NK cell-based approach for screening novel functional immune genes

International Immunopharmacology 11 (2011) 274–279

Contents lists available at ScienceDirect

International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p

NK cell-based approach for screening novel functional immune genes Longyan Wu, Cai Zhang, Zhigang Tian, Jian Zhang ⁎ School of Pharmaceutical Sciences, Shandong University, Jinan 250012, China

a r t i c l e

i n f o

Article history: Received 26 July 2010 Received in revised form 22 October 2010 Accepted 2 December 2010 Available online 17 December 2010 Keywords: NK-92 cells NK cells Novel functional gene Innate immunity

a b s t r a c t The human genome project provides extensive opportunities for the discovery of novel functional immune genes. In order to find innate immune genes that might regulate the function of NK cells from a cDNA library, we used an NK cell line, NK-92, as a platform to screen candidate genes. After comparing with other gene transfer methods, electroporation was selected as the best gene transfection approach to deliver cDNA expression plasmids containing candidate genes into the NK-92 cells. When the transferred gene was stably expressed in NK-92 cells, the functional changes in the NK-92 cells were examined, including cytotoxicity, cytolytic molecules, cytokine production, and proliferation. Two novel genes were selected as functional genes that regulate NK cell function from among more than 100 candidate genes, for which the proliferation and cytotoxicity of NK-92 cells were examined as primary indicators. This was followed by extensive flow cytometry analysis and RT-PCR. The primary data indicated that the two novel genes negatively influenced the cytotoxicity of NK-92 cells by inhibiting the expression of several activating receptors and immune functional genes. Therefore, we describe an efficient method for the discovery of novel functional genes in NK cells by using an NK cell line as a screening platform. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Natural killer (NK) cells, belonging to large granular lymphocytes, are important component of the innate immunity and play essential roles both in tumor immune surveillance and early defense against virus infection [1]. Compared with T cells, the underlying mechanisms of NK cells, such as development, recognition, activation, and cytotoxicity, are less clear. For the convenience of research and application, several NK cell lines have been established, including NK92, NKL, YT, NK-YS, HANK-1, and KHYG-1 [2]. Among them, NK-92 cell line is IL-2 dependent, possesses strong cytolytic activity against a broad range of malignant tumor cells, and was the first NK cell line used in clinical trial for adoptive immunotherapy [3]. The NK-92 cell line is a well characterized tool for the functional research of NK cells [4]. The publication of the complete human genome sequence provides many opportunities for advances in medicine and biotechnology, including the discovery of novel functional genes involved in immunity. There are approximately 30,000 genes in the human genome, the

⁎ Corresponding author. Institute of Immunopharmacology & Immunotherapy, School of Pharmaceutical Sciences, Shandong University, 44 Wenhua West Road, Jinan 250012, China. Tel.: + 86 531 8838 1980; fax: + 86 531 8838 3782. E-mail address: [email protected] (J. Zhang). 1567-5769/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2010.12.003

functions of many of which are unknown or poorly understood. In the past decades, many types of cDNA and RNA interference libraries of the human genome have been established. Taking advantages of these developments, high-throughput technologies for screening novel genes have been used in investigation [5,6]. Cell-based functional arrays, which can measure gene function directly, have been proven efficient. Using this approach, expression plasmids containing full-length open reading frames (ORFs) are transferred into cell lines and the screening of novel functional gene(s) relies on cellular phenotypes or functions [7]. In this study, hundreds of cDNA expression plasmids containing candidate genes were gifted by the Chinese National Human Genome Center in Beijing; however, the function of most of these genes is unknown. In order to discover novel gene(s) that might be involved in NK cell functions from this library, an NK cell-based platform was established. In this approach, these plasmids carrying candidate genes were transfected into NK-92 cells, followed by phenotypic analysis and characterization of the NK-92 cells. As one of the major functions of NK cells is the cytotoxicity against tumor cells or virus infected cells, involving expression of activating and inhibitory receptors, signal transduction, cytolytic molecules (perforin, FasL), adhesion molecules, and cytokines [8,9], here the cytolytic activity of genetransferred NK-92 cells was evaluated as primary screening parameter. Thus, many molecules associated with NK cytotoxicity were detected. We show the results for four candidate genes as an example to describe the usefulness of the NK-92 cell-based platform for the screening of candidate genes.

