- Email: [email protected]
NKT Cell Defects in NOD Mice Suggest Therapeutic Opportunities
doi:10.1006/jaut.2002.0609, available online at http://www.idealibrary.com on
Journal of Autoimmunity (2002) 19, 117–128
NKT Cell Defects in NOD Mice Suggest Therapeutic Opportunities Anjli Kukreja1, Guilia Costi2, John Marker1, Chen Hui Zhang1, Sunil Sinha1, Zhong Sun1 and Noel Maclaren1 1
Weill Medical College of Cornell University, New York, NY 10021, USA; 2 Department of Pediatrics, University of Parma, Italy
Received 17 May 2002 Accepted 26 July 2002 Key words: autoimmunity, NKT cells, NOD mice, T-cell receptors, tolerance
Recent studies have reported that immunoregulatory NKT cells are defective in NOD mice and that treatment of mice with -galactosylceramide that selectively stimulate NKT cells, is anti-diabetogenic. The objective of this study was to document the natural history of changes in NKT cells in various organs in NOD mice in the period up to the time of diabetes onset so that novel intervention therapies could be devised. We found that NKT cell-specific receptor (NKT-TCR) V14J281 expressions by quantitative (RealTime) RT-PCR in thymus, spleen and liver of NOD male and female mice were low at 1–3 months of life compared to BALB/c and C57BL/6 mice, albeit a transient spike in levels occurred in female NOD livers at 2 months. Female pancreases showed low levels of these transcripts despite their active and destructive insulitis. In contrast, NOD males exhibited high expression of this invariant TCR in pancreas, where their insulitis was less destructive. A survey of NKT-TCR expressions in a battery of congenic, non-diabetes prone NOD strains indicated that this NKT phenotype was quite variable but higher than diabetes prone NOD. Bone marrow transplantation of NOD females from B6.NOD-H2g7 donors raised their NKT-TCR expressions. Tuberculin administrations in the forms of BCG and CFA in a manner known to protect NOD mice from diabetes both raised NKT-TCR levels, as did the anti-inflammatory PPAR- agonist rosiglitazone. These findings provide exciting therapeutic avenues to be explored in the treatment of human immune mediated type-1 diabetes where there are similar immunoregulatory lesions. © 2002 Published by Elsevier Science Ltd.
Introduction
peripheral tolerance to self antigens in autoimmune disease are poorly understood, defects at the level of antigen presenting cells or the regulatory T cells may contribute to the lack of self-tolerance to pancreatic beta cell self antigens [6–9]. T cells associated with maintenance of immune tolerance (Treg cells) include immunoregulatory (CD4+) T cells that constitutively express IL-2R (CD25+) and natural killer T cells (NKT cells). NKT cells comprise a small cytokine rich T-cell subset, that is either CD4+CD8− or double negative (DN) CD4−CD8−, and characterized by mature (memory) phenotypes and functional capabilities [10]. NKT cells have an invariant +TCR repertoire and are restricted by the non-classical MHC class I-like CD Id molecules, [11] which present glycolipid rather than peptide antigens [12, 13]. NKT cells are part of the innate immune system, which plays a major role in immunity to infectious agents and tumors. As the earliest responding T cells, NKT cells are components of a first line of defense that modulate the upcoming adaptive immune responses by releasing a set of effector cytokines following their in-vivo activation.
Immune mediated (type-1) diabetes (IMD) is a serious, incurable prototypic autoimmune disease [1] that continues to rise in incidence in the industrialized countries of the world [2]. Evidence from association and linkage studies suggest that the disease results from one strong and multiple weak predisposition genes interacting with strong environmental influences [3]. Such genes likely encode defects in normal immune tolerance mechanisms. Susceptibility to diabetes in the non-obese diabetic (NOD) mouse model of IMD involves complex polygenic quantitative traits in the required presence of their unusual H2g7 (Kd, Ag7, Enull, Db) [4, 5] haplotype while diabetes frequencies generally decrease with decreasing sterility and/or a variety of immuno-stimulations. While the mechanisms causing breakdown of either central or Correspondence to: Noel Maclaren MD, Department of Pediatrics, and Immunology Program, Weill-Cornell College of Medicine, 1300 York Avenue, Room LC-623, New York, New York 10021, USA. Tel.: 212-746-1894; Fax: 212746-1185; E-mail: [email protected] 117 0896–8411/02/$-see front matter
© 2002 Published by Elsevier Science Ltd.
118
NKT cells are found in thymus, liver, spleen and bone marrow, but are uncommon in lymph nodes and gut [10, 14–17]. Besides their role as effectors, NKT cells have been implicated in the regulation of autoimmune conditions. Mice prone to develop nuclear autoantibodies and lupus nephritis have been shown to lose numbers of NKT cells with aging when their autoimmune diathesis becomes evident [18], while mice prone to experimental allergic encephalomyelitis have serious functional defects in NKT cells [19]. Various reports in NOD mice [8, 20, 21] and BioBreeding (BB) rats [22] and in humans [23, 24] associate the dysfunction of NKT cells to diabetes susceptibility, and conversely, the increase of NKT cell activity in animal models to protection from autoimmunity. However, none of these studies in animal models have used markers that are specific for murine NKT cells; i.e., their invariant TCR V14J281. Thus low numbers of CD4−/CD8− (double negative or DN) T cells were reported in the thymi and spleens of NOD mice, a cell population enriched in NKT cells. When enriched populations of such cells were adoptively transferred into NOD mice, the diabetes rate fell [8] suggesting that the increased numbers of NKT cells might have corrected a regulatory deficiency. Another group used a transgenic approach to over-express the canonical TCR of NKT cells in NOD mice, resulting in elevations in NK1.1+ T cells and reduced diabetes rates [25]. Whereas a monoclonal antibody specific for the NK1.1 allotypic marker is used together with CD3 staining to enumerate murine NKT cells, this is impossible in NOD mice since NK1.1 is not expressed by them. Thus earlier studies suggesting that NOD mice are numerically and functionally deficient in NKT cells have relied upon a combination of markers for T cells and for NK cells other than NK1.1. We undertook this study to document NKT cell status in NOD mice using specific molecular assays, to learn how the defect evolves in association with insulitis and diabetes, and to test whether NKT cell numbers can be rescued therapeutically. We report here that NOD/LtJ mice express fewer NKT TCR transcripts (NKT TCR) than C57BL/6J and BALB/cJ mice in multiple tissues, and hypothesize that the NKT cell deficiencies appear to result from a dendritic cell (DC) or T-cell progenitor disorder, since the NOD NKT cell defect was correctable with allogeneic bone marrow transplantation. Further we demonstrate here that interventions known to abrogate NOD diabetes specifically result in increased expression of NKT cell transcripts.
A. Kukreja et al.
C57BL/6J, and BALB/cJ female mice were purchased from The Jackson Laboratory, Bar Harbor Maine. TCR J281 −/− knockout mice were kindly provided by Dr Steven Porcelli [26]. The B6.NOD-H2g7 congenic stock maintained at The Jackson Laboratory is that previously described by Yui et al. [27]. NOD-related mice from six recombinant congenic stocks derived at first backcross (to CBA/J) following an outcross of NOD/Lt to CBA/J have been described previously [28]. These recombinant congenic strains, also from The Jackson Laboratory, are designated NOcCB-1, CBcNO-6, CBcNO-7A, CBcN07B, CBcNO-7C, and CBcNO-7D. These strains are all diabetes free and resistant to cyclophosphamide-induced diabetes, despite containing 50–60% NOD alleles, including the diabetogenic H2g7 haplotype.
Intervention studies Groups of 4 NOD female mice were treated with one of six interventions while all study mice had tissue RNAs harvested at 12 weeks of age. One group received 150 g BCG, administered ip. by a published protocol that protects against diabetes [29]. Another group was treated with an emulsion of 50 l complete Freund’s adjuvant (CFA) in 50 l saline, which was delivered into each hind footpad at 4 and 7 weeks of age, a protocol also known to powerfully prevent diabetes [30]. Leishmania donovani (L. donovani) was administered to a third group via intravenous tail injection at a dose of 15×106 parasites per 200 l saline at 4 and 6 weeks of age since it induces massive expansion of macrophages with splenomegaly in resistant strains of mice [31]. A fourth group was treated with rosiglitazone (Avandia), 0.8 mg/mouse (40 mg/kg) a peroxisome proliferator activated receptor gamma (PPAR) agonist. Treatment was on alternative days by oral gavage, beginning at 7 weeks of age and continuing until time of sacrifice. Another group received a placebo gavage. Finally, bone marrow reconstitutions were done on a sixth group of NOD female mice from B6.NOD-H2g7 congenic donors. Marrow tissues were harvested from the femurs of 4 mice and suspended in PBS, and 15×106 of these cells/mouse were administered iv to 4 recipient NOD mice. When sacrificed, spleen, thymus, liver, pancreas, and bone marrow were harvested for total RNA extraction for real-time RT-PCR analyses.
