during adventitious rooting (Xuan et al., 2008; Lin et al., 2012). Previous studies showed that H2 might induce the antioxidant system in rice (Xu et al., 2013) and alfalfa (Jin et al., 2013). Recently, H2 has been found to enhance cadmium tolerance in Chinese cabbage by reducing cadmium uptake and increasing antioxidant capacities (Wu et al., 2015). Thus, H2 is not only involved in plant stress responses but also required for plant development. The study of H2 effects on adventitious rooting would broaden our understanding of signaling transduction in plants. In the subsequent experiment, chemical scavenger and inhibitors were used to study whether NO was involved in H2-induced adventitious rooting. The results indicated that cPTIO, L-NAME and NaN3 significantly inhibited HRW-induced adventitious root development (Table 2). In view of the inhibitory roles of these chemicals in HRW-induced response, NO might be an essential signaling gasotransmitter in HRW-mediated adventitious root development. Thus, the results presented here suggested that endogenous NO produced by NOS-like and NR enzymes may play an important role in adventitious rooting induced by H2. In accordance with our results, previous studies also showed that NR-associated NO production was involved in H2-regulated stomatal movement (Xie et al., 2014). The crosstalk between H2 and NO has also been found in aluminum stress response in alfalfa (Chen et al., 2013) and amelioration of inflammatory arthritis in mice (Itoh et al., 2011). Here, this study was the first to prove that NO plays important roles in adventitious rooting induced by H2. Previous study showed that H2 reduced lipopolysaccharide/interferon-induced NO release in murine macrophase RAW164 cells (Itoh et al., 2011). Kashiwagi et al. (2014) reported that H2 significantly suppressed NO-induced cytotoxicity in primary cells, but did not affect NO levels in cells. These findings of relationship between H 2 and NO in animal model provide a potential 12

possibility that NO production may be affected by H2 in plant model. In the study, HRW was found to induce NO production in a dose-dependent fashion (Fig. 3A). Additionally, HRW induced higher increase of NO production than the control (Fig. 4A). Recent evidence demonstrated that H2 induced stomatal movement via NO production in Arabidopsis (Xie et al., 2014), which is consistent with our results. However, the decrease of NO generation induced by H2 in alfalfa has been demonstrated to alleviate aluminum-induced inhibition of root elongation (Chen et al., 2013). The results were in contrast with our observations, indicating the complexity of crosstalk between H2 and NO. It may because of the differences of psychological process and treatment methods in the two experiments. It is noted that the decrease of NO induced by H2 was found in stress conditions; while H2-induced NO production was in non-stress conditions. A further study with more focus on the relationship between H2 and NO is therefore recommended. Two enzymatic NO-generation pathways were proposed in plants, NR and NOS enzymes (Desikan et al., 2002). In this study, we observed the increase of NOS and NR activity in HRW treatments (Fig. 3B and 3C). However, L-NAME and NaN3 reversed the positive roles of HRW in these enzymes. L-NAME and NaN3 alone significantly reduced NOS and NR activity compared to the control (Fig. 6). Further study found that NO content in 50% HRW treatment was decreased by addition of L-NAME and NaN3 (Fig. 5). The results obtained here strongly suggest that NOS and NR might contribute to NO production during adventitious rooting induced by H2. Thus, both NOS and NR appears to be involved in H2-induced adventitious root development. Previous study has shown that NR action was responsible for lateral root primordia formation in Arabidopsis (Kolbert et al., 2008). It has been well documented that NOS might contribute to the root elongation in Hibiscus moscheutos (Tian et al., 2007). The involvement of both NOS and NR also was demonstrated in the gravitropic bending responses of soybean (Hu et al., 2005) and in the root hair formation in Arabidopsis (Lombardo et al., 2006). We have previously demonstrated that NO synthesis was required for the adventitious rooting in marigold and that both NOS and NR may contribute to the synthesis of the NO required (Liao et al., 2009). Chen et al. (2013) confirmed that a reduced NR-mediated NO production linked HRW and improved Al-induced inhibition of root elongation in alfalfa. Our results showed that H2-induced adventitious root development was reversed in the presence of NOS and NR inhibitors, indicating that NOS and NR might be responsible for NO production during H2-induced adventitious root organogenesis. Our genetic results showed that HRW 13

