NK cells activated in vivo by bacterial DNA control the intracellular growth of Francisella tularensis LVS

Microbes and Infection 11 (2009) 49e56 www.elsevier.com/locate/micinf

Original article

NK cells activated in vivo by bacterial DNA control the intracellular growth of Francisella tularensis LVS Karen L. Elkins a,*, Susan M. Colombini a, Arthur M. Krieg b, Roberto De Pascalis a a

Laboratory of Mycobacterial Diseases and Cellular Immunology, Division of Bacterial, Parasitic, and Allergenic Products, CBER/FDA, 1401 Rockville Pike, HFM 431, Rockville, MD 20852, USA b Pfizer, Inc., 620 Memorial Drive, Suite 101, Cambridge, MA 02139, USA Received 4 August 2008; accepted 13 October 2008 Available online 22 October 2008

Abstract We demonstrated previously that mice treated with bacterial or oligonucleotide DNA containing unmethylated CpG motifs are transiently protected against lethal parenteral challenge with the intracellular bacterium Francisella tularensis Live Vaccine Strain (LVS). Here we explore the cellular basis of this protection. Wild-type mice that were treated with CpG oligonucleotide DNA and challenged with a lethal dose of LVS survived, while mice lacking TLR9 did not. In vitro, treatment of LVS-infected macrophages and/or naive splenocytes with oligo DNA had no impact on intracellular bacterial replication. In contrast, in vitro co-culture of LVS-infected macrophages with splenocytes obtained from mice treated with oligo DNA in vivo resulted in control of intracellular LVS growth. Control was reversed by antibodies to interferon-g or to tumor necrosis factor-a and by inhibition of nitric oxide, and to a lesser degree by antibodies to Interleukin-12. Further, splenocytes from DNA-primed normal, T cell KO, B cell KO, lymphocyte-deficient scid, or perforin KO mice all controlled intra-macrophage LVS growth. Enriched DNAprimed natural killer cells, but not B cells, clearly controlled intracellular LVS growth. Thus, NK cells contribute to DNA-mediated protection by production of cytokines including IFN-g and TNF-a, resulting in nitric oxide production and control of intracellular Francisella replication. Published by Elsevier Masson SAS. Keywords: Francisella; Natural killer cells; B cells; Macrophages; Bacterial DNA

1. Introduction Although bacterial DNA containing unmethylated CpG dinucleotides stimulates potent immunobiological responses by eukaryotic cells in vitro and in vivo [1,2], the in vivo mechanisms of action have not yet been well defined. In addition to positive effects on cancer cells, allergic responses, and vaccines, CpG DNA given to mice provides immune activation sufficient to permit survival of otherwise lethal infections such as those caused by the intracellular pathogens Listeria monocytogenes [3], Francisella tularensis Live Vaccine Strain (LVS) [4], Mycobacterium tuberculosis [5], and Leishmania major [6,7]. Characteristically, infections with

* Corresponding author. Tel.: þ1 301 496 0544; fax: þ1 301 435 5675. E-mail address: [email protected] (K.L. Elkins). 1286-4579/$ - see front matter Published by Elsevier Masson SAS. doi:10.1016/j.micinf.2008.10.005

intracellular bacteria, whose genomes contain abundant unmethylated CpG motifs, elicit a powerful innate immune response within hours, followed after several days by specific adaptive responses that are largely mediated by T cells [8]. The power of initial innate immune responses, which includes production of cytokines such as Interleukin 12 (IL-12), interferon gamma (IFN-g), and tumor necrosis factor alpha (TNFa), is illustrated by the observation that T cell deficient mice such as athymic nu/nu, scid, or T cell knockout (KO) mice infected with an intracellular bacterium such as F. tularensis LVS survive for nearly a month before ultimately succumbing to infection [9e11]. Not surprisingly, treatment of animals in vivo with a powerful immunomodulator such as CpG DNA can also be toxic and result in negative outcomes, including autoimmune pathology, inappropriate tolerance induction, and shock. Both activating and immunosuppressive DNA sequence motifs, as