L. Wu et al. / International Immunopharmacology 11 (2011) 274–279

275

2. Materials and methods

2.6. RNA isolation and RT-PCR

2.1. Cell lines and cell culture

Total RNA was extracted using TRIzol (Invitrogen Carlsbad, CA, USA). cDNA was synthesized using MMLV Reverse Transcriptase (Invitrogen). The mRNA level of Gene 1 was determined by real-time RT-PCR using a TransStart SYBR qPCR Kit (TransGen, China) using a MyiQ thermocycler (BioRad). The mRNA levels of immune functional genes were determined by reverse transcription polymerase chain reaction (RT-PCR). The primers used are listed in Table 1. The PCR products were electrophoresed, photographed, and analyzed using AlphaEaseFC software (BD Biosciences, CA). The band intensities of each gene were first normalized to the corresponding internal β-actin levels, and then the relative density was normalized again to the NK92-vector group.

NK-92 cells were cultured in α-MEM (GIBICO/BRL, Grand Island, N. Y. USA), 12.5% FBS (Sijiqing, China), 12.5% horse serum (GIBICO), 0.1 mM β-mercaptoethanol, and 100 U/mL rIL-2 (Changchun ChangSheng Gene Pharmaceutical Co., Ltd., China). K562 cells and PG cells were cultured in RPMI-1640 (GIBICO) containing 10% FBS. All of the cell lines were maintained in our laboratory.

2.2. Electroporation of NK-92 cells and selection of stable cell strains Several candidate genes were picked out from the cDNA library, after the analysis of their sequences, potential function and references. The candidate gene expression plasmids (pcDNA3.1-Gene1, 2, 3, 4) and control vector were transfected into NK-92 cells, respectively, by electroporation as described previously [10] using a Bio-Rad Gene PulserII (Bio-Rad, Hercules, CA, USA). The gene-transferred NK92 cells were selected with G418 (GIBICO) for 2 weeks at an increased concentration from 200 to 800 μg/mL, until cells in negative control group (parental NK-92 cells selected with G418) died completely. Stable transfected cells were obtained. The stable NK-92 cells were monocloned and expanded in 96-well plate, and the clones with higher over-expression level of candidate gene were identified and picked out for further research.

2.7. Activation of NK-92 cells and Western blot NK-92-vector cells and NK-92-Gene 1 cells were incubated with 10 μg/mL anti-NKG2D mAb (R&D systems) for 40 min on ice, and then washed with ice cold PBS. These NK cells were suspended with complete medium and incubated at 37 °C for 10 min. At last, the total protein of NK cells were isolated and the phosphorylated PI3K, ERK1/2, PLCγ2 were detected by Western blot. The bands were photographed and analyzed using AlphaEaseFC software (BD Biosciences). The band intensities of each phospho-protein were first normalized to the corresponding total protein levels, and then the relative densities were normalized again to the NK-92-vector group. 2.8. Statistical analysis

2.3. MTT assay for NK-92 cells proliferation NK-92 and NK-92-vector and -gene-transfected cells were cultured in 96-well plates for 0 h, 24 h, 48 h, and 72 h at a density of 6000 cells/well in 200 μL of α-MEM medium. At each time point, 10 μL (5 mg/mL) MTT was added. After a further incubation of 4 h, 100 μL of supernatant was removed from each well and 100 μL of 10% SDS solution was added to dissolve the formazan crystals. The culture plates were then incubated at 37 °C overnight and the absorbance at 570–630 nm was determined using a Microplate Autoreader (BioRad).