induced the expression of NR gene at 24 h (Fig. 7). Itoh et al. (2011) reported that H2 suppressed NO release from macrophage cells, which was due to the inhibition of inducible isoform of NOS (iNOS) expression. Recently, it has been reported that stomatal closure in nia1/2 and nia1/2/noa1 was largely insensitive to H2 treatment, suggesting that NR may be involved in H2-regulated stomatal movement in the ABA signaling cascade (Xie et al., 2014). The evidence from our study supports the possibility that, at least in our experimental conditions, NOS and NR-catalyzed NO production may be involved in H2-mediated adventitious root development. It is well known that there is a close relationship between the activity of POD, PPO and IAAO and the formation of adventitious root (Coban, 2007; Liao et al., 2010). In our experiment, HRW and NO donor SNP increased PPO activity and reduced POD and IAAO activity during adventitious rooting. However, NO scavenger and NO inhibitors suppressed this effect (Fig. 8). POD, PPO and IAAO were always used as biochemical markers for analysis rooting phase for correlation with tissue morphological changes (Liao et al., 2010). POD activity, a signal of rooting ability has been found to be involved in rooting (Halušková et al., 2010). An early increase in the POD activity accounted for the subsequent decrease in IAA content during root organogenesis (Li et al., 2009). Here, our results indicated that NO might be involved in H2-induced decrease of POD activity. It is known that PPO catalyzes the oxidation of phenolic substances which play a vital role in adventitious rooting. PPO activity was increased in cuttings of some grape (Vitis vinifera L.) varieties during the early states after planting (Coban, 2007). Additionally, PPO activity also increased dramatically during root formation in sweetpotato (Kim et al., 2015). Our previous results showed that NO increased PPO activity during adventitious rooting in ground-cover chrysanthemum (Dendranthema morifolium; Liao et al., 2010). In the study, H2 induced a decrease in PPO activity which is dependent on NOS and NR activity. In easy-to-root cultivar, lower IAAO activity was useful to facilitate rooting due to its lower ability to degrade IAA (Li et al., 2000). Thus it is suggested that H2 enhanced adventitious root development which involved NO production by repressing IAAO activity. Collectively, both NO and H2 may play crucial roles in induction of adventitious root. Here, we for the first time report that NO production through NOS and NR pathways might be involved in adventitious rooting induced by H2. Understanding the cell-signaling pathways involved in H2-induced root organogenesis may provide insights into the molecular mechanism of adventitious

14

rooting. Further detailed studies are needed to explore the complex network responsible for NO- and H2-induced plant growth and development.

Acknowledgments This research was supported by the National Natural Science Foundation of China (no. 31160398 and 31560563), the Post Doctoral Foundation of China (nos. 20100470887 and 2012T50828), the Key Project of Chinese Ministry of Education (no. 211182), the Research Fund for the Doctoral Program of Higher Education (no. 20116202120005), and the Natural Science Foundation of Gansu Province, China (no. 1308RJZA179). The authors are grateful to the editors and the anonymous reviewers for their valuable comments and help.