50

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

well as sequences which preferentially activate different cell types and cells from different species, have been identified. Extensive in vitro characterization has revealed that CpG DNA can activate a wide variety of cells, including dendritic cells, macrophages, B cells, natural killer cells (indirectly), and even T cells in some circumstances [1,2]. Treated cells produce a wide variety of cytokines and chemokines, as well as exhibit other effector functions (e.g., proliferation and upregulation of cell surface molecules) in vitro. Previously, we demonstrated that normal mice that were given oligonucleotides containing CpG motifs and then challenged with otherwise lethal doses of F. tularensis LVS between 2 and 10 days after DNA treatment survived [4]. The initial protective effect was dependent on B cells and IFN-g, but not T cells, in that short-term protection was readily demonstrable in T cell KO mice [4]. Here, we wished to determine the cellular source(s) of IFN-g, as well as the role of B cells, in DNA-stimulated protection against lethal LVS challenge. To do so, we have taken advantage of KO mice as well as a novel in vitro culture system that focuses on the ability of cells to control the intracellular replication of bacteria, a critical function in controlling infection. We find that in vivo CpG DNA-mediated in vivo activation of NK cells, but not B cells or macrophages, is important for IFN-g and TNF-a-dependent control of LVS growth in macrophages. 2. Materials and methods 2.1. Bacteria and growth conditions F. tularensis LVS (ATCC 29684; American Type Culture Collection, Rockville, MD) was cultured on modified MuellereHinton (MH) agar plates or in modified MH broth (Difco Laboratories, Detroit, MI), and frozen in aliquots for routine use, as previously described [10,12]. 2.2. Animals and in vivo inoculations The following specific pathogen free, adult male mice were purchased from Jackson Laboratories (Bar Harbor, ME): BALB/cByJ, BALB/c.scid, C57BL/6J, B6/129F2, Igh6 (B cell KO), TCR b/d (total T cell KO), perforin KO, and gamma interferon (GKO) KO (all KO mice on a C57Bl/6J background). TLR9 KO mice [13] on a mixed B6,129 background were the generous gift of Dr. S. Akira, through Dr. Tod Merkel. All mice were housed in sterile microisolator cages in a barrier environment in the CBER specific pathogen free animal facility. Mice were given 0.5 ml IP or 0.1 ml ID of the indicated dilution of DNA or LVS, diluted in PBS (BioWhittaker, Walkersville, MD) containing <0.01 ng/ml endotoxin; actual bacterial doses were simultaneously determined by plate count. 2.3. Bacterial DNA preparations and antibodies The sequences of the phosphorothioates oligonucleotides used, which were produced by a core facility at CBER/FDA in low endotoxin format, were: #1, TCT CCC AGC GTG CGC

CAT (also oligo #1 in previous work) [4]; Me-#1, the latter sequence with methylated Cs at positions 9, 13, and 15 [4]; #2, (also designated elsewhere as oligo 2006) [14], TCGTCGTTT TGTCGTTTTGTCGTT; and control oligo #2, in which the CpG dinucleotides were reversed to GpG (designated elsewhere as oligo 2137) [14], TGCTGCTTTTGTGCTTTTGT GCTT. Preparations of oligo #2 and control oligo #2 were made under GMP-like conditions and contained no detectable endotoxin. The following neutralizing antibodies, purified and in low endotoxin format, used for blocking studies were purchased from BD PharMingen (San Diego, CA): anti-IFN-g (clone R4-6A2); anti-IL-12 (clone C17.8, rat IgG2a); antiTNF-a (clones MP6 XT3 and G281-2626); and anti-IL4 (clone 11B11, rat IgG1). 2.4. In vitro assessment of control of intracellular bacterial growth in bone marrow-derived macrophages (BMMf) The in vitro culture system used to analyze lymphocytes’ ability to control intracellular LVS replication, and validation of the culture system’s reflection of known parameters of in vivo control of bacterial growth, has been described in detail elsewhere [15,16]. Briefly, BMMf were cultured in 24-well plates, confluent monolayers infected with F. tularensis LVS at an MOI of 1:20 (bacteria:BMMf). Single cell suspensions of lymphocytes (5  106/well; we estimate that under these conditions there are 1  107 macrophages per well of a 24-well plate, and thus this is approximately 1 lymphocyte: 2 BMMf), obtained from either naive or CpG DNA treated mice (treated with 20e50 mg of DNA 3e4 days before harvest, as indicated), were added to duplicate or triplicate infected macrophage cultures as indicated. In all the experiments shown, 10 mg/ml CpG DNA of the same sequence as used during in vivo treatment was included in the medium; initial experiments established that numbers of recovered bacteria were similar in co-cultures with and without CpG DNA in the medium (data not shown). Supernatants were harvested, and growth of LVS in BMMf was monitored as previously described [15,16]. 2.5. NK cell preparation and assessment, lymphocyte subpopulation enrichment, and flow cytometry NK (DX5þ) cells, then CD19þ cells were enriched sequentially from splenocytes obtained from double a/beg/ d T cell KO mice using a MACS midi-system and magnetic beads (Miltenyi Biotec, Auburn, CA). Purity of the resulting cell subpopulations was assessed by flow cytometry as previously described [17], using appropriate fluorochrome-labeled antibodies (BD PharMingen, San Diego, CA) in multi-color staining protocols. 2.6. Quantitation of cytokines and nitric oxide in BMMf culture supernatants Culture supernatants were assayed for IFN-g, IL-12, IL-18, TNF-a, IL-4 and IL-10 by standard sandwich ELISAs. All

