Nitric oxide synthase expression in single hippocampal neurons

MOLECULAR BRAIN RESEARCH ELSEVIER

MolecularBrain Research27 (1994) 183-188

Short communication

Nitric oxide synthase expression in single hippocampal neurons Lillian W. Chiang a Felix E. Schweizer b,1, Richard W. Tsien u, Howard Schulman a,, a Department of Neurobiology, Stanford University Medical Center, Stanford, CA 94305, USA b Department of Molecular and Cellular Physiology, Stanford University Medical Center, Stanford, CA 94305, USA

Accepted 2 August 1994

Abstract

The presence of nitric oxide synthase (NOS) in CA1 pyramidal cells of the rat hippocampus was demonstrated by single-cell PCR. NOS-specific primers were used to amplify mRNA isolated from single hippocampal neurons. The sequence of the major amplification-product obtained was identical to that of the constitutively expressed brain-isoform of NOS. These results confirm immunoeytoehemicaldata that NOS is present in CA1, and, therefore, nitric oxide could function as a retrograde messenger in long-term potentiation. Keywords: Nitric oxide synthase; Single-cell PCR; Hippocampus; Long-term potentiation; Retrograde messenger

Long-term potentiation (LTP) is a persistent use-dependent increase in synaptic strength that is thought to underlie memory formation (see reviews [1,25]). At the synapse between CA3 and CA1 hippocampal neurons, LTP is induced postsynaptically, but at least part of the expression seems to involve the presynaptic terminal. A requirement for postsynaptic to presynaptic (retrograde) communication could be satisfied by postsynaptically produced messenger molecules acting on the presynaptic terminal. Candidate molecules include arachidonic acid, platelet-activating factor, carbon monoxide, and nitric oxide [7,9,14,34,40,41,43]. In the rat hippocampus, experiments with NOS inhibitors [2,16,30,32] have supported a role for nitric oxide (NO) in retrograde communication. However, until recently, the absence of NOS detection in postsynaptic CA1 pyramidal cells argued against NO as the retrograde messenger. While in situ and single-cell expression studies have failed to detect NOS mRNA [3,24], histochemical and immunocytochemical studies provided conflicting reports with older studies failing

* Corresponding author. Department of Neurobioiogy,Fairchild Building, Stanford University,Stanford,CA 94305-5401, USA. Fax: (1) (415) 725-3958. 1Present address: Department of Neurobiology,Duke University Medical Center, Durham, NC 27710, USA. 0169-328x/94/$07.00 © 1994 Elsevier ScienceB.V. All rights reserved SSD! 0169-328X(94)00178-2

to detect NOS [3,5,31,35,37] and more recent reports finding positive evidence [10,11,39]. To investigate further the localization of NOS to CA1 pyramidal neurons and to determine the identity of the specific isoform(s), we examined the expression of NOS mRNA in isolated hippocampal neurons in culture and in CA1 neurons acutely dissociated from adult rat brain. A single-cell PCR strategy was chosen for two reasons. First, the isolation of RNA from single cells reduces the complexity of the message pool, thereby facilitating the detection of relevant mRNA molecules. Second, single-cell PCR can establish the presence of a certain mRNA in a given cell type. Since interneurons [3,35,37,39] and glia [29,38] are known to contain NOS, detection of NOS in whole hippocampal extracts would not be conclusive with regard to its presence in CA1 pyramidal neurons. The whole-cell patch-clamp technique was used to gain access to the cytoplasm of isolated, primary hippocampal neurons in culture (prepared from 4-day-old rats as previously described [26], with efforts taken to remove dentate gyrus and subiculum, two regions known to contain high levels of NOS). Spontaneous postsynaptic currents and evoked whole-cell currents were recorded under voltage clamp using silanized micropipettes (pipette solution contained in mM: 100 KCI, 1 MgCI 2, 6 HEPES (pH 7.3), and 20/zg/ml yeast tRNA (Sigma); bath solution contained: 140 NaC1, 5

I ~4

l H: ( 'lmm,e ('t at.