15

References Chen, M., Cui, W., Xie, Y., Zhang, C., Shen, W.B., 2013. Hydrogen-rich water alleviates aluminum-induced inhibition of root elongation in alfalfa via decreasing nitric oxide production. J. Hazard Mater. 267, 40-47. Coban, H., 2007. Determination of polyphenol oxidase activity during rooting in cuttings of some grape varieties (Vitis vinifera L). Asian J. Chem. 19, 4020-4024. Cui, W.T., Gao, C.Y., Fang, P., Lin, G.Q., Shen, W.B., 2013. Alleviation of cadmium toxicity in Medicago sativa by hydrogen-rich water. J. Hazard Mater. 260, 715-724. Cui, W.T., Fang, P., Zhu, K.K., Mao, Y., Gao, C.Y., Xie, Y.J., Wang, J., Shen, W.B., 2014. Hydrogen-rich water confers plant tolerance to mercury toxicity in alfalfa seedings. Ecotox. Environ. Safe. 105, 103-111. Desikan, R., Griffiths, R., Hancock, J., Neill, S.J., 2002. A new role for an old enzyme: nitrate reductase-mediated nitric oxide generation is required for abscisic acid-induced stomatal closure in Arabidopsis thaliana. P. Nati. Acad. Sci. 99, 16314-16318. Foissner, I., Wendehenne, D., Langebartels, C., Durner, J., 2000. In vivo imaging of an elicitor-induced nitric oxide burst in tobacco. Plant J. 23, 817-824. Gouvěa, C.M., Souza, C.P., Magalhaes, C.A., Martin, I.S., 1997. NO-releasing substances that induce growth elongation in maize root segments. Plant Growth Regul. 21, 183-187. Halušková, L., Valentovičová, K., Huttová, J., Mistrík, I., Tamás, L., 2010. Effect of heavy metals on root growth and peroxidase activity in barely root tip. Acta Physiol. Plant 32, 59-65. Hong, Y., Chen, S., Zhang, J.M., 2010. Hydrogen as a selective antioxidant: a review of clinical and experimental studies. J. Inter. Med. Res. 38, 1893-1903. Hu, H.L., Li, P.X., Wang, Y.N., Gu, R.X., 2014. Hydrogen-rich water delays postharvest ripening and senescence of kiwifruit. Food Chem. 156, 100-109. Hu, X., Neill, S.J., Tang, Z., Cai, W., 2005. Nitric oxide mediates gravitropic bending in soybean roots. Plant Physiol. 137, 663-670. Itoh, T., Hamada, N., Terazawa, R., Ito, M., Ohno, K., Ichihara, M., Nozawa, Y., Ito. M., 2011. Molecular hydrogen inhibits lipopolysaccharide/interferon γ-induced nitric oxide

16

production through modulation of signal transduction in macrophages. Biochem. Bioph. Res. Co. 411, 143-149. Jin, Q., Zhu, K., Cui, W., Xie, Y., Han, B., Shen, W.B., 2013. Hydrogen gas acts as a novel bioactive molecule in enhancing plant tolerance to paraquat-induced oxidative stress via the modulating of heme oxygenase-1 signaling system. Plant Cell Environ. 36, 956-969. Kashiwagi, T., Yan, H.X., Hamasaki, T., Kinjo, T., Nakamichi, N., Teruya, K., Kabayama, S., Shirahata, S., 2014. Electrochemically reduced water protects neural cells from oxidative damage. Oxid. Med. Cell Longev. doi: 10.1155/2014/869121. Kim, Y.H., Park, S.C., Ji, C.Y., Lee, J.J., Jeong, J.C., Lee, H.S., 2015. Kwak SS. Diverse antioxidant enzyme levels in different sweetpotato root types during storage root formation. Plant Growth Regul. 75(1), 155-164. Kolbert, Z., Barhta, B., Erdei, L., 2008. Exogenous auxin-induced NO synthesis is nitrate reductase-associated in Arabidopsis thaliana root primordial. J. Plant Physiol. 165, 967-975. Li, X.M., He, X.Y., Zhang, L.X., Chen, W., Chen, Q., 2009. Influence of elevated CO2 and O3 on IAA, IAA oxidase and peroxidase in the leaves of ginkgo tress. Biol. Plant 53, 339-342. Li, M., Huang, Z.L., Tan, S.M., Mao, X.Y., Lin, H.Q., Long, T., 2000. Comparison on the activities and isoenzymes of polyphenol oxidase and indoleacetic acid oxidase of difficult and easy to root eucalyptus species. Forest Res. 13, 493-500. Liao, W.B., Xiao, H.L., Zhang, M.L., 2009. Role and relationship of nitric oxide and hydrogen peroxide in adventitious root development of marigold. Acta Physiol. Plant 31,1279-1289. Liao, W.B., Xiao, H.L., Zhang, M.L., 2010. Effect of nitric oxide and hydrogen peroxide on adventitious root development from cuttings of ground-cover chrysanthemum and associated biochemical changes. J. Plant Growth Regul. 29, 338-348. Liao, W.B., Huang, G.B., Yu, J.H., Zhang, M.L., Shi, X.L., 2011. Nitric oxide and hydrogen peroxide are involved in indole-3-butyric acid-induced adventitious root development in marigold. J. Hortic. Sci. Biotech. 86, 159-165.