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

51

antibody pairs and recombinant standards were purchased from BD PharMingen (San Diego, CA), and cytokines quantified by comparison to recombinant standards. Nitric oxide (NO) was detected in culture supernatants by standard Griess reaction, and NO2 quantified by comparison to NaNO2. 2.7. Statistical evaluation The statistical significance of any difference in parameters was assessed using Student’s t-test (InStat, GraphPad Software, Inc., San Diego, CA). 3. Results 3.1. Role of TLR9 in DNA-mediated protection Previous results indicated that both wild-type (WT) BALB/ cByJ and C56BL/6J mice treated with oligo #1 CpG oligonucleotide DNA, as well as two other oligo sequences, survived challenge with otherwise lethal intraperitoneal doses of LVS given 3e4 days later [4]. To extend these findings as well as examine the properties of an oligo sequence being studied in human clinical trials, here we also studied oligo #2. Treatment of mice with oligo #2 also stimulated in vivo protection against LVS challenge in BALB/cByJ, C57BL/6J, and B6/129 F2 mice; for this sequence, a 50 mg dose i.p. stimulated optimal protection in BALB/cByJ and C57BL/6J mice (data not shown). The role of TLR9 in the recognition of CpG DNA was then tested using TLR9 KO mice, which were available on a mixed B6,129 background. WT B6,129 F2 mice treated with 50 mg of oligo #2 survived lethal challenge with 104 LVS i.p., while TLR9 KO mice treated with oligo #2, as well as control PBS-treated mice, did not (Fig. 1). To ensure that studies focused on general mechanisms not limited to particular mouse strains or to a particular DNA sequence, several mouse strains as well as both oligos were compared throughout subsequent studies. Results were comparable with both. Selected examples drawing from all available studies, chosen to illustrate outcomes in different strains of mice and with each type of oligo sequence, are shown here. 3.2. Role of DNA-primed splenocytes, cytokines, and nitric oxide in control of intracellular LVS growth To more directly study the means by which in vivo DNA treatment engenders survival, an in vitro culture system utilizing BMMf infected with LVS was employed. WT BALB/cByJ mice were inoculated i.p. with either oligo #1 or control methylated oligo Me-#1. Previous results demonstrated that a dose of 20 mg stimulated optimal in vivo protection for this sequence [4], and thus this dose was used here. Three days later, splenocytes from these mice were co-cultured with LVSinfected BMMf monolayers, and growth of bacteria was measured over time. LVS growth increased exponentially in macrophages cultured without splenocytes, whether or not oligo DNA was included in the culture medium (Fig. 2A and

Fig. 1. CpG DNA-stimulated protection against lethal F. tularensis LVS challenge in mice depends on TLR9. Groups of 5e8 B6/129 F2 mice or TLR9 KO mice on a mixed B6,129 background were treated with PBS or 50 mg oligo #2 i.p. Four days after DNA treatment, all mice were challenged with 104 LVS i.p. Survival, depicted on the x-axis, was monitored for 30 days. This experiment is one of three experiments performed of similar design and outcome.

data not shown). In contrast, LVS growth was greatly limited in cultures containing in vivo DNA-primed splenocytes (Fig. 2A). Splenocytes from control oligo Me-#1-treated mice had little impact on bacterial growth, comparable to that seen when normal splenocytes from untreated or PBS-treated mice were used [16]. This effect was not altered by inclusion or omission of oligo DNA curing the culture period (Fig. 2A and data not shown). Culture supernatants were assessed for mediators previously found to be of interest in control of intracellular LVS growth, and results from the 72 h cultures shown in Fig. 2A are shown in Fig. 2BeE. Under the conditions used here, small amounts (IL-12 or TNF-a) or no detectable amounts (IFN-g or NO) of mediators were found in supernatants from LVS-infected macrophages, either in the presence (Fig. 2) or absence (data not shown) of exogenous addition of oligo DNA to cultures. As seen previously in co-cultures using BALB/cByJ lymphocytes [15], robust amounts of IL-12 and IFN-g were present in all co-cultures with LVS-infected macrophages and lymphocytes (Fig. 2BeC). In contrast, much higher amounts of TNF-a and NO were found in cultures containing DNA-primed splenocytes compared to those with unprimed splenocytes (Fig. 2DeE). Small amounts of IL-18 were also detected in all cultures without regard to addition of splenocytes (approximately 75 pg/ml throughout; data not shown), and IL-4 was not detected (limit of detection, <50 pg/ ml). Thus, production of TNF-a and NO, but not IL-12 or IFNg, correlated directly with control of intracellular LVS growth. Conditions for optimal LVS growth control in vitro by DNAprimed cells were further examined. In vivo doseeresponse studies and in vitro cell titrations demonstrated that control of bacterial growth by DNA-primed splenocytes was dose and cell