2.4. 4h

51

Cr release cytotoxicity assay

Assays were performed using NK-92 and NK-92-vector and -gene-transfected cells (NK-92-Gene 1, 2, 3, and 4). The NK-92 cells were mixed with 51Cr-labeled K562 or PG cells at effecter (E) to target (T) ratios of 20:1, 10:1, and 5:1. After standard 4 h incubation, the supernatants were harvested and analyzed on a gamma counter (model 500; Beckman Instruments, Irvine, CA, USA). The percentage cytotoxicity was calculated as follows: cytotoxicity (%)=(CPME + T −CPMspontaneous)/ (CPMmaximum −CPMspontaneous)×100%.

2.5. Flow cytometry analysis Cells were harvested, washed twice with PBS, and incubated with antibodies for 30 min at 4 °C. The receptors expressed on the NK-92 cells were then measured using a BD FACS Calibur (BD Biosciences, CA). PE mouse anti-human CD25, CD122, CD132, CD69, CD314 (NKG2D), PE-labeled mouse IgG1κ, FITC-labeled mouse anti-human CD94, FITC mouse IgG1κ, PE-cy5 anti-human CD54, CD95, PE-cy5 mouse IgG1κ isotype control, Alexa Fluor488 mouse anti-human CD56, Alexa Fluor488 mouse IgG1κ Isotype control (BD Pharmingen), PE-conjugated anti-human NKG2A, and mouse IgG2a Isotype control PE (R&D systems) were used for phenotype analysis.

Data are presented as the mean ± SEM of three independent experiments. Statistical analysis was performed using Student's t test (one tail). Statistical significance was conferred when p b 0.05. 3. Results 3.1. Construction and identification of cDNA-expression plasmids of human candidate genes Hundreds of candidate genes, from the cDNA library of full-length human gene open reading frame (ORF) constructed by the Chinese National Human Genome Center, were functionally unknown or poorly understood. Therefore, we expect to identify novel functional gene(s) take part in the function of NK cells from this library. The cDNA of candidate genes were constructed into expression vector pcDNA3.1/myc-His(-)B, which carries the bacterial NEO gene for positive selection of stable integrants (Fig. 1A). These plasmids were identified by electrophoresis, and the sequences of some plasmids were confirmed by RT-PCR, endonuclease digestion (Fig. 1B) and Table 1 Sequences of primers for RT-PCR. Genes

Primer sequences

Product size (bp)

IFN-γ

R: ATGAAATATACAAGTTATAATCTTGGCTTT F: GATGCTCTTCGACCTCGAAACAGCAT R: CAGAGGGAAGAGTTCCCCAG F: CCTTGGTCTGGTAGGAGACG R: AAAGTCAGCTCCACTGAAGCTGTG F: AGTCCTCCACCTCGTTGTCCGTGA R: CCAGAGAAGCTCATTGTTGG F: CCAATCCATGAGGATGGTG R: CTGGGAGATGAGTGAATTTCATA F: GACTTCACCAGTTTAAGTAAATC R: ATGTTTCAGCTCTTCCACCTACAGA F: CCAGAGAGAGCTCAGATACGTTGAC R: ATCATGTTTGAGACCTTCAACA F: CATCTCTTGCTCGAAGTCCA

494

TNF-α Perforin NKG2A NKG2D FasL β-actin

430 436 325 416 500 300

276

L. Wu et al. / International Immunopharmacology 11 (2011) 274–279

G418 for two weeks and were then monocloned. In this process, certain details require special attention. In the transfection of Gene 1, for example, mRNAs of NK-92-vector and NK-92-Gene 1 cells were extracted after transfection for 24, 48, 72, and 96 h, and the overexpression levels of Gene 1 were measured by real-time PCR. As shown in Fig. 2, the expression level of Gene 1 in NK-92-Gene 1 cells was over 200-fold higher compared with the control cells at 24 h and 48 h, but it decreased sharply at 72 h. At 96 h, the over-expression level was only 1.45-fold higher (Fig. 2A). These results indicated that over-expression of the exogenous gene could only persist for approximately 96 h after this gene was transiently transfected into NK-92 cells by electroporation. Thus, positive selection with G418 or sorting with flow cytometry must be performed within 96 h after electroporation. Because there were still many negative cells or cells with low Gene 1 over-expression in the cell population after G418 selection, these cells were then monocloned and the cell clone with the highest Gene 1 expression level (approximately 12 folds) was selected for additional work (Fig. 2B). 3.3. Primary screening of transferred candidate immune genes by analyzing NK-92 cell proliferation and cytotoxicity In order to identify whether these candidate genes play roles in NK cells, we first investigated the proliferation ability and cytotoxicity of these cells. We observed that the proliferation of stably transfected NK-92 cells did not show obvious changes compared with NK-92vector cells (Fig. 3A). This suggests that the main function of these genes is not to regulate NK cell survival or basic metabolism.