17

Liao, W.B., Zhang, M.L., Huang, G.B., Yu, J.H., 2012. Ca2+ and CaM are involved in NO-and H2O2-induced adventitious root development in marigold. J. Plant Growth Regul. 31, 253-264. Lin, Y.T., Li, M.Y., Cui, W.L., Lu, W., Shen, W.B., 2012. Hame oxygenase-1 is involved in hydrogen sulfide-induced cucumber adventitious root formation. J. Plant Growth Regul. 31, 519-528. Lin, Y.T., Zhang, W., Qi, F., Cui, W.T., Xie, Y.J., Shen, W.B., 2014. Hydrogen-rich water regulates cucumber adventitious root development in a heme oxygenase-1/carbon monoxide-dependent manner. J. Plant Physiol. 171, 1-8. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2T-△△ C method. Methods 25, 402-408. Lombardo, M.C., Graziano, M., Polacco, J.C., Lamattina, L., 2006. Nitric oxide functions as a positive regulator of root hair development. Plant Signal. Behav. 1, 28-33. Nordstrom, A.C., Eliasson, L., 1991. Levels of endogenous indole-3-acetic acid and indole-3-acetylaspartic acid during adventitious root formation in pea cuttings. Physiol. Plant. 825, 99-605. Pagnussat, G.C., Simontacchi, M., Puntarulo, S., Lamattina, L., 2002. Nitric oxide is required for root organogenesis. Plant Physiol. 129, 954-956. Pagnussat, C.G., Lanteri, M.L., Lombardo, M.C., Lamattina, L., 2004. Nitric oxide mediates the indole acetic acid induction activation of a mitogen-activated protein kinase cascade involved in adventitious root development. Plant Physiol.135, 279-286. Rama, D.S., Prasad, M.N.V., 1996. Ferulic acid mediated changes in oxidative enzymes of maize seedlings: Implication in growth. Biol. Plant 38, 387-395. Smart, D.R., Kocsis, L., Walker, M.A., Stockert, C., 2003. Dormant buds and adventitious root formation by Vitis and other woody plants. J. Plant Growth Regul. 21, 196-314. Stöhr, C., Stremlau, S., 2006. Formation and possible roles of nitric oxide in plant roots. J. Exp. Bot. 57, 463-470. Su, N.N., Wu, Q., Liu, Y.Y., Cai, J.T., Shen, W.B., Xia. K., Cui, J., 2014. Hydrogen-rich water reestablishes ROS homeostasis but exerts differential effects on anthocyanin

18

synthesis in two varieties of radish sprouts under UV-A irradiation. J. Agr. Food Chem. 62, 6454-6462. Tian, Q.Y., Sun, D.H., Zhao, M.G., Zhang, W.H., 2007. Inhibition of nitric oxide synthase (NOS) underlies aluminum-induced inhibition of root elongation in Hibiscus moscheutos. New Phytol. 174, 322-331. Trevisan, S., Manoli, A., Begheldo, M., Nonis, A., Enna, M., Vaccaro, S., Caporale, G., Ruperti, B., Quaggiotti, S., 2011. Transcriptome analysis reveals coordinated spatiotemporal regulation of haemoglobin and nitrate reductase in response to nitrate in maize roots. New Phytol. 192, 338-352. Wu, Q., Su, N.N., Cai, J.T., Shen, Z.G., Cui, J., 2015. Hydrogen-rich water enhances cadmium tolerance in Chinese cabbage by reducing cadmium uptake and increasing antioxidant capacities. J. Plant Physiol. 175, 174-182. Xie, Y.J., Mao, Y., Lai, D., Zhang, W., Shen, W.B., 2012. H2 enhances Arabidopisis salt tolerance by manipulating ZAT10/12-mediated antioxidant defence and controlling sodium exclusion. Plos One doi: 10. 1371. Xie, Y.J., Mao, Y., Zhang, W., Lai, D.W., Wang, Q.Y., Shen, W.B., 2014. Reactive oxygen species-dependent nitric oxide production contributes to hydrogen-promoted stomatal closure in Arabidopsis. Plant Physiol. 165, 759-773. Xu, S., Zhu, S.S., Jiang, Y.L., Wang, N., Wang, R., Shen, W.B., Yang, J., 2013. Hydrogen-rich water alleviates salt stress in rice during seed germination. Plant Soil 370, 47-57. Xuan, W., Zhu, F.Y., Xu, S., Huang, B.K., Ling, T.F, Qi, J.Y., Ye, M.B., Shen, W.B., 2008. The heme oxygenase/carbon monoxide system is involved in the auxin-induced cucumber adventitious rooting process. Plant Physiol. 148, 881-893. Xuan, W., Xu, S., Li, M.Y., Han, B., Zhang, B., Zhang, J., Lin, Y.T., Huang, J.J., Shen, W.B., Cui, J., 2012. Nitric oxide is involved in hemin-induced cucumber adventitious rooting process. J. Plant Physiol. 169, 1032-1039.