Sequencing study of NOD NKT cell receptors
Materials and Methods Mice All studies were performed in accordance with the institutional guidelines for the animal care. All studies involved groups of 4 mice for each RT-PCR tissue observation made. Male and female NOD/LtJ mice,
Total RNAs were extracted from the spleen, thymus, pancreas, bone marrow, and liver of NOD as well as C57BL/6 mice using Trizol (Invitrogen) and cDNAs of the invariant canonical TCR chain were generated by RT-PCR using the following primers: (5′V14) 5′ CTAAGCACAGCACGCTGCACA-3′; (5′C) 5′ GAA GCTTGTCTGGTT GCTCCAG-3′; and (5′J281) 5′ CAGGTATGACAATCAGCTGAGTCC-3′. These PCR products were cloned into PCR Script vector from
Immunoregulatory T cells in immune mediated diabetes in NOD mice
Stratagene. DNA sequencing was performed using the sequencing kits, a sequencing primer and an automated ABI 377 DNA sequencer. Quantitative RT-PCR analyses in NOD mice NKT cells in mice are characterized by the presence of the canonical V14J281 TCR. The Taqman quantitative RT-PCR technology (ABI PRISM 7700) was used for relative quantification of this TCR expression. With this sensitive technology, we also studied the expressions of CD1.1, LFA-1, annexin-V and caspase-9 using specific primers and probes. Total RNA was extracted from the tissues of NOD, J281−/−, BALB/c, and C57BL/6 mice using Trizol reagent (Invitrogen). The RNA was treated with DNAse and the cDNAs were generated by first strand synthesis reaction using oligo-dT [12–18] primers and Moloney murine leukemia virus-reverse transcriptase under optimized conditions as previously described [32]. Using Primer Express software, the optimized primers and probes selected were: The primers and probe for V14J281 TCR were: Forward primer (V14) 5′ GTGTGGTGGGCGATAGA GGT 3′ Reverse primer (J281) 5′ ACAACCAGCTGAGTCC CAGC 3′ TCR Probe: 6-FAM 5′ CAGCCTTAGGGAGGCTGC ATTTTGG 3′ TAMRA. The primers and probe used for CD1.1 were: Forward primer 5′ GATAACTCCAAGGGCCTCCAA 3′ Reverse primer 5′ CATAGAGACTGTGTCCTAAGAT GGTCA 3′ CD1.1 Probe 6-FAM 5′ TTGTGGCTCTTTTAATAAT GTTTGTTCTAAATGCCA 3′ TAMRA. The primers and probe used for LFA-1 were: Forward primer 5′GGCTACCCGCTTGGTCG 3′ Reverse primer 5′ CCTATCCCCATTGATGTCCG 3′ LFA-1 Probe 5′ FAM-TTTGGAGCCGCCATAACTG CCCT 3′-TAMRA We then measured the above transcripts (labeled with FAM dye) relative to the endogenous housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (labeled with VIC dye). Forward primer (GAPDH) 5′ ACTGGCATGGCCT TCCG 3′ Reverse primer (GAPDH) 5′ CAGGCGGCACGTCAG ATC 3′ GAPDH Probe VIC 5′ TTCCTACCCCCAATGTGTCC GTCGT 3′TAMRA Comparative Ct method The Comparative Ct method was used to quantify various transcripts to the control endogenous gene
119
GAPDH that is expressed in all tissue samples. GAPDH Ct values did not vary between tissue types or treatment. The following formula was used to calculate the target gene copy number as normalized to corresponding GAPDH expression: 2 −(Ct), where Ct=[Ct of Target molecule−Ct of GAPDH), Ct represents subtraction of a Ct value by the Ct calibrator value, which in this instance was the 3 month female NOD value for each respective organ.
Results Assay validation Our sequencing studies for the invariant NKT-TCR transcripts in NOD and C57BL/6 livers were found to be identical. Further, NKT cell-specific V14J281 TCR was readily detected in NOD, C57BL/6 and BALB/c mice by Real-Time RT-PCR method but not in the J281−/− mice as expected. The inter-assay and intraassay variabilities in Ct values for a control cDNA sample respectively were 0.023 and 0.029 for GAPDH, 0.029 and 0.026 for NKT TCR, 0.039 and 0.017 for LFA-1, 0.01 and 0.029 for caspase-9, 0.022 and 0.033 for annexin V, and 0.032 and 0.02 for CD 1.1 The natural history of NKT cell expression in NOD mice Thymi, spleens, livers, pancreata and bone marrows were collected from NOD males and females, C57BL/6 females and BALB/c females and studied at l, 2 and 3 months of age. We observed that the invariant NKT-TCR expression was dynamic being tissue, gender, and age dependent (Figure 1). There were striking differences in NKT-TCR levels in the pancreata of male and female NOD mice (Figure 1a). Pancreata of NOD females exhibited significantly reduced frequencies of NKT TCR as compared to pancreata of NOD males at all time points. As expected, pancreatic NKT TCR expression of control non-diabetes prone C57BL/6 and BALB/c mice that had no insulitis was low, and comparable to the low levels observed in pancreata of NOD females with insulitis. There was considerable age-associated variability evident in NKT-TCR transcripts in the liver. NOD levels were significantly reduced from those in the two control strains matched for age and sex (Figure 1b), with the exception of a significant transient increase in NOD females at 2 months of age that was not seen in NOD males. However by 3 months of age, when the first female mice are soon to develop diabetes, the NKT-TCR levels had fallen significantly below those of control mice. By 4 and 6 months, there was a modest increase in hepatic expression of NKTTCR in diabetic NOD females (data not shown). The control mice, on the other hand had increased expressions of NKT-TCR by 2 and 3 months of age compared to levels at 1 month, with all control levels being significantly increased over NOD, except when
120
A. Kukreja et al.
Figure 1. The panels show the levels of NKT cell canonical receptor transcripts in (a) pancreas (b) liver (c) spleen and (d) thymus with the bars representing the mean±1 SEM levels of 4 mice normalized to GAPDH transcript levels. Female NOD mice had significantly reduced NKT-TCR levels from the control mice (b,c,d) while male NOD mice had significantly higher expression than NOD female mice in the pancreas (a).
compared to 2-month-old NOD females. Reductions of splenic expressions of NOD NKT cells were less evident yet significant in female NOD mice (Figure 1c) than for livers at all time points. The thymic data showed NOD female and male NKT-TCR deficiencies at all ages (Figure 1d), in sharp contrast to the normal age-related rise in NKT cells in the thymi of the control females. These control data confirm the earlier suggestion of age-dependent increases of NKT cells in the thymus previously reported by indirect measurement of DN T cells [8]. NKT cells in diabetes resistant congenic NOD mice In an attempt to identify genetic loci associated with the NKT cell defect, we compared expression of the canonical TCR V14J281 expression in liver, spleen, and thymus from NOD to that of C57BL/6J, BALB/c and B6.NOD-H2g7 females aged to 3 months, since this was the age when the NOD defect was consistently expressed. We also analyzed this clonotypic
expression in a series of six recombinant congenic stocks sharing H2g7 identity with NOD. These mice are strongly resistant to intra-islet insulitis and diabetes [30]. The results are summarized in Table 1. We found that hepatic expression in all congenic/ recombinant congenic mice was significantly greater than in NOD. The expression data (with NOD set at ‘1’) show that H2g7 was not a major modifier in either liver or spleen (data not shown). Among the six recombinant congenic stocks, CBcNO-7D most resembled C57BL/6J in terms of expression level in various organs. Genome scans show that this line shares all markers present in CBcNO-7A, -7B, and -7C with the exception of segments of Chr. 10 and Chr 12, where CBcNO-7D has CBA alleles and the other three strains have NOD alleles. Interestingly, 3-month-old females from the NOcCB-1 strain, which shows the highest degree of genome sharing with NOD, exhibited NODlike low expression in spleen, but not in liver. Thymic expression levels among all strains were considerably more variable such that no genetic conclusions could be drawn based upon this tissue (data not shown). Thus there was no NOD genomic interval that
Immunoregulatory T cells in immune mediated diabetes in NOD mice
Table 1. The mean±1 SEM expression ratios of NKT-TCRs normalized to GAPDH expressions in congenic mice are shown relative to that in 3-month-old female NOD mice. Expressions in the liver show all mice to be significantly greater than that in the NOD mice Strain B6 NOD-H2g7 NO-CB1 CBcNO-6 CBcNO-7A CBcNO-7B CBcNO-7C CBcNO-7D NOD C57BL/6
Liver 16.4±4.91* 11.5±1.43* 8±1.35* 12±0.89* 8.4±0.7* 11.5±1.85* 16.4±0.7* 1 22.58±1.73*
*P<0.01 as compared to NOD.