52

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

Fig. 2. CpG DNA-primed lymphocytes control the intra-macrophage growth of F. tularensis LVS in vitro. Bone marrow derived macrophages from BALB/cByJ mice were infected with F. tularensis LVS as described in Materials and Methods at a multiplicity of infection of 1:20 (bacteria:macrophages). Immediately following infection, splenic lymphocytes from BALB/cByJ mice treated three days earlier with either PBS (solid line, filled circles), 20 mg oligo #1 (dashed line, filled squares), or 20 mg Me-oligo #1 (dashed line, open triangles) were added to the infected macrophage monolayers. (A) Numbers of CFU viable bacteria were determined 24, 48, and 72 h after the initiation of cultures by removing supernatants, washing the adherent monolayers with PBS, lysing macrophages with water, and plating serial dilutions of LVS bacteria on MHA plates. Results are shown as mean log CFU/ml  SD of the mean of triplicate cultures. Recovered CFU values for all cultures containing oligo #1-primed lymphocytes are significantly different from either of the control cultures harvested on days 1, 2, or 3 (all combinations, p < 0.001). (BeE) Supernatants obtained on day 3 from the indicated cultures were assessed by ELISA for quantities of IL-12 p40 (B), IFN-g (C), TNF-a (D), or by Griess reaction as an estimate of NO (E). Results are shown as mean ng/ml cytokine  SD of the mean of triplicate cultures (BeD) or mean mmoles/ml nitrite  SD of the mean of triplicate cultures (E). Amounts of IL-12 or IFN-g found in cultures containing lymphocytes are significantly different compared to those with only LVS-infected macrophages monolayers ( p < 0.001 for all combinations). Amounts of TNF-a and nitrite found in cultures containing oligo DNAprimed cells were significantly different compared to the corresponding cultures containing Me-oligo DNA-primed cells ( p < 0.001 for both comparisons), but not significantly different compared to cultures containing only LVS-infected macrophages ( p > 0.05). Results shown from one experiment are representative of seven experiments of similar design and outcome.

number dependent. Studies using co-cultures with DNAprimed splenocytes placed in transwell inserts, separated from LVS-infected macrophages, suggested that control of intracellular LVS growth by DNA did not require cell contact (data not shown), and thus likely involved soluble cytokine production. Experiments were, therefore, designed to determine the impact of blocking the cytokines produced in abundance in co-cultures

on control of intracellular LVS growth. Neutralizing amounts of anti-IFN-g, anti-IL-12, or anti-TNF-a were added to the culture medium throughout the 72 h culture period. Blocking the action of IFN-g, but not IL-4 with an isotype matched antibody, consistently and significantly reversed the ability of these cells to control LVS growth (Fig. 3A), to a level comparable to that of naive splenocytes (Fig. 3A) and to cultures with control oligo

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

53

Neutralization of these cytokines was confirmed by ELISA assays of the corresponding culture supernatants, and neutralization of IL-12 also greatly reduced amounts of IFN-g (data not shown). Consistent with the major loss of control of intracellular LVS growth in cultures treated with anti-IFN-g and anti-TNF-a, quantities of NO detected in such supernatants were greatly reduced (Fig. 3B). A lesser but significant impact of anti-IL-12 was found, and anti-IL-4 had no effect (Fig. 3B). 3.3. Role of natural killer cells in DNA-mediated protection Although B cell KO mice were not protected against LVS challenge by CpG DNA treatment, non-T cells such as NK cells were common to all previous tested KO mice that were successfully protected [4]. Here, we tested the in vitro activity of splenocytes derived from oligo #1-primed B cell KO (BKO) mice and total T cell KO (TKO) mice, both of which contained NK cells but lack the respective B or T lymphocyte subpopulations. Splenocytes from oligo #1-primed WT, BKO, and TKO mice, but not control Me-oligo #1-primed mice, all effectively controlled LVS growth (Fig. 4). Further, splenocytes from perforin KO mice were also comparable to WT

Fig. 3. IFN-g, TNF-a, and IL-12 contribute to the control of intramacrophage growth of F. tularensis LVS by CpG DNA-primed lymphocytes. Bone marrow derived macrophages from BALB/cByJ mice were infected with F. tularensis LVS as described for Fig. 2 and in Materials and methods. Immediately following infection, splenic lymphocytes from BALB/cByJ mice treated three days earlier with either PBS or 50 mg oligo #2 were added directly to the infected macrophage monolayers in the presence or absence of 25 mg of the indicated neutralizing antibodies. (A) Numbers of CFU viable bacteria were determined 3 days after the initiation of cultures as for Fig. 2. Results are shown as mean log CFU/ml  SD of the mean of triplicate cultures (black bars). Recovered CFU values for all cultures containing oligo #1-primed lymphocytes are significantly different from those containing anti-IFN-g, antiIL-12, or anti-TNF-a ( p < 0.0001 for IFN-g and TNF-a; p ¼ 0.0604 for IL12), but not from those containing anti-IL-4 ( p > 0.05). (B) Supernatants obtained on day 3 from the indicated cultures were assessed by Griess reaction as an estimate of NO (light gray bars). Results are shown as mean mM/ml nitrite  SD of the mean of triplicate cultures. Amounts of nitrite found in cultures containing LVS alone, anti-IFN-g, or anti-TNF-a are not significantly different compared to each other ( p > 0.05). Amounts of nitrite found in cultures containing either oligo #2-primed cells or anti-IL-4 are not significantly different compared to each other ( p > 0.05), but both contain significantly larger amounts of nitrite compared to cultures containing anti-IL-12 (p < 0.01). Results shown from one experiment are representative of eight experiments of similar design and outcome.

Me-#2-primed splenocytes and anti-IFN-g (data not shown). Blocking TNF-a strongly reversed the control of intracellular LVS growth (Fig. 3A). Blocking of IL-12 had lesser, but significant, effects on the control of bacterial growth.