3.2. Approaches for gene transfection into NK-92 cells The functional analysis of a specific gene requires its overexpression or down-regulation in model cells. First, the cDNA plasmids of candidate genes need to be efficiently transfected into NK-92 cells and then cell lines stably over-expressing individual candidate genes are established. Due to the resistance of NK cells, it is difficult to transfect exogenous DNA into these cells [11]. Three methods have been reported for gene delivery into NK cell lines, namely, lipofection, electroporation, and a viral delivery system [10,12–14]. In this experiment, we found it difficult to transfect NK cells with candidate genes using Lipofectamine 2000. We also attempted to use the lentivirus gene delivery system and obtained satisfactory transfection efficiency (data not shown); however, it is quite costly to reconstruct a cDNA library into the lentivirus system. Therefore, the lentivirus gene delivery system is inconvenient for gene screening. One of the most efficient and widely used gene transfection methods is electroporation. Eric M. Grund and colleagues thoroughly investigated the most efficient and effective methods for gene transfer into NK-92 cells [10]. Using this method, the candidate genes were transfected into NK-92 cells and screened. Here, four representative candidate genes, which may be involved in NK cell function, are shown to illustrate transfection into NK-92 cells. These four cDNA plasmids (Genes 1, 2, 3, and 4) were electroporated into NK-92 cells, and stable cell lines over-expressing Genes 1, 2, 3, and 4 were successfully established following selection with

Relative Gene 1 mRNA level

sequencing (data not shown). Fig. 1B is one representative of the results of identification.

A 400

NK-92-vector

**

350 300

NK-92-Gene1

**

250 200

*

8 4 0 24h

48h

72h

96h

Time

B Relative Gene 1 mRNA level

Fig. 1. Construction of cDNA plasmids containing candidate genes. A. The ORF of candidate genes was inserted into pcDNA3.1/myc-His(-)B at an EcoR I site in the multiple cloning site. B. The cDNA plasmids with candidate genes were identified by PCR and endonuclease digestion. Electrophoresis of the products was carried out on a 1.0% agarose gel. Identification of candidate genes was repeated twice. M1, DNA marker (300, 500, 800, 1000, 1500, and 2000 bp); Lanes 1 and 2, cDNA plasmids; Lanes 3 and 4, PCR product (1000 bp); Lanes 5 and 6, endonuclease digestion products (5.5 kb and 1.36 kb); M2, 1 kb DNA marker (1, 2, 3, 4, 5, 6, 8, and 10 kb).

14

**

12 10 8 6 4 2 0

NK-92 NK-92-vector NK-92-Gene 1

Fig. 2. Transfection of candidate genes into an NK-92 cell line by electroporation. A. NK-92 cells were electroporated with a cDNA plasmid containing Gene 1 or with control vector. The mRNA of these cells was extracted at 24, 48, 72, and 96 h, and measured by real-time RT-PCR. B. Gene 1-transfected NK-92 cells were selected using G418 and sub-cloned. The mRNAs of NK-92, NK-92-vector, and NK-92-Gene 1 cells were measured by real-time RT-PCR. The expression level of Gene 1 was normalized to its corresponding NK-92-vector group. Data are shown as the mean ± SEM of three independent experiments. ⁎p b 0.05; and ⁎⁎p b 0.01.