mapped the NOD NKT cell defect expressed in the most informative tissue, the liver. Expression of CD1.1 in various organs Whereas the NKT cell deficiency in NOD mice was confirmed, the reasons for it were not. Since NKT cells are CD1d restricted by glycolipid presentation by antigen presenting cells (APCs), we next studied effect of age on the expression of CD1.1. However, we found no differences in the expression of CD1.1 in various NOD organs as compared with control nonautoimmune prone mice (data not shown). In an attempt to stimulate tissue macrophages/DCs to learn whether they would in turn stimulate NKT cells indirectly, we infected NOD females with L. donovani without any increase in NKT-TCRs as covered below. Thus we could show no evidence of a possible abnormality of CD1d expression on APCs to explain the NOD NKT cell defect. We did not measure CD1.2 transcript levels. LFA-1-dependent maturation of NKT cells Since LFA-1 is required for the development of liver NKT cells [33], we next studied its expression in all tissues (Figure 2) already studied for NKT cells (Figure 1). In the pancreas there was a significant decrease in LFA-1 at three months of age in female mice (Figure 2a) compared to their male counterparts. Similarly, LFA-1 expressions were low in livers, spleens and thymi at various time points in female NOD mice. Furthermore, in both the spleen (Figure 2c) and thymus (Figure 2d), there was a significant increase in the expression of LFA-1 in male NOD mice at 1, 2, and 3 months of age over both female NOD and mice of the non-diabetes prone control strains. Thus NOD females exhibited statistically significant deficiencies in LFA-1 expression, as compared to male NOD and age matched control mice. Since LFA-1 has been shown to have a role in regulation of leukocyte
121
adhesion to endothelium and extravasation [34, 35] and T-cell co-stimulation during activation [36] besides specific effects on NKT cell development and homing as discussed above, we speculate that LFA-1 deficiency observed in female NOD mice might effect the development, migration or the functions of NKT cells. NKT cell expansions with various interventions Since deficiency of NKT cells paralleled the risk of diabetes in various NOD mice, we next studied pharmacological approaches which are known to protect against NOD diabetes, since if they stimulated NKT cells to expand in numbers and release potentially protective cytokines, this might have explained their beneficial effects. We show herein for the first time, that BCG vaccine does in fact increase NKT cell numbers in various organs, especially in the pancreas (Figure 3a). The stimulatory effect from tuberculin antigen was generally greater in the other tissues when CFA was given, especially in liver and spleen (Figure 3b & c). Since the NKT cells defect could result from a primary problem with APCs [37], we next attempted to stimulate NKT cells by infecting NOD mice with L. donovani since it is known to powerfully induce macrophage/DC activation and proliferation. Leishmania infection did not reduce the frequencies of diabetes (data not shown), nor was there any increase in NKT TCR levels (Figure 3b, c, and d), indicating NKT cell specificity for the above tuberculin-based stimuli. Importantly, bone marrow transplantation of the female NOD mice at 4 and 7 weeks of age from congenic B6.NOD-H2g7 donors drastically improved their NKT cell expressions at 3 months of age in livers and spleens. Diabetes-resistant congenic B6.NODH2g7 mice were used as donors since they lacked NKT cell defect seen in NOD females (Table 1). Finally, rosiglitazone (Avandia) was given to female NOD mice since it is a common class of drug used to treat type-2 diabetes which is also a powerful antiinflammatory agent acting through suppression of NfB and stimulation of IB in monocytes associated with a fall in peroxisome proliferator-activated receptor (PPAR-) and rise in PPAR- [38]. Troglitazone has been shown to attenuate the expression of experimentally induced encephalitis in C57BL/6 mice [39]. Rosiglitazone treatment mediated a striking increase in NKT-TCRs, specifically in the liver (Figure 3b). Thus it is may be possible to use NKT cell stimulation rather than T-cell suppression to treat autoimmune disease such as IMD. All of the mice were normoglycemic when studied (Figures 3 and 4) except for untreated control mice and those infested with Leishmania donovani. Since LFA-1 has been shown to be required for the development of the liver NKT cells [33], we next studied the effect of these interventions on LFA-1 expression, that protect NOD mice from diabetes by increasing NKT cells as described above. Increased LFA-1 transcripts expression was observed in BCGimmunized (pancreas and spleen) and bone marrow
122
A. Kukreja et al.
Figure 2. The panels show the mean±1 SEM levels of LFA-1 transcripts in (a) pancreas (b) liver (c) spleen and (d) thymus with the bars indicating the mean of 4 mice normalized to GAPDH expression. Significantly reduced levels were found in the diabetes prone NOD female mice.
recipients (pancreas, liver and spleen) following the increased NKT TCR expression pattern as a result of the interventions (Figure 4).
Discussion While recent studies have thrown light on mechanisms of peripheral regulation of adaptive immune responses mediated by NKT cells, we affirm here that the NOD mouse is deficient in NKT cells as assessed by a quantitative and specific molecular transcription assay. This defect may be part of an underlying thymic disorder in generating and/or exporting these cells to the periphery. This idea is supported by the positive results from our bone marrow transfer studies, which suggest an intrinsic defect in bone marrow derived progenitor-T cells and the diminished expression of LFA-1 in the study tissues. Whereas much of what is known about NKT cells has been derived from NK1.1-expressing C57BL/6 mice, the marker is found in only a subset of inbred mouse strains that express an allelic form of NK1.1 (among which are B6, NZB, and SJL) detectable by the
commercially available mAb PK136 [10]. Even in these mice, activated NK1.1+ T cells may down-regulate their own NK1.1 expression, making it difficult to follow these cells after their stimulation [40]. Because NK1.1 is also expressed on CD1d-independent T cells [41], most peripheral (splenic) DN T cells do not express NK1.1 even in C57BL/6 mice nor are they very biased towards V8.2 expression [42]. Assuming that a similar heterogeneity exists in NOD mice, much of the DN cells in spleen and lymph nodes represent non-NKT cells. NOD NK1.1 congenic mice that selectively express the NK1.1 marker on NK and NKT cell subsets [43–45] have been produced to obviate these analytical difficulties. Such mice manifest reduced diabetes incidence and improved NK and NKT cell performances as compared to wild type NOD mice. However we show here in wild type NOD mice an unambiguous deficiency in NKT cells specifically defined by their V14J281 transcripts in various organs in the absence of the NK1.1 allotypic marker. NKT cells are potent cytotoxic T cells that may have potential as mediators of cancer containment [26, 46] or regulators of self-tolerance [37, 47]. Our findings in NOD mice suggest that NKT cells are protective
Immunoregulatory T cells in immune mediated diabetes in NOD mice
123
Figure 3. The panels depict the effects of five different interventions on the levels of NKT-TCRs expressed at 3 months of age in female NOD mice in (a) pancreas (b) liver (c) spleen and (d) thymus. The bars represent the mean±1 SEM levels of 4 mice normalized to GAPDH expression. Whereas only BCG increased pancreatic expression, all interventions increased transcription in the other tissues except for infection with L. donovani.