Fig. 4. CpG DNA-primed lymphocytes from T cell KO mice, B cell KO mice and perforin KO mice control the intramacrophage growth of F. tularensis LVS. Bone marrow derived macrophages from C57BL/6J mice were infected with F. tularensis LVS as described for Fig. 2 and in Materials and methods. Immediately following infection, splenic lymphocytes from either WT C57BL/6J mice or the indicated KO mice on a C57BL/5J background, all treated three days earlier with either 20 mg Me-oligo #1 (open hatched bars) or 20 mg oligo #1 (black bars) as indicated, were added directly to the infected macrophage monolayers. Numbers of CFU viable bacteria were determined 3 days after the initiation of cultures as for Fig. 2. Results are shown as mean log CFU/ml  SD of the mean of triplicate cultures (black bars); results shown for infected macrophages (‘‘LVS alone’’) are those using oligo #1 added to the medium, but were not different from those using Me-oligo #1 added to the medium (not shown). Recovered CFU values for all cultures containing oligo #1-primed lymphocytes are significantly different from those containing either no cells or cells from Me-oligo #1 primed cells (for all combinations p < 0.01), but not significantly different from each other ( p > 0.05 for all combinations). Results shown from one experiment are representative of four experiments of similar design and outcome.

54

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

splenocytes in controlling the intracellular growth of LVS (Fig. 4). Cytokines in 72 h culture supernatants were also measured; all supernatants from cultures containing splenocytes lacking either B or T cells contained IFN-g, IL-12, TNFa, and NO in amounts roughly comparable to those found in WT co-cultures (data not shown). We then studied the activity of splenocytes derived from oligo #1-primed scid mice, which lack both B and T lymphocytes but contain NK cells, macrophages, and dendritic cells. DNA-primed scid splenocytes added to LVS-infected macrophages greatly reduced intracellular LVS growth (Fig. 5), in a doseedependent manner and accompanied by production of IFN-g, IL-12, TNF-a, and NO (data not shown). Addition of neutralizing anti-IFN-g (Fig. 5) or anti-TNFa (data not shown), but not anti-IL-4, to the cultures containing DNA-primed scid splenocytes significantly reversed the control of intracellular LVS growth (Fig. 5), and greatly reduced the corresponding production of NO (data not shown). The experiments using DNA-primed scid splenocytes suggested that NK cells contributed to the control of intracellular LVS growth, but previous in vivo experiments also suggested a role for B cells [4]. To directly determine the contribution of each of these cell types, we used CpG DNA-treated T cell KO mice as a source of splenocytes, enriched the NK cell

Fig. 5. CpG DNA-primed lymphocytes from scid mice control the intramacrophage growth of F. tularensis LVS by an IFN-g-dependent mechanism. Bone marrow derived macrophages from BALB/cByJ mice were infected with F. tularensis LVS as described for Fig. 2 and in Materials and methods. Immediately following infection, splenic lymphocytes from either WT BALB/ cByJ mice or scid mice on a BALB/c background treated four days earlier with either 20 mg oligo #1 or 20 mg Me-oligo #1 were added directly to the infected macrophage monolayers. Co-cultures also contained 25 mg anti-IFN-g or antiIL-4 as indicated. Numbers of CFU viable bacteria were determined 3 days after the initiation of cultures as in Fig. 2. Results are shown as mean log CFU/ ml  SD of the mean of triplicate cultures (black bars). Recovered CFU values for all cultures containing oligo #1-primed WT or scid lymphocytes, with or without anti-IL-4, are significantly different from those containing either no cells or with anti-IFN-g ( p < 0.01), but not significantly different from each other ( p > 0.05 for all combinations). Results shown from one experiment are representative of six experiments of similar design and outcome.

population by positive selection, and selected CD19þ B cells from the remaining NK-depleted negative fraction. WT, T cell KO splenocytes, and NK cells enriched from oligo #1-primed TKO mice strongly controlled intracellular LVS growth (Fig. 6). In contrast, DNA-primed CD19þ B cells alone had no significant effect, and combining NK cells with B cells resulted in control of intracellular LVS growth similar to that of NK cells alone. As seen previously, IFN-g was produced in all co-cultures containing lymphocytes, but NO and TNFa were found only in supernatants of cultures in which intracellular LVS growth was controlled (data not shown). 4. Discussion The ability of bacterial DNA containing CpG motifs to modulate infection, vaccination, autoimmunity, and tolerance

Fig. 6. NK1.1þDX5þ cells, but not CD19þB220þ B cells, purified from CpG DNA-primed T cell KO lymphocytes, control the intramacrophage growth of F. tularensis LVS. Bone marrow derived macrophages from C57BL/6J mice were infected with F. tularensis LVS as described for Fig. 2 and in Materials and methods. Immediately following infection, splenic lymphocytes or the indication enriched subpopulations were added directly to the infected macrophage monolayers. Either WT or T cell KO mice were treated four days earlier with either 20 mg oligo #1 or 20 mg Me-oligo #1. NK or B cell subpopulations were purified as described in Materials and methods, and were obtained from T cell KO mice on a C57BL/6J background. Here, enriched NK cell subpopulations were w91% NK1.1þ, and the remaining cells were mixtures of CD11bþF4/80þ macrophages and CD11cþ dendritic cells with few detectable CD19þ B cells. Conversely, B cell subpopulations were w94% CD19þ, and the remaining cells were mixtures of CD11bþF4/80þ macrophages and CD11cþ dendritic cells with few detectable NK1.1þ NK cells. Numbers of CFU viable bacteria were determined 3 days after the initiation of cultures as in Fig. 2. Results are shown as mean log CFU/ml  SD of the mean of triplicate cultures (black bars). Recovered CFU values for cultures containing oligo #1-primed WT, TKO primed, NK selected, or NK þ B cell selected lymphocytes are significantly different from those containing either no cells or Me-oligo #1-primed cells ( p < 0.0001 for all combinations), but not significantly different from each other ( p > 0.05 for all combinations). Results shown from one experiment are representative of six experiments of similar design and outcome.