~,lotcctdar Brain I?,e.~earch 2 7 ~ 1994) 1S3-1~¢,¥

were observed; Fig. 1B). Application ~)l dcpolarizing voltage steps from a holding potential of -5(} mV evoked voltage-dependent whole-cell currents (Fig. IC). Small depolarizations activate a fast, inward sodium current (blocked by tetrodotoxin, not shown) whereas depolarizations to more positive potentials reveal ~)1 outward current, most likely carried by potassium. "File

KCI, I CaCI 2, 1 MgCI 2, 5 glucose, and 5 HEPES (pH 7.3)). Fig. 1A shows a micrograph of a pyramidal neuron in culture. Such pyramidal neurons exhibited spontaneous excitatory postsynaptic currents due to the spontaneous release of glutamate from presynaptic terminals onto the voltage-clamped neuron (-7(1 mV holding potential; no inhibitory postsynaptic currents

C

B

~30

~-10-

-10-30-

-50 mV

~-

-~-1 nA

i0 m s t 2o J

pA

50 ms

Fig. 1. Scanning D I C / N o m a r s k i image (A) (bar = 12/zm), spontaneous events (B), and whole-cell currents (C) typical of pyramidal neurons in culture chosen for single-cell PCR. Whole-cell currents were not leak-subtracted.

L.W.. Chiang et al. / Molecular Brain Research 27 (1994) 183-188

morphology and electrophysiological properties of these cells are typical for hippoeampal pyramidal neurons in culture. After the cells had been held in whole-cell voltage-clamp from 5 to 20 min, the cellular content was aspirated for utilization in PCR. RNase-free recording conditions (RNase-free solutions, equipment, and gloves), silanized pipettes, and inclusion of tRNA in the electrode buffer were used to maximize the chances for recovery of nucleic acid. Each aspirated cytosol was expelled into a silanized, RNase-free microeentrifuge tube. First-strand eDNA synthesis was initiated by addition of 10/zl of a solution, containing 50 mM Tris. HCI (pH 8.3), 10 mM dithiothreitol, 3 mM MgC12, 75 mM KCI, 5 /~M random hexamer primer (New England Biolabs), 0.5 mM of each deoxynueleotide (Boehringer Mannheim), 2 U//~I RNase inhibitor (rRNasin ®, Promega), and 10 U//~I reverse transcriptase (Superscript T M II, Gibco BRL), and was incubated for 15 min at room temperature followed by 1 h at 37°C. The PCR strategy (Fig. 2A) involved nested primer sets chosen from a region of NOS message (coordinates 1717 to 2433 of the brain isoform, GenBank accession no. X59949) that is distinct from the cytochrome P-450 reductase-like carboxy-terminus but within a well conserved portion believed to be part of the catalytic domain of NOS [4,15,18,20,22,23,27,33,42]. Degenerate primers LWC1 (TACGGAATTCGGCCATCACNRTRTTCCC; N = A / G / C / T ; R = A / G ) and LWC4 (CTrGGATCCATCTCCTGGTGGAANACAGG) were designed to amplify across all the known sequences of NOS isoforms in the first PCR (total template from eDNA synthesis amplified for 30 cycles: 1 min at 94"C, 30 s at 55°C, and 1 min at 72°C; AmpliTaq TM, Perkin Elmer Cetus). One-tenth of the first PCR was amplified in a second, capillary PCR (35 cycles: < 1 s at 94°C, 5 s at 42°C, 15 s at 72°C; 1605 Air Thermo-Cycler, Idaho Technologies) with nested primer sets LWC1 and LWC3 (AT-I'AGGATCCGCAGCACGTCGAAGCGGCC), or with LWC2 (ATGAATTCGCCGCTrCGACGTGCTGCC) and LWC4, resuiting in NOS-specific 211-bp or 558-bp products, respectively (Fig. 2). Control cytosols treated with DNase I (2 U//~I; Boehringer Mannheim) prior to eDNA synthesis gave a NOS-specific PCR band, whereas those treated with RNase A (0.1 mg/ml; Sigma) did not (Fig. 2B), demonstrating that the PCR product was RNA-dependent and excluding the possibility that the signal originated from chromosomal DNA. Single-cell expression-profiling, as described by Eberwine et al. [13] was used to corroborate the neuronal origin of the NOS-specific PCR product, and to further characterize the mRNA population of single neurons. The entire mRNA population from a single neuron was amplified in situ (during whole-cell record-

185

A ~

[cyt P-45o

I

- - ~ NOS

m m ~ l m u

"',~.4 1st PCR:

2nd PCRs:

'," 1

733 3

211 bp 2

4 558 bp

B LWC1 + LWC3 I

LWC2 + LWCA I U)