tolerogenic cells in that they are overtly deficient in autoimmune prone NOD mice; there were increased numbers of pancreatic NKT cells in relatively diabetes resistant NOD males but they were essentially absent from the pancreata of highly diabetes prone NOD females despite their early and vigorous insulitis as has also been suggested by Naumov et al. [37]. Expression of normal levels of the canonical V14J281 NKT-TCR in liver and spleen cells in diabetes resistant recombinant congenic strains in which the MHC and at least 50% of the non-MHC markers tested were derived from NOD indicates the complex, non-MHC dependent genetic control of the defect in NOD. It is interesting to note that certain of the recombinant congenic lines would be expected to express CBA-derived genes adjacent to and including the Cd1 complex on Chromosome 3. The Cd1 locus is at 48 cM, and while CBcNO-7C is homozygous for CBA markers both proximal (Fcgr1, 45.2 cM) and distal (Amy1, 50.0 cM), it should carry the CBA-derived Cd1 complex. In contrast, CBcNO-7B and -7D carry NOD markers across this interval. CBcNO-7A carries the NOD allele at Fcgr1 and the CBA allele at Amy1 so that the origin of its Cd1 allele is indeterminate at this point. However, data in Table 1 indicate that allelic
variation in this segment of Chromosome 3 is not responsible for the increased hepatic expression of the V14J281 NKT-TCR in the recombinant congenic panel. The strains all appear to have inherited from the NOD progenitor the cluster of genes encoding the NK1 antigen (Nk1, 62.7 cM) and NK function receptors (Nkrp1 at 62.1 cM) on Chromosome 6, so these loci also are not implicated in the expression differences distinguishing the recombinant congenic strains from the parental NOD strain. Further, treatment of prediabetic NOD mice with IL-7 reportedly enhances NKT function [48]. All six recombinant congenic lines have a CBA-derived gene encoding IL-7 (Il7, 6.6 cM) on proximal Chromosome 3 based upon CBA origin of proximal and distal flanking markers at 2.4 cM and 10.5 cM respectively. Further, the NOcCB-1 and CBcNO-6 strains, but not the CBcNO-7 series, would be expected to express the CBA allele of the IL-7 receptor (Il7r, Chromosome 15). Possibly, IL-7 levels and/or signalling properties may in part account for the more normal development of the NKT population in certain of these NOD-related strains. The mechanism involved in the NKT cell deficiency in NOD mice needs to be explained. When DN thymocytes were transferred to NOD mice and
124
A. Kukreja et al.
Figure 4. The panels depict the effects of five different interventions on the levels of LFA-1 transcripts expressed at 3 months of age in female NOD mice in (a) pancreas (b) liver (c) spleen and (d) thymus. The bars represent the mean±1 SEM levels normalized to GAPDH expressions. All interventions increased LFA-1 expression in various organs following the increased NKT-TCR expression pattern as a result of these interventions.
showed protection from diabetes, Baxter et al. inferred that it was due to transfer of the NKT cells [8], albeit they used F1 mouse donors that could have induced a graft versus host response (GVHR). Similarly, LaFace [49] showed that allogeneic bone marrow transplantations to lethally irradiated NOD mice were antidiabetic while syngeneic bone marrow transplantation of the irradiated thymectomized mice gave rise to NKT cells in various organs including the liver [50]. Still others have shown that bone marrow transplants protect the NOD mouse from diabetes [51, 52]. We performed the experiment with MHC compatible bone marrow and showed that NKT cell numbers generated from B6.NOD-H2g7 marrow precursors could be greatly increased this way. As above, these donors have normal NKT cell TCR transcript expressions. Our studies of the natural history of prediabetic events showed that repositories of NKT cells are deficient in NOD mice, suggesting that production of these cells is defective. However our findings indicate that the NOD thymic epithelial cells that expand T cells in context of MHC cannot be responsible for the NKT cell defect. That leaves two possibilities. First that the bone marrow transplants replaced medullary
macrophages in the thymus which in turn expanded NKT cells or replaced bone marrow T-cell precursors which in turn were expanded in the NOD thymus. In respect to the former possibility, we found that CD1.1 transcripts to be normal while stimulation of macrophages by L. donovani did not induce NKT cells to rise (they actually fell), results that offer no support that the NKT problem is due to defective antigenic stimulation. However our studies herein cannot confirm one over the other of these two possibilities. The transient increase in the numbers of these cells in the female liver at 2 months of age (the results were reproducible), could have been due to their aggregation by a ‘graveyard’ phenomena [53], albeit we were unable to confirm increased apoptosis of these cells in this site through measurement of annexin V or caspase 9 transcripts (data not shown). This area needs further investigation, possibly by specifically studying apoptosis markers (annexin V) for NKT cells isolated by use of -Ga1Cer loaded CD1d tetramers. Furthermore, it has been suggested that liver NK1.1+ NKT cells have a high death rate, and migrate from the liver where they undergo phenotypic changes [54]. Since intra-hepatic population of NKT cells is cytotoxic through both Fas ligand-mediated and
Immunoregulatory T cells in immune mediated diabetes in NOD mice
perforin-mediated mechanisms, we speculate that initially NKT cells undergo expansion around 2 months of age in response to the rise in islet cell autoreactive T cells, but that during this process they die themselves leaving the undefended NOD mice to develop diabetes. Furthermore, deletion of liver NKT cells occurs within 1 day after the administration of IL-12 [55]. We hypothesize that in NOD mice, a biased Thl type response (more IL-12 and IFN) leads indirectly to deletion of NKT cells and diabetes by 3 months of age. Interestingly, we found that expression of LFA-1 was also defective in NOD mice at peripheral sites, especially in the pancreas of female mice. LFA-1 (CD11a/18) is a member of 2 integrin family of cell adhesion molecules that is expressed exclusively on leukocytes, including T cells, and is involved in cell migrations into tissues expressing ICAM-1 [56]. NKT cells in thymus and lymph nodes express high levels of LFA-1 as they do in liver [57]. On the other hand however, it has been reported that LFA-1 is also expressed on liver cells other than NKT cells and may play a pivotal role in accumulation of immunoregulatory cells in liver [58]. Thus LFA-1 may play a role in trafficking to or retention of CD4+ NKT cells by the liver, or their proliferation once there. In contrast Moriyama et al. [59] and Bertry-Coussot et al. [60] have shown that the transient blockade of LFA-1/ICAM pathway leads to induction of tolerance and long term reversal of established autoimmunity in NOD mice. However in our natural history study, we have shown that like NKT cell expression, LFA-1 expression is also reduced in various organs and upon immunization of the NOD mice with interventions that prevent the disease, increase both NKT cell as well as LFA-1 transcript expressions. This suggests the specificity of LFA-1 expression for NKT cells mediating their migration to various organs. By contrast, the studies of Monyama et al. [59], and Bertry-Coussot et al. [60], showed that diabetes could be prevented by LFA-1 blockade, indicating that positive expression of LFA-1 has been involved in the migration of effector T cells that mediate cell damage. We suggest that the findings are not mutually exclusive. It remains unknown how NKT cells mediate tolerogenesis to self, albeit these cells are cytokine rich and could be involved in supporting a Th2 response that is generally associated with protective immunomodulatory strategies rather than a Thl anti-islet response constituent of a destructive insulitis [61]. This simple hypothesis however, is unlikely to provide a complete explanation for NKT cell mediated tolerogenesis since murine NKT cells secrete quantities of both INF- and IL-4, while Falcone et al. found impaired rather than enhanced INF- secretion from NOD splenocytes enriched for NKT cells [62]. In our published patient studies, we likewise found that IMD patient T cells like that of NOD mice had a reduced ability to secrete INF in response to PMA plus calcium ionomycin stimulation in vitro. Furthermore, two recent studies suggest functionally distinct subsets of NKT cells as identified by using alpha-galactosylceramide (-Ga1Cer)-loaded CD1d tetramers. Whereas DN
125
NKT cells have a strict Thl profile, CD4+ NKT cells exclusively produce IL-4 and IL-13 on primary stimulation [63, 64]. It remains to be seen if these lineages are differentially altered in type-1 diabetes. Another report has alternatively suggested that NKT cell mediated immune suppression may be mediated through dendritic cells (DCs), especially those in the regional pancreatic lymph nodes [37]. We did not study this attractive possibility ourselves. There may be a therapeutic potential for glycolipid antigenic agents that stimulate NKT cells to mitigate against autoimmune diseases. To date, the only antigen known to stimulate isolated NKT cells in the context of CD1d is -Ga1Cer. Three separate groups have now shown protection when the agent is administered directly to the mice [47, 65] while another group has shown protection when DCs are exposed to -Ga1Cer in vitro before being reinfused to NOD recipients [37]. In all cases, protection against diabetes could be demonstrated, an effect which was less evident with mice as they aged [65]. Boitard had previously shown that the efficiency of splenocyte transfer of diabetes became progressively reduced with aging of the donor mice [66]. We could show herein, that over time, non-diabetic NOD mice gained NKT cells associated with a diminished tendency to develop overt diabetes (data not shown). We now add to the therapeutic possibilities of NKT cell stimulation, by showing that NKT cell numbers were greatly improved in vivo by tuberculin administration in the form of BCG or CFA, interventions that are well known to be anti-diabetic [29, 67]. Whereas there may be a glycolipid in the membrane of the organism that stimulates NKT cells, the rise in NKT cells in vivo may have an indirect explanation. The specificity of this mycobacterial antigenic effect was shown by our negative results with Leishmania. The infection showed a decrease in the canonical NKT-TCR expression in all organs. The effect we believe is possibly due to induction of IL-12 post infection [68] leading to IL-12 mediated death of NKT cells [55]. Our positive results on NKT cell numbers after rosiglitazone treatments were intriguing, especially since adults with late onset type-1 diabetes are often thought to have type-2 diabetes and may receive a PPAR- agonist [69]. While there is a perturbation in multiple cytokines with this agent the mechanism of action for its effect on NKT cells needs to be explored. In summary, we demonstrate here that NOD mice are deficient in NKT cells like their human counterparts, and provide suggestive evidence that these defects may be part of a more generalized bone marrow progenitor disorder as suggested by Yang et al. [70]. The genetic complexity underlying control of this NKT cell defect did not permit identification of controlling loci by studying recombinant congenic stocks containing NOD MHC as well as NOD alleles at multiple other loci. It appears likely that the defect while not absolute is inherent, albeit likely influenced by the environment. The therapeutic possibilities from approaches that are immuno-stimulatory to NKT cells in treating or preventing autoimmune diseases like type-1 diabetes appear exciting and immediately