L. Wu et al. / International Immunopharmacology 11 (2011) 274–279

277

cell line, and PG, a lung adenocarcinoma cell line. Compared with the NK-92-vector cells, the cytotoxic activity of NK-92-Gene 1 against both K562 and PG cells decreased significantly, and that of NK-92Gene 3 against PG cells showed an obvious decrease (Fig. 3B,C). These results indicate that Genes 1 and 3 may be involved in the cytotoxic function of NK-92 cells. 3.4. Extensively screening of candidate immune genes by analyzing transferred NK-92 cell immunophenotypes and immune functional expression

Fig. 3. Proliferation and cytolytic function of gene-transferred NK-92 cells. A. NK-92, NK-92-vector, and NK-92-gene-transfected cells were cultured in 96-well plates for 0, 24, 48, and 72 h at a density of 6000 cells/well in 200 μL of α-MEM medium. Ten microliters (5 mg/mL) MTT (thiazolyl blue) was added to cell cultures at each time point. After incubation for an additional 4 h, 100 μL of supernatant was removed from each well and 100 μL of 10% SDS solution was added into each well of the plates. The culture plate was incubated at 37 °C overnight and the absorbance of each well was measured at 570/630 nm. Data are shown as the mean ± SEM of three to four repeat wells from one of three independent experiments. B,C. NK-92 and NK-92-vector, and -gene-transfected cells were co-incubated with 51Cr labeled K562 (B) or PG (C) cells at a ratio of 20:1, 10:1, and 5:1 for 4 h. The supernatants were harvested and measured using a gamma counter. The cytotoxic activity of NK-92 cells was calculated as described in Materials and methods. Data are shown as mean ± SEM of three independent experiments. ⁎p b 0.05; and ⁎⁎p b 0.01.

NK cells play an important role in tumor immune surveillance; therefore, the cytotoxicity of NK cells against tumor cells is a major consideration. The cytotoxic activities of NK-92 and NK-92-vector and -gene-transfected cells were analyzed by 4-h 51Cr release assay. We selected two types of target cell line: K562, a myelogenous leukemia

As shown above, the cytotoxicity of NK-92 decreased following transfection of Genes 1 and 3. Since the activation and cytotoxicity of NK cells are determined by the balance between inhibitory and activating NK receptors, we investigated whether Genes 1 and 3 affected this balance by immunophenotypic analysis. Ten types of molecule expressed on NK cells were detected using flow cytometry: NKG2D, NKG2A, CD132, CD122, CD25, CD56, CD54, CD69, CD94, and CD95. The mean fluorescent intensities (MFI) of these molecules are listed in Table 2. The expression levels of CD122, CD132, and CD94 on NK-92-Gene 1 cells were significantly higher than that of NK-92-vector cells (Table 2). There were also different changes on other transferred NK-92 cells, but these were not statistically significant. Interestingly, we noticed that the expression level of the NK cell active receptor NKG2D decreased slightly, whereas that of the inhibitory receptor NKG2A increased on NK-92-Gene 1 cells. This may have led to the down-regulated cytotoxicity observed in NK-92-Gene 1 cells. On the basis of the characterization of NK cells, we further investigated which immune functional genes were affected by Genes 1 or 3 in NK cells. The mRNA levels of NK cell receptors and several immune functional genes were detected using RT-PCR, including NK cell receptors NKG2D and NKG2A, cytokines IFN-γ and TNF-α, cytotoxic protein perforin, and FasL. For NK-92-Gene 1 cells, mRNA levels of NKG2A and FasL were significantly higher, whereas IFN-γ and TNF-α mRNA levels were noticeably lower. For NK-92-Gene 3 cells, mRNA levels of IFN-γ and NKG2A were noticeably lower (Fig. 4A and B). The NKG2D/DAP10 signaling pathways have been proved to play important roles in the cytotoxicity of NK cells [15–17]. To investigate this signaling pathway and clarify the effect of candidate genes on NK92 cells, NK-92-vector cells and NK-92-Gene1 cells were activated with anti-NKG2D mAb. The phosphorylation levels of ERK1/2, PI3K (p85, p55) and PLCγ2 were assayed by Western blot. As shown in Fig. 4C and D, when compared with NK-92-vector cells, the phosphorylation levels of ERK1/2 and PI3K were decreased significantly in Gene 1 transferred NK-92 cells. In summary, through this screening approach, we found that candidate Gene 1 and Gene 3 may be novel immune functional genes of NK cells, which play distinctive roles on NK cells. These results lay the foundation for a detailed large-scale screen in the future. 4. Discussion Over-expression and knockdown of specific genes in model cell lines are essential tools for studying gene function. Thus, technologies suitable for transferring genes into NK cells are important. NK cell lines are known for their resistance to exogenous gene transfer. Many methods have been developed for gene transfection into primary NK or NK cell lines. Although we previously reported that an IL-15 gene-modified NK-92 cell line was successfully established by performing transfection using Lipofectamine 2000 [12], in the present study, NK-92 cells transfected with a candidate gene were not efficiently obtained using this method. We propose that this may be because IL-15 promotes proliferation and survival of NK cells, which is beneficial to NK-92–IL-15 cell survival and propagation