I

I (n

| 558 bp

I

I

211 bp

Fig. 2. A: nested PCR stategy. Approximate positions of primers LWC1, LWC2, LWC3, and LWC4 are indicated by arrows. Dashed lines at the end of NOS represent the variable lengths of different isoforms. The predicted sizes for PCR products LWC1 + LWC3 (211 bp) and LWC2+ LWC4 (558 bp) would be the same for all NOS isoforms. B: ethidium bromide-stained agarose gel showing single-cell PCR products from individual cultured neurons H20, H24, H25, and H39. All samples were first amplified with LWC1 and LWC4. In the second PCR, the samples were amplified with LWC1 + LWC3 or with LWC2+LWC4 as indicated. Control single-neurons were treated with DNase or RNase prior to first-strand eDNA synthesis. Included for reference are the amplification products of the fulllength eDNA clone of the brain-isoform of NOS (brain NOS), and pBR322 DNA restricted with HpaII (M).

ing) and labeled in vitro as previously described [12,13,24,36]. The labeled RNA was hybridized to slot blots (Minifold ® II, Schleicher & Schuell) loaded with eDNA clones for brain NOS, a-Ca2÷/calmodulin-de pendent protein kinase, neurofilament protein, NMDA receptor RI, glial fibrillary acidic protein (GFAP), and immediate early gene los. Single neurons expressed the neuronal gene products in addition to NOS, but did not express non-neuronal GFAP (Fig. 3). Under the same high-stringency wash conditions (55°C, 15 mM NaCI, 1.5 mM sodium citrate, 1% SDS), control RNA amplified from whole hippocampus additionally hybridized the GFAP eDNA clone. Although the slot

L lf.~ ('hum~: ~'I m' , '~loh'cu/ar Brain ICe.search 27 (1994) 183-188

blot assay is not quantitative, Fig. 3 demonstrates the enhancement of the NOS signal over background when R N A from a single neuron expressing a specific message is compared to R N A from whole tissue, in which the NOS signal has been diluted by RNA from other cells. Using single-cell PCR (n = 17) or expression profiling (n = 7), we demonstrated the presence of NOS in 22 out of 24 neurons harvested from primary hippocampal cultures. The two NOS-negative single-cell P C R samples might reflect a true absence of NOS m R N A in those neurons or might be due to inefficient aspiration of the cytoplasm. To investigate the presence of NOS m R N A in adult hippocampal neurons, acutely-dissociated CA1 neurons were prepared from adult rats (5 weeks old, as previously described [6], taking care to isolate area CAI). Individual, pyramidal-like neurons were patched in the whole-cell configuration and processed for single-cell PCR as described above. NOS m R N A was detected in 12 out of 21 neurons (Fig. 4); 8 neurons were negative; one resulted in a P C R product of different size (see below). The cytosol of acutely dissociated neurons was more difficult to harvest than that of cultured neurons; the cells tended to be stiff and, in contrast to the cultured neurons, aspiration of the cytoplasm was not visually evident. This observation

H13 vector

HIP

~ ii~iii~ii~

NMDA-R1 NF-L FOS GFAP NOS

Fig. 3. Typical expression profiles obtained when total RNA was isolated from a single hippocampal neuron (H13) or the whole hippocampus (HIP). The RNA was labeled in vitro and hybridized to slot blots loaded with Bluescript vector (Stratagene), various rat cDNA clones: NMDA receptor RI (NMDA-R1; pN60 [28]), neurofilament protein (NF-L; p567c [19]), immediate early gene fos (Fos; pc-fos(rat)-I [8]), brain isoform of nitric oxide synthase (NOS; fulllength cDNA in E c o R l site of Bluescript; S.H. Snyder), and aCa-'~/calmodulin-dependent protein kinase (CamK; full-length eDNA in E c o R l site of Bluescript; H. Schulman), and mouse glial fibrillary acidic protein (GFAP; GI [21]). Each column represents a single hybridization experiment and exposure.

t/J

O 7

t~

t~

Z7 t er + ÷

!