126
A. Kukreja et al.
embraceable through clinical trials of appropriate immunostimulatory vaccines [71]. 13.
Acknowledgements We thank Dr Edward Leiter (The Jackson Laboratory, Bar Harbor) for kindly supplying the NOD-related congenic and recombinant congenic mice and for his critical reading of the manuscript. We also thank Dr Steven Porcelli (Albert Einstein College of Medicine, New York, NY) for kindly supplying J281−/− mice. This work was supported through an Innovation Grant (7-01-IN-06) from the American Diabetes Association. A.K. was supported by a fellowship grant (3-1999-768) from the Juvenile Diabetes Foundation.
References 1. Maclaren N.K., Kukreja A. 2000. Type 1 Diabetes. In The Metabolic and Molecular Bases of Inherited Disease, Vol. II, 8th edition M.D. William, S. Sly, eds. McGraw-Hill, St Louis, pp. 1471–1488 2. Atkinson M.A., Eisenbarth G.S. 2001. Type 1 diabetes: new perspectives on disease pathogenesis and treatment. Lancet 358: 221–229 3. Todd J.A., Bell J.I., McDevitt H.O. 1987. HLA-DQ beta gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 329: 599–604 4. Quartey-Papafio R., Lund T., Chandler P., Picard J., Ozegbe P., Day S., Hutchings P.R., O’Reilly L., Kioussis D., Simpson E. 1995. Aspartate at position 57 of nonobese diabetic I-Ag7 beta-chain diminishes the spontaneous incidence of insulin-dependent diabetes mellitus. J. Immunol. 154: 5567–5575 5. Singer S.M., Tisch R., Yang X.D., Sytwu H.K., Liblau R., McDevitt H.O. 1998. Prevention of diabetes in NOD mice by a mutated I-Ab transgene. Diabetes 47: 1570–1577 6. Leiter E.H., Serreze D.V. 1992. Antigen presenting cells and the immunogenetics of autoimmune diabetes in NOD mice. Reg. Immunol. 4: 263–273 7. Serreze D., Gaskins H.R., Leiter E. 1993. Defects in the differentiation and function of antigen presenting cells in NOD/Lt mice. J. Immunol. 150: 2534–2543 8. Baxter A.G., Kinder S.J., Hammond K.J., Scollay R., Godfrey D.I. 1997. Association between alphabetaTCR+CD4−CD8− T-cell deficiency and IDDM in NOD/Lt mice. Diabetes 46: 572–582 9. Salomon B., Lenschow D.J., Rhee L., Ashourian N., Singh B., Sharpe A., Bluestone J.A. 2000. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12: 431–440 10. Bendelac A., Rivera M.N., Park S.H., Roark J.H. 1997. Mouse CD1-specific NKl T cells: development, specificity, and function. Annu. Rev. Immunol. 15: 535–562 11. Bendelac A. 1995. Positive selection of mouse NK1+ T cells by CD1-expressing cortical thymocytes. J. Exp. Med. 182: 2091–2096 12. Kawano T., Cui J., Koezuka Y., Toura L, Kaneko Y., Motoki K., Ueno H., Nakagawa R., Sato H., Kondo E.,
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Koseki H., Taniguchi M. 1997. CDld-restricted and TCR-mediated activation of valphal4 NKT cells by glycosylceramides. Science 278: 1626–1629 Schofield L., McConville M.J., Hansen D., Campbell A.S., Fraser-Reid B., Brusby M.J., Tachado S.D. 1999. CD1d-restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells. Science 283: 225–229 Ohteki T., MacDonald H.R. 1994. Major histocompatibility complex class I related molecules control the development of CD4+8− and CD4−8− subsets of natural killer 1.1+ T cell receptor-alpha/beta+ cells in the liver of mice. J. Exp. Med. 180: 699–704 Yankelevich B., Knobloch C., Nowicki M., Dennert G. 1989. A novel cell type responsible for marrow graft rejection in mice. T cells with NK phenotype cause acute rejection of marrow grafts. J. Immunol. 142: 3423–3430 Ballas Z.K., Rasmussen W. 1990. NK1.1+ thymocytes. Adult murine CD4−, CD8− thymocytes contain an NK1.1+, CD3+, CD5hi, CD44hi, TCR-V beta 8+ subset. J. Immunol. 145: 1039–1045 Sykes M., Hoyles K.A., Romick M.L., Sachs D.H. 1990. In vitro and in vivo analysis of bone marrow-derived CD3+, CD4−, CD8−, NK1.1+ cell lines. Cell Immunol. 129: 478–493 Mieza M.A., Itoh T., Cui J.Q., Makino Y., Kawano T., Tsuchida K., Koike T., Shirai T., Yagita H., Matsuzawa A., Koseki H., Taniguchi M. 1996. Selective reduction of V alpha 14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156: 4035–4040 Yoshimoto T., Bendelac A., Hu-Li J., Paul W.E. 1995. Defective IgE production by SJL mice is linked to the absence of CD4+, NK1.1+ T cells that promptly produce interleukin 4. Proc. Natl Acad. Sci. USA 92: 11931–11934 Gombert J.M., Herbelin A., Tancrede-Bohin E., Dy M., Carnaud C., Bach J.F. 1996. Early quantitative and functional deficiency of NK1+-like thymocytes in the NOD mouse. Eur. J. Immunol. 26: 2989–2998 Laloux V., Beaudoin L., Jeske D., Carnaud C., Lehuen A. 2001. NK T cell-induced protection against diabetes in V alpha 14-J alpha 281 transgenic nonobese diabetic mice is associated with a Th2 shift circumscribed regionally to the islets and functionally to islet autoantigen. J. Immunol. 166: 3749–3756 Iwakoshi N.N., Greiner D.L., Rossini A.A., Mordes J.P. 1999. Diabetes prone BB rats are severely deficient in natural killer T cells. Autoimmunity 31: 1–14 Wilson S.B., Kent S.C., Patton K.T., Orban T., Jackson R.A., Exley M., Porcelli S., Schatz D.A., Atkinson M.A., Balk S.P., Strominger J.L., Hafler D.A. 1998. Correction: Extreme Thl bias of invariant Valpha24JalphaQ T cells in type 1 diabetes. Nature 391: 177–181 Kukreja A., Costi G., Marker J., Zhang C., Sun Z., Lin-Su K., Ten S., Sanz M., Exley M., Wilson B., Porcelli S., Maclaren N. 2002. Multiple immuno-regulatory defects in type-1 diabetes. J. Clin. Invest. 109: 131–140 Lehuen A., Lantz O., Beaudoin L., Laloux V., Carnaud C., Bendelac A., Bach J.F., Monteiro R.C. 1998. Overexpression of natural killer T cells protects Valphal4-Jalpha281 transgenic nonobese diabetic mice against diabetes. J. Exp. Med. 188: 1831–1839
Immunoregulatory T cells in immune mediated diabetes in NOD mice