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

has been clearly documented in a variety of animal models. An appreciation of the recognition and signalling events important at the single cell level is emerging [2,18,19], but much remains to be understood about the elements important in vivo. The mechanisms of action of CpG DNA as an immunomodulator alone have generally been attributed to activation of several cells types and innate immune responses. DNA-mediated protection against Listeria and Leishmania depends on IL-12 and IFN-g in vivo [3,7]. DNA-mediated protection against lethal F. tularensis LVS challenge was demonstrable in T cell KO mice but not IFN-g KO or B cell KO mice [4]. Thus, we focused on the possible contribution of NK cells of the innate immune system, as well as B cells of adaptive responses, to this pathogen. Using an in vitro culture system that models the in vivo interactions necessary for host cells to eliminate bacteria from infected macrophages, we find that direct activation of macrophages or splenocytes in vitro by DNA does not impact intracellular bacterial growth (Fig. 2 and following). Instead, production of soluble mediators by NK cells primed by CpGDNA in vivo contributes to DNA-mediated protection: natural killer cells, but not B cells, controlled intracellular LVS growth (Figs. 4e6). This control was largely due to production of soluble mediators, but not perforin (Fig. 4); indeed, growth control was greatly reduced by blockade of IFN-g or TNF-a, and to a lesser degree IL-12 (Figs. 3 and 5). Ultimately, control of intracellular LVS growth correlated well with the production of TNF-a and NO (Figs. 2 and 4), as noted in a number of other circumstances [15,16,20]. The central role of IFN-g was previously indicated by the observation that gamma interferon KO (GKO) mice treated with CpG DNA did not survive LVS challenge [4]. However, a wide variety of evidence indicates that production of IFN-g is necessary, but not sufficient, for survival of LVS infection, and its presence alone does not predict protection [11,15,20,21]. In co-culture experiments, blockade of IFN-g as well as TNF-a by neutralizing antibodies strongly reversed intracellular growth control by DNA-primed cells (Figs. 3 and 5). The role of TNFa, already known to be also critical for initial survival of LVS [9e11], during DNA-mediated protection in vivo has not been tested directly, as TNF-a KO mice have a wide variety of defects, greatly limiting interpretation of such an in vivo experiment. Blockade of IL-12 exhibited a lesser, but reproducibly significant, effect on intracellular growth control by DNA-primed cells (Fig. 3). The role of IL-12 in LVS infection is complex, and indeed IL-12 p70 is neither required for resolution of primary sublethal LVS infection nor for survival of secondary challenge [15]. Here, it is likely that IL-12 provides a moderate contribution, at least in vitro, by its well known function in regulating quantities of IFN-g production. Not surprisingly, DNA-stimulated protection against LVS infection was clearly dependent on TLR9 (Fig. 1). TLR9 is expressed intracellularly in murine macrophages, dendritic cells, and B cells, but not on NK cells or T cells [2,22]. The expression pattern of this receptor also made macrophages, dendritic cells, and B cells obvious candidates for involvement in DNA-mediated protection. Direct activation of macrophages by CpG DNA was essentially ruled out by the finding that LVS