278

L. Wu et al. / International Immunopharmacology 11 (2011) 274–279

Table 2 Immunophenotypes of transferred NK cells. MFI

NK-92

-Vector

-Gene 1

-Gene 2

-Gene 3

-Gene 4

NKG2D NKG2A CD25 CD122 CD132 CD54 CD94 CD95 CD56 CD69

7.90 ± 1.39 68.21 ± 24.66 12.56 ± 4.65 76.43 ± 24.99 14.82 ± 5.23 1034.61 ± 284.93 32.72 ± 3.50 35.79 ± 9.54 95.82 ± 31.77 4.81 ± 1.78

7.83 ± 3.41 61.74 ± 21.33 11.89 ± 4.33 72.36 ± 19.60 13.11 ± 3.43 963.20 ± 209.90 29.57 ± 4.45 37.33 ± 9.41 91.06 ± 22.17 5.05 ± 1.83

5.36 ± 2.19 77.14 ± 26.16 13.90 ± 5.27 101.65 ± 33.55⁎ 16.30 ± 3.67⁎ 1019.68 ± 296.55 37.64 ± 7.71⁎ 29.40 ± 9.73⁎⁎

7.32 ± 1.10 64.19 ± 31.85 11.97 ± 6.12 58.06 ± 18.28 13.53 ± 3.02 1127.18 ± 471.29 31.00 ± 7.41 42.91 ± 17.34 113.30 ± 48.96 5.53 ± 1.42

6.52 ± 0.86 58.53 ± 21.29 9.69 ± 3.96 73.61 ± 17.98 12.82 ± 3.82 812.15 ± 181.28 30.90 ± 7.27 25.86 ± 9.89 93.62 ± 28.95 –

7.19 ± 1.16 68.98 ± 25.39 10.69 ± 3.73 79.56 ± 19.17 12.99 ± 2.72 913.31 ± 201.09 34.55 ± 6.20 32.56 ± 10.53 94.62 ± 25.56 7.07 ± 0.00

90.90 ± 24.78 4.15 ± 0.84

Values are shown as mean ± SEM from three independent experiments. ⁎ p b 0.05. ⁎⁎ p b 0.01.

during the selection by G418. Genes delivered into NK cells with a lentivirus or retrovirus system have been proven efficient and gentle, but the transfection efficiency is lower in NK-92 cells, at approximately 15% [13,14]. This is inconvenient and costly for the large-scale screening of novel genes. We also tried the nucleofection protocol from Amaxa, which needed fewer cells and plasmids, and resulted in little cell injury [18]. However, the specific equipment

and reagents of this system are costly. After a comparison of the methods available, gene transfection by electroporation proved to be easier and more useful for large-scale screening of novel immune functional genes. Although a high quantity of cells and plasmids are needed, electroporation is still the most suitable method for NK-92 cell transfection. As previously described, using the electroporation