26. Cui J., Shin T., Kawano T., Sato H., Kondo E., Toura I., Kaneko Y., Koseki H., Kanno M., Taniguchi M. 1997. Requirement for Valphal4 NKT cells in IL-12-mediated rejection of tumors. Science 278: 1623–1626 27. Yui M., Muralidharan K., Moreno-Altamirano B., Perrin G., Chestnut K., Wakeland E. 1995. Production of congenic mouse strains carrying NOD-derived diabetogenic genetic intervals: an approach for the genetic dissection of complex traits. Mammalian Genome 7: 331–334 28. Reifsnyder P., Flynn J., Gavin A., Simone E., Sharp J., Herberg L., Leiter E. 1998. Genotypic and phenotypic characterization of six new recombinant congenic strains derived from NOD/Shi and CBA/J genomes. Mammalian Genome 10 29. Qin H.Y., Singh B. 1997. BCG vaccination prevents insulin-dependent diabetes mellitus (IDDM) in NOD mice after disease acceleration with cyclophosphamide. J. Autoimmun. 10: 271–278 30. Sadelain M.W., Qin H.Y., Sing B. 1990. Prevention of type 1 diabetes in NOD mice by adjuvant immunotherapy. Diabetes 39: 583–589 31. Murray H.W., Nathan C.F. 1999. Macrophage microbicidal mechanisms in vivo: reactive nitrogen versus oxygen intermediates in the killing of intracellular visceral Leishmania donovani. J. Exp. Med. 189: 741–746 32. Gorski J., Wassai M., Zhu X., Kissela B., Keever C., Flomenberg N. 1994. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping. Correlation with immune status. J. Immunol. 152: 5109–5119 33. Ohteki T., Maki C., Koyasu S., Mak T.W., Ohashi P.S. 1999. Cutting edge: LFA-1 is required for liver NK1.1+TCR alpha beta+ cell development: evidence that liver NK1.1+TCR alpha beta+ cells originate from multiple pathways. J. Immunol. 162: 3753–3756 34. Staunton D.E., Dustin M.L., Springer T.A. 1989. Functional cloning of ICAM-2, a cell adhesion ligand for LFA-1 homologous to ICAM-1. Nature 339: 61–64 35. Wang J.H., Springer T.A. 1998. Structural specializations of immunoglobulin superfamily members of adhesion to integrins and viruses. Immunol. Reviews 163: 197–215 36. Green J.M., Thompson C.B. 1994. Modulation of T cell proliferation responses by acessory cell interactions. Immunol. Research 13: 234–243 37. Naumov Y.N., Bahjat K.S., Gausling R., Abraham R., Exley M.A., Koezuka Y., Balk S.B., Strominger J.L., Clare-Salzer M., Wilson S.B. 2001. Activation of CD 1 d-restricted T cells protects NOD mice from developing diabetes by regulating dendritic cell subsets. Proc. Natl Acad. Sci. USA 98: 13838–13843 38. Aljada A., Ghanim H., Friedman J., Garg R., Mohanty P., Dadona P. 2001. Troglitazone reduces the expression of PPAR gamma while stimulating that of PPAR alpha in mononuclear cells in obese subjects. J. Clin. Endocrinol. Metab. 86: 3130–3133 39. Niino M., Iwabuchi K., Kikuchi S., Ato M., Morohashi T., Ogata A., Tashiro K., Onoe K. 2001. Amelioration of experimental autoimmune encephalomyelitis in C57BL/6 mice by an agonist of peroxisome proliferator-activated receptor gamma. J. Neuroimmunol. 116: 40–48
127
40. Chen H., Paul W.E. 1998. A population of CD62L low Nk1.1-CD4+T cells that resembles NK1.1+CD4+ T cells. Eur. J. Immunol. 25: 3172–3182 41. Eberl G., Lees R., Smiley S.T., Taniguchi M., Grusby M.J., MacDonald H.R. 1999. Tissue-specific segregation of CD Id-dependent and CD 1d-independent NK T cells. J. Immunol. 162: 6410–6419 42. Zlotnik A., Godfrey D.I., Fischer M., Suda T. 1992. Cytokine production by mature and immature CD4−CD8−T cells. Alpha beta-T cell receptor+ CD4−CD8− T cells produce IL-4. J. Immunol. 149: 1211–1215 43. Carnaud C., Gombert J., Donnars O., Garchon H., Herbelin A. 2001. Protection T cell performance in NOD.NK1.1 mice congenic at the NK, complex. J. Immunol. 166: 2404–2411 44. Poulton L.D., Smyth M.J., Hawke C.G., Silveira P., Shpherd D., Naidenko O.V., Godfrey D.I., Baxter A.G. 2001. Cytometric and functional analyses of NK and NKT cell deficiencies in NOD mice. Int. Immunol. 13: 887–896 45. Hammond K.J., Pellicci D.G., Poulton L.D., Naidenko O.V., Scalzo A.A., Baxter A.G., Godfrey D.I. 2001. CD1d-restricted NKT cells: an interstrain comparison. J. Immunol. 167: 1164–1173 46. Smyth M., Godfrey D. 2000. NKT cells and tumor immunity—a double-edged sword. Nature Immunol. 1: 459–460 47. Sharif S., Arreaza G.A., Zucker P., Mi Q.S., Sondhi J., Naidenko O.V., Kronenberg M., Koezuka Y., Delovitch T.L., Gombert J.M., Leite-De-Moraes M., Gouarin C., Zhu R., Hameg A., Nakayama T., Taniguchi M., Lepault F., Lehuen A., Bach J.F., Herbelin A. 2001. Activation of natural killer T-cells by alpha-galactosylceramide treatment prevents the onset and recurrence of autoimmune type 1 diabetes. Nature Med. 7: 1057–1062 48. Gombert J.M., Tancrede-Bohin E., Hameg A., Leite-de-Moraes M.C., Vicari A., Bach J.F., A. H. 1996. IL-7 reverses NKI+ T cell-defective IL-4 production in the non-obese diabetic mouse. Int. Immunol. 8: 1751–1758 49. LaFace D.M., Peck A.B. 1989. Reciprocal allogeneic bone marrow transplantation between NOD mice and diabetes-nonsusceptible mice associated with transfer and prevention of autoimmune diabetes. Diabetes 38: 894–901 50. Sato K., Ohtsuka K., Hasegawa K., Yamagiwa S., Wantanabe H., Asakura H., Abo T. 1995. Evidence for extrathymic generation of intermediate T cell receptor cells in the liver revealed in thymectomized, irradiated mice subjected to bone marrow transplantation. J. Exp. Med. 182: 759–767 51. Ikehara S., Ohtsuki H., Good R.A., Asamoto H., Nakamura T., Sekita K., Muso E., Tochino Y., Ida T., Kuzuya H. 1985. Prevention of type I diabetes in nonobese diabetic mice by allogeneic bone marrow transplantation. Proc. Natl Acad. Sci. USA 82: 7743–7747 52. Ikehara S., Nakamura T., Sekita K., Muso E., Yasumizu R., Ohtsuki H., Hamashima Y., Good R.A. 1987. Treatment of systemic and organ-specific autoimmune disease in mice by allogeneic bone marrow transplantation. Prog. Clin. Biol. Res. 229: 131–146 53. Crispe I.N., Dao T., Klugewitz K., Mehal W.Z.a., Metz D.P. 2000. The liver as a site of T-cell apoptosis: graveyard, or killing field? Immunol. Rev. 174: 47–62
128
54. Coles M.C., Raulet D.H. 2000. NK1.1+T cells in the liver arise in the thymus and are selected by interactions with class I molecules on CD4+CD8+ cells. J. Immunol. 164: 2412–2418 55. Eberl G., MacDonald H.R. 1998. Rapid death and regeneration of NKT cells in anti-CD3epsilon- or IL-12-treated mice: a major role for bone marrow in NKT cell homeostasis. Immunity 9: 345–353 56. Huang C., Springer T.A. 1995. A binding interface on the I domain of lymphocyte function-associated antigen-1 (LFA-1) required for specific interaction with intercellular adhesion molecule 1 (ICAM-1). J. Biol. Chem. 270: 19008–19016 57. Matsumoto Y., Emoto M., Usami J., Maeda K., Yoshikai Y. 1994. A protective role of extrathymic alpha beta TcR cells in the liver in primary murine salmonellosis. Immunology 81: 8–14 58. Emoto M., Mittrucker H.W., Schmits R., Mak T.W., Kaufmann S.H. 1999. Critical role of leukocyte function-associated antigen-1 in liver accumulation of CD4+NKT cells. J. Immunol. 