19

Figure captions Fig.1. The kinetics curve of H2 releasing in HRW. Purified H2 gas (99.99%, v/v) generated from a hydrogen gas generator (QL-300, Saikesaisi Hydrogen Energy Co., Ltd., China) was bubbled into 1 L distilled water at a rate of 300 mL min-1 for 30 min. Then, the corresponding hydrogen-rich water (HRW) was rapidly diluted to the required saturations [1%, 10%, 50%, and 100%, (v/v)]. H2 concentration in freshly prepared HRW was determined with a “Dissolved hydrogen portable meter” (Trustlex Co., Led, ENH-1000, Japan), and it remained at a relative constant level in 25℃ for at least for 12 h. Fig.2. Effects of different concentrations of HRW on the induction of adventitious root development in cucumber explants. The primary root system was removed from hypocotyls of 5-day-old germinated cucumber. Explants were incubated with distilled water or different concentrations of HRW as indicated for 5 days. Photographs were taken after 5 days of treatment Fig. 3. Effects of different concentrations of HRW on NO content, NOS and NR activity. The primary root system was removed from the hypocotyls of 5-d-old, germinated cucumber seedlings. NO levels (A) of hypocotyls were determined by Greiss reagent, NOS (B) and NR (C) activity from excised cucumber hypocotyls was analyzed using the NOS and NR determination Kit (Jiancheng, Nanjing, China) according to the manufacturer’s instructions in explants treatment with distilled water (control) or different concentration of HRW after the indicated times (24 h). Values (means ± SE) are the averages of three independent experiments (n=15 explants from each of three independent experiments) Fig.4. HRW induced a transient increase of endogenous NO, NOS and NR activity in cucumber explants. The primary root system was removed from the hypocotyls of 5-d-old, germinated cucumber seedlings. NO levels (A) of hypocotyls were determined by Greiss reagent in explants treatment with distilled water (control) or 50% HRW. NOS (B) and NR activity (C) of hypocotyls were determined using the NOS and NR determination Kit (Jiancheng, Nanjing, China) according to the manufacturer’s instructions in explants treatment with distilled water (control) or 50% HRW. Values (means ± SE) are the averages of three independent experiments (n=15 explants form each of three independent experiments). 20