55

replicated exponentially in bone marrow derived macrophages treated with CpG DNA (in the absence of lymphocytes), to a degree identical to that of control cultures (Fig. 2 and others). In contrast to other studies suggesting an impact of CpG DNA on uptake of bacteria [23], additional experiments using macrophages pre-treated in vitro with CpG DNA 1e3 days before LVS infection demonstrated no impact on LVS uptake or growth compared to control cultures (data not shown). Although we did not have the opportunity to directly study the role of dendritic cells, it is unlikely that they alone were responsible for the observed effects; in enrichment studies (Fig. 6), the non-NK1.1þDX5þ fraction remaining after NK and B cell selection contained abundant readily detectable CD11cþ cells, but did not control growth (data not shown). However, the interesting possibilities that in vivo activated dendritic cells participate in the activation of NK cells, e.g., through production of Type I interferons, as well as the possibility that hybrid ‘‘NK DCs’’ [24] are involved, are of interest and remain to be studied in detail. Considerable technical challenges are involved in designing such experiments. Because in vivo CpG DNA-mediated protection is clearly defective in B cell KO mice [4], we were keenly interested in the possibility that B cell activation was involved. However, DNA-primed lymphocytes from B cell KO mice clearly controlled the intracellular growth of LVS (Fig. 4), and highly enriched B cells from DNA-primed T cell KO mice did not (Fig. 6). Other data indicate that the role of B cells in LVS infection is due to a combination of anti-LPS antibody production by B-1 B cells in the peritoneal cavity and to a nonantibody function involved in regulating neutrophil trafficking [16,25,26] (Cole et al., submitted for publication). These functions appear to be required for survival of any intraperitoneal LVS challenge, and are therefore likely to be unrelated to the CpG DNA treatment studied here. Instead, in vitro studies clearly demonstrated the potential of highly enriched in vivo DNA-primed NK cells to control the intracellular growth of LVS (Fig. 6), an observation consistent with other recent studies indicating contributions of NK cells to control of LVS infection [27,28]. Because murine NK cells do not appear to express TLR9, it is likely that the in vivo activation is itself indirect and may involve plasmacytoid dendritic cells, as demonstrated previously in other circumstances [29,30]. Disappointingly, we were not able to obtain clear in vivo evidence for the involvement of NK cells, as strategies used to deplete NK cells in vivo were consistently incomplete (data not shown), a technical issue that has been encountered by others. Similar technical issues apply to assessing the overall role of NK cells in survival or control of sublethal LVS infection: the i.d. LD50 of LVS-infected mice treated with antiNK1.1 or anti-LGL antibodies is similar to that of control mice [25] (D.L. Leiby and K.L. Elkins, unpublished data), but this too may reflect incomplete depletion. As noted previously [4], T cell KO mice treated with CpG DNA and challenged with LVS survive for nearly a month, weeks longer than unprimed naive mice, but eventually succumb to overwhelming bacterial infection. Thus activation of innate immune responses by CpG DNA appears to function

56

K.L. Elkins et al. / Microbes and Infection 11 (2009) 49e56

primarily to convert a lethal infection to a sublethal immunizing infection. Collectively, therefore, these studies strongly suggest that local TLR9-dependent but indirect activation of conventional NK cells by CpG DNA treatment results in cytokine and NO production, with subsequent expansion of T cell-mediated immune responses that ultimately lead to survival of F. tularensis LVS infection.

[15]

[16]

Acknowledgments We are most grateful to Dr. S. Akira for making the TLR9 knockout mice available for these studies. We thank our CBER colleagues, Mustafa Akkoylanu and Eda Bloom, for thoughtful and careful review of the manuscript. References [1] K.J. Ishii, S. Akira, Innate immune recognition of, and regulation by, DNA, Trends Immunol. 27 (2006) 525e532. [2] A.M. Krieg, CpG motifs in bacterial DNA and their immune effects, Annu. Rev. Immunol. 20 (2002) 709e760. [3] A.M. Krieg, L. Love-Homan, A.K. Yi, J.T. Harty, CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge, J. Immunol. 161 (1998) 2428e2434. [4] K.L. Elkins, T.R. Rhinehart-Jones, C. Stibitz, J.S. Conover, D.M. Klinman, Bacterial DNA containing CpG motifs stimulates lymphocyte-dependent protection of mice against lethal infection with intracellular bacteria, J. Immunol. 162 (1999) 2291e2298. [5] B.L. Freidag, G.B. Melton, F. Collins, D.M. Klinman, A. Cheever, L. Stobie, W. Suen, R.A. Seder, CpG oligodeoxynucleotides and interleukin-12 improve the efficacy of Mycobacterium bovis BCG vaccination in mice challenged with Mycobacterium tuberculosis, Infect. Immun. 68 (2000) 2948e2953. [6] S. Zimmerman, O. Egeter, S. Hausmann, G.B. Lipford, M. Rocken, H. Wagner, K. Heeg, CpG oligonucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis, J. Immunol. 160 (1998) 3627e3630. [7] J.A. Shah, P.A. Darrah, D.R. Ambrozak, T.N. Turon, S. Mendez, J. Kirman, C.Y. Wu, N. Glaichenhaus, R.A. Seder, Dendritic cells are responsible for the capacity of CpG oligodeoxynucleotides to act as an adjuvant for protective vaccine immunity against Leishmania major in mice, J. Exp. Med. 198 (2003) 281e291. [8] U.E. Schaible, H.L. Collins, S.H. Kaufmann, Confrontation between intracellular bacteria and the immune system, Adv. Immunol. 71 (1999) 267e377. [9] K.L. Elkins, T. Rhinehart-Jones, C.A. Nacy, R.K. Winegar, A.H. Fortier, T-cell-independent resistance to infection and generation of immunity to Francisella tularensis, Infect. Immun. 61 (1993) 823e829. [10] K.L. Elkins, T.R. Rhinehart-Jones, S.J. Culkin, D. Yee, R.K. Winegar, Minimal requirements for murine resistance to infection with Francisella tularensis LVS, Infect. Immun. 64 (1996) 3288e3293. [11] K.L. Elkins, S.C. Cowley, C.M. Bosio, Innate and adaptive immunity to Francisella, Ann. N. Y. Acad. Sci. 1105 (2007) 284e324. [12] A.H. Fortier, M.V. Slayter, R. Ziemba, M.S. Meltzer, C.A. Nacy, Live vaccine strain of Francisella tularensis: infection and immunity in mice, Infect. Immun. 59 (1991) 2922e2928. [13] H. Hemmi, O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira, A toll-like receptor recognizes bacterial DNA, Nature 408 (2000) 740e745. [14] G. Hartmann, R.D. Weeratna, Z.K. Ballas, P. Payette, S. Blackwell, I. Suparto, W.L. Rasmussen, M. Waldschmidt, D. Sajuthi, R.H. Purcell,