162: 5094–5098 59. Moriyama H., Yokono K., Amano K., Nagata M., Hasegawa Y., Okamoto N., Tsukamoto K., Miki M., Yoneda R., Yagi N., Tominaga Y., Kikutani H., Hioki K., Okumura K., Yagita H., Kasuga M. 1996. Induction of tolerance in murine autoimmune diabetes by transient blockade of leukocyte function-associated antigen-1/intercellular adhesion molecule-1 pathway. J. Immunol. 157: 3737–3743 60. Bertry-Coussot L., Lucas B., Danel C., Halbwachs-Mecarelli L., Bach J.F., Chatenoud L., Lemarchand P. 2002. Long-term reversal of established autoimmunity upon transient blockade of the LFA-1/intercellular adhesion molecule-1 pathway. J. Immunol. 168: 3641–3648 61. Muir A., Peck A., Clare-Salzler M., Song Y.H., Cornelius J., Luchetta R., Krischer J., Maclaren N. 1995. Insulin immunization of nonobese diabetic mice induces a protective insulitis characterized by diminished intraislet interferon gamma transcription. J. Clin. Invest. 95: 628–634 62. Falcone M., Yeung B., Tucker L., Rodriguez E., Sarvetnick N. 1999. A defect in interleukin 12-induced activation and interferon gamma secretion of peripheral natural killer T cells in nonobese diabetic mice suggests new pathogenic mechanisms for
A. Kukreja et al.
63.
64.
65.
66.
67.
68.
69.
70.
71.
insulin-dependent diabetes mellitus. J. Exp. Med. 190: 963–972 Gumperz J.E., Miyake S., Yamamura T., Brenner M.B. 2002. Functionally distinct subsets of CD 1d-restricted natural killer T cells revealed by CD Id tetramer staining. J. Exp. Med. 195: 625–636 Lee P.T., Benlagha K., Teyton L., Bendelac A. 2002. Distinct functional lineages of human V(alpha)24 natural killer T cells. J. Exp. Med. 195: 637–641 Hong S., Wilson M.T., Serizawa I., Wu L., Singh N., Naidenko O.V., Miura T., Haba T., Scherer D.C., Wei J., Kronenberg M., Koezuka Y., Van Kaer L. 2001. The natural killer T-cell ligand alpha-galactosylceramide prevents autoimmune diabetes in non-obese mice. Nature Med. 7: 1057–1062 Boitard C., Yasunami R., Dardenne M., JF B. 1989. T cell mediated inhibition of the transfer of autoimmune diabetes in the NOD mice. J. Exp. Med. 169: 1669–1680 Qin H.Y., Sadelain M.W., Hitchon C., Lauzon J., Singh B. 1993. Complete Freund’s adjuvant-induced T cells prevent the development and adoptive transfer of diabetes in nonobese diabetic mice. J. Immunol. 150: 2072–2080 Quinones M., Ahuja S.K., Melby P.C., Pate L., Reddick R.L., Ahuja S.S. 2000. Preformed membrane-associated stores of interleukin (IL)-12 are a previously unrecognized source of bioactive IL-12 that is mobilized within minutes of contact with an intracellular parasite. J. Exp. Med. 192: 507–516 Maclaren N., Lan M., Coutant R., Schatz D., Silverstein J., Muir A., Clare-Salzer M., She J.X., Malone J., Crockett S., Schwartz S., Quattrin T., De Silva M., Vander Vegt P., Notkins A., Krischer J. 1999. Only multiple autoantibodies to islet cells (ICA), insulin, GAD65, IA-2 and IA-2beta predict immune-mediated (Type 1) diabetes in relatives. J. Autoimmun. 12: 279–287 Yang Y., Bao M., Yoon J.W. 2001. Intrinsic defects in the T-cell lineage results in natural killer T-cell deficiency and the development of diabetes in the nonobese diabetic mouse. Diabetes 50: 2691–2699 Lin-Su K., Kukreja A., Maclaren N.K. 2001. Diabetes Vaccines: A Future to Be Realized. Diabetes Technol. & Therap. 3: 451–431
Journal of Autoimmunity (2002) 19, 117–128
NKT Cell Defects in NOD Mice Suggest Therapeutic Opportunities Anjli Kukreja1, Guilia Costi2, John Marker1, Chen Hui Zhang1, Sunil Sinha1, Zhong Sun1 and Noel Maclaren1 1
Weill Medical College of Cornell University, New York, NY 10021, USA; 2 Department of Pediatrics, University of Parma, Italy
Received 17 May 2002 Accepted 26 July 2002 Key words: autoimmunity, NKT cells, NOD mice, T-cell receptors, tolerance
Recent studies have reported that immunoregulatory NKT cells are defective in NOD mice and that treatment of mice with -galactosylceramide that selectively stimulate NKT cells, is anti-diabetogenic. The objective of this study was to document the natural history of changes in NKT cells in various organs in NOD mice in the period up to the time of diabetes onset so that novel intervention therapies could be devised. We found that NKT cell-specific receptor (NKT-TCR) V14J281 expressions by quantitative (RealTime) RT-PCR in thymus, spleen and liver of NOD male and female mice were low at 1–3 months of life compared to BALB/c and C57BL/6 mice, albeit a transient spike in levels occurred in female NOD livers at 2 months. Female pancreases showed low levels of these transcripts despite their active and destructive insulitis. In contrast, NOD males exhibited high expression of this invariant TCR in pancreas, where their insulitis was less destructive. A survey of NKT-TCR expressions in a battery of congenic, non-diabetes prone NOD strains indicated that this NKT phenotype was quite variable but higher than diabetes prone NOD. Bone marrow transplantation of NOD females from B6.NOD-H2g7 donors raised their NKT-TCR expressions. Tuberculin administrations in the forms of BCG and CFA in a manner known to protect NOD mice from diabetes both raised NKT-TCR levels, as did the anti-inflammatory PPAR- agonist rosiglitazone. These findings provide exciting therapeutic avenues to be explored in the treatment of human immune mediated type-1 diabetes where there are similar immunoregulatory lesions. © 2002 Published by Elsevier Science Ltd.
Introduction
peripheral tolerance to self antigens in autoimmune disease are poorly understood, defects at the level of antigen presenting cells or the regulatory T cells may contribute to the lack of self-tolerance to pancreatic beta cell self antigens [6–9]. T cells associated with maintenance of immune tolerance (Treg cells) include immunoregulatory (CD4+) T cells that constitutively express IL-2R (CD25+) and natural killer T cells (NKT cells). NKT cells comprise a small cytokine rich T-cell subset, that is either CD4+CD8− or double negative (DN) CD4−CD8−, and characterized by mature (memory) phenotypes and functional capabilities [10]. NKT cells have an invariant +TCR repertoire and are restricted by the non-classical MHC class I-like CD Id molecules, [11] which present glycolipid rather than peptide antigens [12, 13]. NKT cells are part of the innate immune system, which plays a major role in immunity to infectious agents and tumors. As the earliest responding T cells, NKT cells are components of a first line of defense that modulate the upcoming adaptive immune responses by releasing a set of effector cytokines following their in-vivo activation.