Fig. 4. RT-PCR analysis of NK cell-associated functional genes. A. The mRNAs of TNF-α, IFN-γ, perforin, NKG2D, NKG2A, and FasL in NK-92-vector and -gene-transfected cells were measured by RT-PCR. The PCR products were electrophoresed, photographed, and analyzed using AlphaEaseFC. B. The histogram represents the relative expression levels of each gene. The band intensities of each gene were normalized to their corresponding internal β-actin levels, and then the relative density was normalized to the NK-92-vector group. Data are shown as the mean ± SEM of three independent experiments. ⁎p b 0.05; and ⁎⁎p b 0.01. NK-92-vector cells and NK-92-Gene1 cells were activated with anti-NKG2D mAb. The total protein of NK cells was isolated and the phosphorylated ERK1/2, PI3K, and PLCγ2 were detected by western blot. D. Statistical chart of mean intensity of phosphorylated ERK1/2, PI3K, and PLCγ2. The band intensities of each phospho-protein were first normalized to the corresponding total protein levels, and then the relative densities were normalized again to the NK-92-vector group. Data are shown as the mean ± SEM of three independent experiments. ⁎p b 0.05 and ⁎⁎p b 0.01.

L. Wu et al. / International Immunopharmacology 11 (2011) 274–279

method, a transfection efficiency of 40% is obtainable in NK-92 cells with common electroporation equipment and reagents [10], although it does lead to high mortality. Additionally, as shown in Fig. 2A, NK-92 cells appear to be naturally resistant to exogenous DNA, which resulted in a rapid decrease in transferred genes; therefore, cell function analysis or positive selection should be performed within 96 h after transfection. For the functional screening of gene-transfected NK-92 cells, convenient and efficient analysis methods should be used initially. For NK cells, proliferation and cytotoxicity against tumor cells are fundamentally the most important parameters. If a candidate gene can affect the proliferation or cytotoxicity of NK-92 cells, the levels of receptors, cytokines, and cytotoxic proteins expressed by NK cells should also be determined. This serves to support the established evidence concerning the function of the specific gene in NK cells. In our research, we identified two candidate genes involved in NK92 cell function by impairing the cytotoxic behavior of NK-92 cells, thereby affecting immunophenotypes and functional gene expression. For NK-92-Gene 1 cells, the expression levels of CD94 and NKG2A, which could form an heterodimer and inhibit the activation of NK cells fatefully [19], were up-regulated, concomitant with the downregulation of activating receptor NKG2D (Fig. 4A,B) and phosphorylation of NKG2D/DAP10 signaling pathway (Fig. 4C,D). Besides, expression of cytokine IFN-γ and TNF-α, and cytotoxic activity against both K562 and PG cells decreased significantly (Fig. 3B). Out of accord with these findings described above, expression levels of CD122 and CD132, the common receptors of IL-2 and IL-15 which would enhance the response of NK cells to these cytokines, influence the development of NK cells and also increase NK cell cytotoxic activity [20], were simultaneously up-regulated by Gene 1, as well as the important molecule to cytolytic NK cell activity FasL. These data further demonstrated that the cytotoxic activity of NK cells is determined by a comprehensive effects, including the balance between NK cell activating and inhibitory receptors [21] and the formation of immune synapses [22,23]. Differently from Gene 1, Gene 3 only decreased the cytolytic activity of NK-92 cells against solid tumor PG cells significantly, and concomitant with slightly decrease of adhesion molecule CD54 (ICAM-1), an important adhesion molecule in the target recognition by NK cells (binding to the integrin LFA-1) and the decrease of cytokine IFN-γ (Table 2 and Fig. 4A,B). These findings indicated that Gene 1 and Gene 3 regulate NK cell cytotoxicity in different mechanisms. On the basis of these results, we could study in detail the functions of these two novel genes in the future, and this will help clarify the underlying mechanisms by which NK cell cytotoxicity is regulated. Identification of novel immune functional genes often begins with a high-throughput investigation, followed by individual study of the precise functions of the novel genes identified. Our research process demonstrates that an NK cell line-based platform is efficient and suitable for immune functional gene screening.