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

H.L. Davis, A.M. Krieg, Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo, J. Immunol. 164 (2000) 1617e1624. K.L. Elkins, A. Cooper, S.M. Colombini, S.C. Cowley, T.L. Kieffer, In vivo clearance of an intracellular bacterium, Francisella tularensis LVS, is dependent on the p40 subunit of interleukin-12 (IL-12) but not on IL-12 p70, Infect. Immun. 70 (2002) 1936e1948. C.M. Bosio, K.L. Elkins, Susceptibility to secondary Francisella tularensis LVS infection in B cell deficient mice is associated with neutrophilia but not with defects in specific T cell mediated immunity, Infect. Immun. 69 (2001) 194e203. S.C. Cowley, E. Hamilton, J.A. Frelinger, J. Su, J. Forman, K.L. Elkins, CD4CD8 T cells control intracellular bacterial infections both in vitro and in vivo, J. Exp. Med. 202 (2005) 309e319. K.J. Ishii, T. Kawagoe, S. Koyama, K. Matsui, H. Kumar, T. Kawai, S. Uematsu, O. Takeuchi, F. Takeshita, C. Coban, S. Akira, TANKbinding kinase-1 delineates innate and adaptive immune responses to DNA vaccines, Nature 451 (2008) 725e729. K. Schroder, M. Spille, A. Pilz, J. Lattin, K.A. Bode, K.M. Irvine, A.D. Burrows, T. Ravasi, H. Weighardt, K.J. Stacey, T. Decker, D.A. Hume, A.H. Dalpke, M.J. Sweet, Differential effects of CpG DNA on IFN-beta induction and STAT1 activation in murine macrophages versus dendritic cells: alternatively activated STAT1 negatively regulates TLR signaling in macrophages, J. Immunol. 179 (2007) 3495e3503. S.C. Cowley, K.L. Elkins, Multiple T cell subsets control Francisella tularensis LVS intracellular growth without stimulation through macrophage interferon gamma receptors, J. Exp. Med. 198 (2003) 379e389. A. Sjo¨stedt, R.J. North, J.W. Conlan, The requirement of tumour necrosis factor-alpha and interferon-gamma for the expression of protective immunity to secondary murine tularaemia depends on the size of the challenge inoculum, Microbiology 142 (1996) 1369e1374. C.A. Leifer, M.N. Kennedy, A. Mazzoni, C. Lee, M.J. Kruhlak, D.M. Segal, TLR9 is localized in the endoplasmic reticulum prior to stimulation, J. Immunol. 173 (2004) 1179e1183. P. Utaisincharoen, W. Kespichayawattana, N. Anuntagool, P. Chaisuriya, S. Pichyangkul, A.M. Krieg, S. Sirisinha, CpG ODN enhances uptake of bacteria by mouse macrophages, Clin. Exp. Immunol. 132 (2003) 70e75. G. Plitas, U.I. Chaudhry, T.P. Kingham, J.R. Raab, R.P. DeMatteo, NK dendritic cells are innate immune responders to Listeria monocytogenes infection, J. Immunol. 178 (2007) 4411e4416. K.L. Elkins, S.C. Cowley, C.M. Bosio, Innate and adaptive immune responses to an intracellular bacterium, Francisella tularensis live vaccine strain, Microbes. Infect. 5 (2003) 132e142. K.L. Elkins, C.M. Bosio, T.R. Rhinehart-Jones, Importance of B cells, but not specific antibodies, in primary and secondary protective immunity to the model intracellular bacterium, Francisella tularensis live vaccine strain, Infect. Immun. 67 (1999) 6002e6007. M.C. Lopez, N.S. Duckett, S.D. Baron, D.W. Metzger, Early activation of NK cells after lung infection with the intracellular bacterium, Francisella tularensis LVS, Cell. Immunol. 232 (2004) 75e85. J.R. Wickstrum, K.J. Hong, S. Bokhari, N. Reed, N. McWilliams, R.T. Horvat, M.J. Parmely, Coactivating signals for the hepatic lymphocyte gamma interferon response to Francisella tularensis, Infect. Immun. 75 (2007) 1335e1342. S.E. Blackwell, A.M. Krieg, CpG-A-induced monocyte IFN-gammainducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-alpha, J. Immunol. 170 (2003) 4061e4068. A. Krug, A.R. French, W. Barchet, J.A. Fischer, A. Dzionek, J.T. Pingel, M.M. Orihuela, S. Akira, W.M. Yokoyama, M. Colonna, TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function, Immunity 21 (2004) 107e119.