Asterisks indicate that mean values are significantly different between the treatments of HRW and Control (P＜0.05) according to Duncan’s multiple test. Fig. 5. Effects of HRW，SNP，cPTIO, L-NAME and NaN3 on NO content in cucumber explants. Explants removed primary root were incubated with distilled water (a), 50% HRW (b), 50 μM SNP (c), 50% HRW+200 μM cPTIO (d), 50% HRW+30 μM L-NAME (e) and 50% HRW+15 μM NaN3 (f) for 24 h. Then, NO content (A) was determined by using Greiss reagent assay. Mean and SE values were calculated from at least three independent experiments (n=15). Bars denoted by the same letter did not differ significantly at P<0.05 according to Duncan’s multiple test. B, 4-amino-5-methylamino-2’,7’-diamino-fluorescein diacetate (DAF-FM DA) detected in a longitudinal section from the tip of the hypocotyls. Pictures were taken after 24 h of treatment. Bars=0.5 mm. Fig. 6. Effects of HRW，SNP， L-NAME and NaN3 on NOS and NR activity in cucumber explants. Explants removed primary root were incubated with 50% HRW, 50 μM SNP, 30 μM L-NAME and 15 μM NaN3 alone, or the combination for 24 h. Then NOS (A) and NR (B) activity from excised cucumber hypocotyls was analyzed using the NOS and NR determination Kit (Nanjing Biologic Engineering Co., China) according to the manufacturer’s instructions. Mean and SE values were calculated from at least three independent experiments (n=15). Bars denoted by the same letter did not differ significantly at P<0.05 according to Duncan’s multiple test. Fig.7. Effect of HRW on adventitious rooting, cucumber NR genes transcripts levels. Cucumber explants were incubated with distilled water (control) or 50% HRW for 24h. NR gene expression was analyzed by real-time RT-PCR. The expression levels of genes were presented as values relative to water treatment (Control). Asterisks indicate that mean values are significantly different between the treatments of HRW and Control (P＜0.05) according to Duncan’s multiple test. Fig.8. Effects of cPTIO, L-NAME and NaN3 on POD, PPO and IAAO activity in cucumber explants. Explants removed primary root were incubated with 50% HRW, 50 μM SNP, 200 μM cPTIO, 30 μM L-NAME and 15 μM NaN3 alone, or the combination. The activity of 21

POD (A), PPO (B) and IAAO (C) was determined at 24 h. Mean and SE values were calculated from at least three independent experiments (n=15). Bars denoted by the same letter did not differ significantly at P<0.05 according to Duncan’s multiple test.

22

Fig. 1

23

Fig. 2

24

Fig. 3

25

Fig. 4

26

Fig. 5

27

Fig. 6

28

Fig. 7

29

Fig. 8

30

Tables Table 1 Effect of different concentration of HRW on adventitious root formation in cucumber Treatments

Root number /explants

Adventitious root length /explant (cm)

0(CK) 1 10 50 100

3.67 ± 0.34 b 4.57 ± 0.33 b 5.55 ± 1.57 b 10.13 ± 1.61a 9.13 ± 2.22 a

0.77 ± 0.21 b 1.57 ± 0.19 b 2.13 ± 1.08 b 7.84 ± 2.23 a 6.78 ± 0.28 a

HRW were used at 0, 1, 10, 50 and 100%. The values (mean ± SE) are the average of three independent experiments. Values not sharing the same letters in a column within HRW treatment were significantly different by Duncan’s multiple-comparison test (P < 0.05)

31

Table 2 Effect of HRW, SNP, IBA, cPTIO, L-NAME and NaN3 on adventitious root development in cucumber explants Treatments

Root number /explant

Adventitious root length/ explant (cm)

CK HRW SNP IBA cPTIO L-NAME NaN3 HRW + cPTIO HRW + L-NAME HRW + NaN3

4.06 ± 0.53 b 8.58 ± 1.84 a 10.05 ± 1.48 a 9.38 ±1.37 a 0.73 ± 0.28 c 0.91 ± 0.19 c 0.72 ± 0.32 c 1.74 ± 0.86 c 1.04 ± 0.33 c 0.83 ± 0.29 c

1.02 ± 0.22 b 4.27 ± 0.78 a 5.11 ± 1.63 a 4.76 ±1.13 a 0.09 ± 0.05 c 0.21 ± 0.04 c 0.12 ± 0.07 c 0.39 ± 0.15 c 0.23 ± 0.06 c 0.19 ± 0.06 c

HRW, SNP, IBA, cPTIO, L-NAME and NaN3 were used at 50%, 50 μM SNP, 10 μM IBA, 200 μM cPTIO, 30 μM L-NAME or 10 μM NaN3, respectively. The values (mean ± SE) are the average of three independent experiments. Values not sharing the same letters in a column within HRW treatment were significantly different by Duncan’s multiple-comparison test (P < 0.05)

32