279

Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (30901307 and 30972962) and the Ministry of Science and Technology of China (2007AA021000; 2007AA021109; 2006CB504303; and 008ZX10002-008). References [1] Vivier E, Tomasello E, Baratin M, Walzer T, Ugolini S. Functions of natural killer cells. Nat Immunol 2008;9:503–10. [2] Drexler HG, Matsuo Y. Malignant hematopoietic cell lines: in vitro models for the study of natural killer cell leukemia–lymphoma. Leukemia 2000;14:777–82. [3] Tonn T, Becker S, Esser R, Schwabe D, Seifried E. Cellular immunotherapy of malignancies using the clonal natural killer cell line NK-92. J Hematother Stem Cell Res 2001;10:535–44. [4] Gong JH, Maki G, Klingemann HG. Characterization of a human cell line (NK-92) with phenotypical and functional characteristics of activated natural killer cells. Leukemia 1994;8:652–8. [5] Cullen LM, Arndt GM. Genome-wide screening for gene function using RNAi in mammalian cells. Immunol Cell Biol 2005;83:217–23. [6] Michiels F, van Es H, van Rompaey L, et al. Arrayed adenoviral expression libraries for functional screening. Nat Biotechnol 2002;20:1154–7. [7] Tian L, Wang P, Guo J, et al. Screening for novel human genes associated with CRE pathway activation with cell microarray. Genomics 2007;90:28–34. [8] Raulet DH, Guerra N. Oncogenic stress sensed by the immune system: role of natural kille cell receptors. Nat Rev Immunol 2009;9:568–80. [9] Glimcher LH, Townsend MJ, Sullivan BM, Lord GM. Recent developments in the transcriptional regulation of cytolytic effector cells. Nat Rev Immunol 2004;4: 900–11. [10] Grund EM, Muise-Helmericks RC. Cost efficient and effective gene transfer into the human natural killer cell line, NK92. J Immunol Meth 2005;296:31–6. [11] Trompeter HI, Weinhold S, Thiel C, Wernet P, Uhrberg M. Rapid and highly efficient gene transfer into natural killer cells by nucleofection. J Immunol Meth 2003;274:245–56. [12] Zhang J, Sun R, Wei H, Zhang J, Tian Z. Characterization of interleukin-15 genemodified human natural killer cells: implications for adoptive cellular immunotherapy. Haematologica 2004;89:338–47. [13] Miah SM, Campbell KS. Expression of cDNAs in human natural killer cell lines by retroviral transduction. Meth Mol Biol 2010;612:199–208. [14] Savan R, Chan T, Young HA. Lentiviral gene transduction in human and mouse NK cell lines. Meth Mol Biol 2010;612:209–21. [15] Awasthi A, Samarakoon A, Dai X, et al. Deletion of PI3K-p85alpha gene impairs lineage commitment, terminal maturation, cytokine generation and cytotoxicity of NK cells. Genes Immun 2008;9:522–35. [16] Upshaw JL, Leibson PJ. NKG2D-mediated activation of cytotoxic lymphocytes: unique signaling pathways and distinct functional outcomes. Semin Immunol 2006;18:167–75. [17] Wu J, Song Y, Bakker AB, et al. An activating immunoreceptor complex formed by NKG2D and DAP10. Science 1999;285:730–2. [18] Maasho K, Marusina A, Reynolds NM, Coligan JE, Borrego F. Efficient gene transfer into the human natural killer cell line, NKL, using the Amaxa nucleofection system. J Immunol Meth 2004;284:133–40. [19] Masilamani M, Nguyen C, Kabat J, Borrego F, Coligan JE. CD94/NKG2A inhibits NK cell activation by disrupting the actin network at the immunological synapse. J Immunol 2006;177:3590–6. [20] Atedzoe BN, Ahmad A, Menezes J. Enhancement of natural killer cell cytotoxicity by the human herpesvirus-7 via IL-15 induction. J Immunol 1997;159:4966–72. [21] Lanier LL. Up on the tightrope: natural killer cell activation and inhibition. Nat Immunol 2008;9:495–502. [22] Orange JS. Formation and function of the lytic NK-cell immunological synapse. Nat Rev Immunol 2008;8:713–25. [23] Orange JS. The lytic NK cell immunological synapse and sequential steps in its formation. Adv Exp Med Biol 2007;601:225–33.