Fig. 4. Ethidium bromide-stained agarose gel showing single-cell PCR products from acutely-dissociated adult neurons H66, H68, H70, and H72. The primers used were LWCI and LWC4 in the first PCR, and LWC1 and LWC3 in the second; markers and controls are as described for Fig. 2B.

might explain the lower number of NOS positive neurons in the acute preparation versus in culture. However, in both cases the percentage of NOS positive neurons is far too high to be due solely to the relatively rare interneurons. The NOS-specific PCR products from single cells were gel purified (GeneClean c', Bio 101 Inc.) and prepared for cycle sequencing (AmpliTaq ~"~ Cycle Sequencing Kit, Perkin Elmer Cetus). The sequence of the amplification products (211 and 558 bp) obtained from four primary-cultured neurons and five acutely dissociated neurons was identical to the previously cloned, brain isoform of NOS [4]. The different PCR product observed for one acutely dissociated neuron appears to have arisen from the endothelial isoform of NOS (sequence not shown). Hybridization of radiolabeled endothelial-specific primers to the single-celt PCR products from all of the acutely dissociated neurons harvested detected the endothelial isoform in one other neuron (not shown). Thus, the major NOS isoform detected was identical to, or a splice variant of, the brain enzyme. The m R N A for a second endothelial isoform could be present in a small subpopulation of hippocampal neurons, or present in all hippocampal neurons at a level at the threshold of our detection methods. In summary, by utilizing the very sensitive technique of single-cell PCR, we have demonstrated the presence of NOS m R N A in CA1 neurons. In the same cells, we also found evidence for other neuronal mRNAs, but not for non-neuronal ones. Our finding that the major isoform detected is identical to the constitutive brainisoform does not exclude the possibility that an additional isoform of NOS may be present as well. Indeed,

L.W. Chiang et al. ~Molecular Brain Research 27 (1994) 183-188

a recent transgenic mouse, deficient for the constitutive brain-isoform of NOS, still retains reduced, NOS enzyme activity in the hippocampus [17]. This activity could be due to the presence of the endothelial isoform which has also been detected in CA1 by antibody staining [10]. Our demonstration of the presence of mRNA for at least one NOS isoform confirms immunocytochemical data, and suggests the utilization of nitrinergic signaling by CA1 pyramidal neurons, perhaps in the context of LTP. The authors thank L.F. Eng, J.-P. Julien, S. Nakanishi, and S.H. Snyder for providing cDNA clones used for expression profiling, J.H. Eberwine for advice on single-cell molecular biology, T.A. Ryan for assistance with photomicrographs, H. Bito for critical reading of the manuscript, and L. Brocke for providing hippocampal RNA. L.W.C. was supported by an NIH Epilepsy Training Program (NS07280). This work was funded by an NIMH Silvio Conte Center for Neuroscience Research Grant (MH48108) awarded to H.S. and R.W.T. [1] Bliss, T.V. and Collingridge, G.L., A synaptic model of memory: Long-term potentiation in the hippocampus, Nature, 361 (1993) 31-39. [2] Bfhme, G.A., Bon, C., Stutzmann, J.-M., Doble, A. and Blanchard, J.-C., Possible involvement of nitric oxide in long-term potentiation, Eur. J. Pharmacol., 199 (1991) 379-381. [3] Bredt, D.S., Glatt, C.E., Hwang, P.M., Fotuni, M., Dawson, T.M. and Snyder, S.H., Nitric oxide synthase protein and mRNA are discretely localized in neuronal populations of the mammalian CNS together with NADPH diaphorase, Neuron, 7 (1991) 615-624. [4] Bredt, D.S., Hwang, P.M., Glatt, C.E., Lowenstein, C., Reed, R.R. and Snyder, S.H., Cloned and expressed nitric oxide synthase structurally resembles cytochrome P-450 reductase, Nature, 351 (1991) 714-718. [5] Bredt, D.S., Hwang, P.M. and Snyder, S.H., Localization of nitric oxide synthase indicating a neural role for nitric oxide, Nature, 347 (1990) 768-770. [6] Chad, J.E., Stanford, I., Wheal, H.V., Wiiliamson, R. and Woodhall, G., Dissociated neurons from adult rat hippocampus. In J. Chad and H. Wheal (Eds.), Cellular Neurobiology, Oxford University Press, New York, 1991, pp. 19-37. [7] Clark, G.D., Happel, L.T., Zorumski, C.F. and Bazan, N.G., Enhancement of hippocampal excitatory synaptic transmission by platelet-activating factor, Neuron, 9 (1992) 1211-6. [8] Curran, T., Gordon, M.B., Rubino, K.L. and Sambucetti, L.C., Isolation and characterization of the c-.fos(rat) cDNA and analysis of post-translational modification in vitro, Oncogene, 2 (1987) 79-84. [9] del Cerro, S., Arai, A. and Lynch, G., Inhibition of long-term potentiation by an antagonist of platelet-activating factor receptors, Behav. Neural Biol., 54 (1990) 213-7. [10] Dinerman, J.L., Dawson, T.M., Schell, M.J., Snowman, A. and Snyder, S.H., Endothelial nitric oxide sythase localized to hippocampal pyramidal cells: Implications for synaptic plasticity, Proc. Natl. Acad. Sci. USA, 91 (1994) 4214-4218. [11] Divac, I., Ramirez-Gonzalez, J.A., Ronn, L.C.B., Jahnsen, H. and Regidor, J., NADPH-diaphorase (NOS) is induced in pyramidal neurones of hippocampal slices, NeuroReport, 5 (1993) 325-328.

187

[12] Eberwine, J., Spencer, C., Miyashiro, K., Mackler, S. and Finnell, R., Complementary DNA synthesis in situ: Methods and applications. In R. Wu (Ed.), Methods In Enzymology, Vol. 216, Academic Press, San Diego, 1992, pp. 80-100. [13] Eberwine, J., Yeh, H., Miyashiro, K., Cao, Y., Nair, S., Finnel, R., Zettei, M. and Coleman, P., Analysis of gene expression in single live neurons, Proc. Natl. Acad. Sci. USA, 89 (1992) 30103014. [14] Garthwaite, J., Charles, S.L. and Chess-Williams, R., Endothelium-derived relaxing factor release on activation of NMDA receptors suggests role as intracellular messenger in the brain, Nature, 336 (1988) 385-388. [15] Geller, D.A., Lowenstein, C.J., Shapiro, R.A., Nussler, A.K., Silvio, M.D., Wang, S.C., Nakayama, D.K., Simmons, R.L., Snyder, S.H. and Billiar, T.R., Molecular cloning and expression of inducible nitric oxide synthase from human hepatocytes, Proc. Natl. Acad. Sci. USA, 90 (1993) 3491-3495. [16] Haley, J.E., Wilcox, G.L. and Chapman, P.F., The role of nitric oxide in hippocampal long-term potentiation, Neuron, 8 (1992) 211-216. [17] Huang, P.L., Dawson, T.M., Bredt, D.S., Snyder, S.H. and Fishman, M.C., Targeted disruption of the neuronal nitric oxide synthase gene, Cell, 75 (1993) 1273-1286. [18] Janssens, S.P., Shimouchi, A., Quertermous, T., Bioch, D.B. and BIoch, K.D., Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase, J. Biol. Chem., 267 (1992) 14519-14522. [19] Julien, J.-P., Ramachandran, K. and Grosveld, F., Cloning of a cDNA encoding the smallest neurofilament protein from the rat, Biochim. Biophys. Acta, 825 (1985) 398-404. [20] Lamas, S., Marsden, P.A., Li, G.K., Tempst, P. and Michel, T., Endothelial nitric oxide synthase" molecular cloning and characterization of a distinct constitutive enzyme isoform, Proc. Natl. Acad. Sci. USA, 89 (1992) 6348-6352. [21] Lewis, S.A., Balcarek, J.M., Krek, V., Shelanski, M. and Cowan, N.J., Sequence of a cDNA clone encoding mouse glial fibrillary acidic protein: structural conservation of intermediate filaments, Proc. Natl. Acad. Sci. USA, 81 (1984) 2743-2746. [22] Lowenstein, C.J., Glatt, C.S., Bredt, D.S. and Snyder, S.H., Cloned and expressed macrophage nitric oxide synthase contrasts with the brain enzyme, Proc. Natl. Acad. Sci. USA, 89 (1992) 6711-6715. [23] Lyons, C.R., Orloff, G.J. and Cunningham, J.M., Molecular cloning and functional expression of an inducible nitric oxide synthase from a murine macrophage cell line, J. Biol. Chem., 267 (1992) 6370-6374. [24] Mackler, S.A., Brooks, B.P. and Eberwine, J.H., Stimulus-induced coordinate changes in mRNA abundance in single postsynaptic hippocampal CA1 neurons, Neuron, 9 (1992) 539-548. [25] Madison, D.V., Malenka, R.C. and Nicoll, R.A., Mechanisms underlying long-term potentiation of synaptic transmission, Annu. Rev. Neurosci., 14 (1991) 379-397. [26] Malgaroli, A. and Tsien, R.W., Glutamate-induced long-term potentiation of the frequency of miniature synaptic currents in cultured hippocampal neurons, Nature, 357 (1992) 134-139. [27] Marsden, P.A., Schappert, K.T., Chen, H.S., Flowers, M., Sundell, C.L., Wilcox, J.N., Lamas, S. and Michel, T., Molecular cloning and characterization of human endothelial nitric oxide synthase, FEBS Lett., 307 (1992) 287-293. [28] Moriyoshi, K., Masu, M., Ishii, T., Shigemoto, R., Mizuno, N. and Nakanishi, S., Molecular cloning and characterization of the rat NMDA receptor, Nature, 354 (1991) 31-37. [29] Murphy, S., Simmons, M.L., AguUo, L., Garcia, A., Feinstein, D.L., Galea, E., Reis, D.J., Minc-Golomb, D. and Schwartz, J.P., Synthesis of nitric oxide in CNS glial cells, Trends Neurosci., 16 (1993) 323-8. [30] O'DeU, T.J., Hawkins, R.D., Kandel, E.R. and Arancio, O.,

18S

[31]

[32]

[33]

[34] [35]

[36]

1_.IV. ( 7tiang et at.., Moh!cular Brain Research 27 (1994) l,~3-188 Tests of the roles of two diffusible substances in long-term potentiation: evidence for nitric oxide as a possible early retrograde messenger, Proc. ,Natl. Acad. Sci. USA, 88 (19911 11285I t 289. Sehmidt, H.H.H.W., Gagne, G.D., Nakane, M.. Pollock, J.S., Miller, M.F. and Murad, F., Mapping of neural nitric oxide synthase in the rat suggests frequent co-localization with NADPH diaphorase but not with soluble guanylyl cyclase and novel paraneural functions for nitrinergic signal transduction, Z Histochem. Cytochem., 40 (1992) 1439-1456. Schuman, E.M. and Madison, D.V., A requirement tot the intercellular messenger nitric oxide in long-term potentiation, Science, 254 (1991) 1503-1506. Sessa, W.C., Harrison, J.K., Barber, C.M., Zeng, D., Durieux, M.E., D'Angelo, D.D., Lynch, K.R. and Peach, M.J., Molecular cloning and expression of a eDNA encoding endothelial cell nitric oxide synthase, J. Biol. Chem., 267 (1992) 15274-15276. Stevens, C.F. and Wang, Y., Reversal of long-term potentiation by inhibitors of haem oxygenase, Nature, 364 (1993) 147--149. Valtschanoff, J.G., Weinberg, R.J., Kharazia, V.N., Nakane, M. and Schmidt, H.H,H.W., Neurons in rat hippoeampus that synthesize nitric oxide, J. Comp. Neurol., 33l (1993) 111-121. Van Gelder, R.N., yon Zastrow, M.E., Yool, A., Dement, W.C., Barchas, J.D. and Eberwine, J.H., Amplified RNA synthesized from limited quantities of heterogeneous eDNA, Proc. NatL Acad. Sci. USA, 87 (1990) 1663-1667.

[37] Vincent, S.R. and Kimura, 1f.. ltistochemical mapping ot ni~1k oxide synthase in the rat brain, Neuroscience. 46 (1992) 755-784 [38] Wallace, M.N. and Fredens, K., Activated astrocytcs ol the mouse hippocampus contain high levels of NADPH-diaphorase. NeuroReport, 3 (1992) 953-6. [39] Wendland, B., Schweizer, F.E., Ryam T.A., Nakane. M,. Murad. F., Scheller, R.H. and Tsien. R.W., Existence of nitric oxide symhase in rat hippocampal pyramidal cells. Proc. Natl..4cad. Sci. USA, 91 (1994) 2151-2155. [40] Wieraszko, A., Li, G., Kornecki. E., Hogan, M.V. and Ehrlich, Y.H., Long-term potentiation in the hippocampus induced by platelet-activating factor, Neuron, 10 (1993) 553 557. [41] Williams, J.H., Erringtom M.L., Lynch. M.A. and Bliss. TN.. Arachidonic acid induces a long-term activity-dependent enhancement of synaptic transmission in the hippocampus, Nature, 341 (1989) 739-42. [42] Xie, O.-W., Cho, H.J., Calaycay, J., Mumford, R.A., Swiderek, K.M.. Lee, T.D., Ding, A., Troso, T. and Nathan, C., Cloning and characterization of inducible nitric oxide synthase from mouse macrophages, Science, 256 (1992) 225-228. [43] Zhuo, M., Small, S.A., Kandel, E.R. and Hawkins, R.D., Nitric oxide and carbon monoxide produce activity-dependent longterm synaptic enhancement in hippocampus, Science, 260 (1993) 1946-195(I.