Immune mediated (type-1) diabetes (IMD) is a serious, incurable prototypic autoimmune disease [1] that continues to rise in incidence in the industrialized countries of the world [2]. Evidence from association and linkage studies suggest that the disease results from one strong and multiple weak predisposition genes interacting with strong environmental influences [3]. Such genes likely encode defects in normal immune tolerance mechanisms. Susceptibility to diabetes in the non-obese diabetic (NOD) mouse model of IMD involves complex polygenic quantitative traits in the required presence of their unusual H2g7 (Kd, Ag7, Enull, Db) [4, 5] haplotype while diabetes frequencies generally decrease with decreasing sterility and/or a variety of immuno-stimulations. While the mechanisms causing breakdown of either central or Correspondence to: Noel Maclaren MD, Department of Pediatrics, and Immunology Program, Weill-Cornell College of Medicine, 1300 York Avenue, Room LC-623, New York, New York 10021, USA. Tel.: 212-746-1894; Fax: 212746-1185; E-mail: [email protected] 117 0896–8411/02/$-see front matter
© 2002 Published by Elsevier Science Ltd.
118
NKT cells are found in thymus, liver, spleen and bone marrow, but are uncommon in lymph nodes and gut [10, 14–17]. Besides their role as effectors, NKT cells have been implicated in the regulation of autoimmune conditions. Mice prone to develop nuclear autoantibodies and lupus nephritis have been shown to lose numbers of NKT cells with aging when their autoimmune diathesis becomes evident [18], while mice prone to experimental allergic encephalomyelitis have serious functional defects in NKT cells [19]. Various reports in NOD mice [8, 20, 21] and BioBreeding (BB) rats [22] and in humans [23, 24] associate the dysfunction of NKT cells to diabetes susceptibility, and conversely, the increase of NKT cell activity in animal models to protection from autoimmunity. However, none of these studies in animal models have used markers that are specific for murine NKT cells; i.e., their invariant TCR V14J281. Thus low numbers of CD4−/CD8− (double negative or DN) T cells were reported in the thymi and spleens of NOD mice, a cell population enriched in NKT cells. When enriched populations of such cells were adoptively transferred into NOD mice, the diabetes rate fell [8] suggesting that the increased numbers of NKT cells might have corrected a regulatory deficiency. Another group used a transgenic approach to over-express the canonical TCR of NKT cells in NOD mice, resulting in elevations in NK1.1+ T cells and reduced diabetes rates [25]. Whereas a monoclonal antibody specific for the NK1.1 allotypic marker is used together with CD3 staining to enumerate murine NKT cells, this is impossible in NOD mice since NK1.1 is not expressed by them. Thus earlier studies suggesting that NOD mice are numerically and functionally deficient in NKT cells have relied upon a combination of markers for T cells and for NK cells other than NK1.1. We undertook this study to document NKT cell status in NOD mice using specific molecular assays, to learn how the defect evolves in association with insulitis and diabetes, and to test whether NKT cell numbers can be rescued therapeutically. We report here that NOD/LtJ mice express fewer NKT TCR transcripts (NKT TCR) than C57BL/6J and BALB/cJ mice in multiple tissues, and hypothesize that the NKT cell deficiencies appear to result from a dendritic cell (DC) or T-cell progenitor disorder, since the NOD NKT cell defect was correctable with allogeneic bone marrow transplantation. Further we demonstrate here that interventions known to abrogate NOD diabetes specifically result in increased expression of NKT cell transcripts.
A. Kukreja et al.
C57BL/6J, and BALB/cJ female mice were purchased from The Jackson Laboratory, Bar Harbor Maine. TCR J281 −/− knockout mice were kindly provided by Dr Steven Porcelli [26]. The B6.NOD-H2g7 congenic stock maintained at The Jackson Laboratory is that previously described by Yui et al. [27]. NOD-related mice from six recombinant congenic stocks derived at first backcross (to CBA/J) following an outcross of NOD/Lt to CBA/J have been described previously [28]. These recombinant congenic strains, also from The Jackson Laboratory, are designated NOcCB-1, CBcNO-6, CBcNO-7A, CBcN07B, CBcNO-7C, and CBcNO-7D. These strains are all diabetes free and resistant to cyclophosphamide-induced diabetes, despite containing 50–60% NOD alleles, including the diabetogenic H2g7 haplotype.
Intervention studies Groups of 4 NOD female mice were treated with one of six interventions while all study mice had tissue RNAs harvested at 12 weeks of age. One group received 150 g BCG, administered ip. by a published protocol that protects against diabetes [29]. Another group was treated with an emulsion of 50 l complete Freund’s adjuvant (CFA) in 50 l saline, which was delivered into each hind footpad at 4 and 7 weeks of age, a protocol also known to powerfully prevent diabetes [30]. Leishmania donovani (L. donovani) was administered to a third group via intravenous tail injection at a dose of 15×106 parasites per 200 l saline at 4 and 6 weeks of age since it induces massive expansion of macrophages with splenomegaly in resistant strains of mice [31]. A fourth group was treated with rosiglitazone (Avandia), 0.8 mg/mouse (40 mg/kg) a peroxisome proliferator activated receptor gamma (PPAR) agonist. Treatment was on alternative days by oral gavage, beginning at 7 weeks of age and continuing until time of sacrifice. Another group received a placebo gavage. Finally, bone marrow reconstitutions were done on a sixth group of NOD female mice from B6.NOD-H2g7 congenic donors. Marrow tissues were harvested from the femurs of 4 mice and suspended in PBS, and 15×106 of these cells/mouse were administered iv to 4 recipient NOD mice. When sacrificed, spleen, thymus, liver, pancreas, and bone marrow were harvested for total RNA extraction for real-time RT-PCR analyses.
Sequencing study of NOD NKT cell receptors
Materials and Methods Mice All studies were performed in accordance with the institutional guidelines for the animal care. All studies involved groups of 4 mice for each RT-PCR tissue observation made. Male and female NOD/LtJ mice,
Total RNAs were extracted from the spleen, thymus, pancreas, bone marrow, and liver of NOD as well as C57BL/6 mice using Trizol (Invitrogen) and cDNAs of the invariant canonical TCR chain were generated by RT-PCR using the following primers: (5′V14) 5′ CTAAGCACAGCACGCTGCACA-3′; (5′C) 5′ GAA GCTTGTCTGGTT GCTCCAG-3′; and (5′J281) 5′ CAGGTATGACAATCAGCTGAGTCC-3′. These PCR products were cloned into PCR Script vector from
Immunoregulatory T cells in immune mediated diabetes in NOD mice
Stratagene. DNA sequencing was performed using the sequencing kits, a sequencing primer and an automated ABI 377 DNA sequencer. Quantitative RT-PCR analyses in NOD mice NKT cells in mice are characterized by the presence of the canonical V14J281 TCR. The Taqman quantitative RT-PCR technology (ABI PRISM 7700) was used for relative quantification of this TCR expression. With this sensitive technology, we also studied the expressions of CD1.1, LFA-1, annexin-V and caspase-9 using specific primers and probes. Total RNA was extracted from the tissues of NOD, J281−/−, BALB/c, and C57BL/6 mice using Trizol reagent (Invitrogen). The RNA was treated with DNAse and the cDNAs were generated by first strand synthesis reaction using oligo-dT [12–18] primers and Moloney murine leukemia virus-reverse transcriptase under optimized conditions as previously described [32]. Using Primer Express software, the optimized primers and probes selected were: The primers and probe for V14J281 TCR were: Forward primer (V14) 5′ GTGTGGTGGGCGATAGA GGT 3′ Reverse primer (J281) 5′ ACAACCAGCTGAGTCC CAGC 3′ TCR Probe: 6-FAM 5′ CAGCCTTAGGGAGGCTGC ATTTTGG 3′ TAMRA. The primers and probe used for CD1.1 were: Forward primer 5′ GATAACTCCAAGGGCCTCCAA 3′ Reverse primer 5′ CATAGAGACTGTGTCCTAAGAT GGTCA 3′ CD1.1 Probe 6-FAM 5′ TTGTGGCTCTTTTAATAAT GTTTGTTCTAAATGCCA 3′ TAMRA. The primers and probe used for LFA-1 were: Forward primer 5′GGCTACCCGCTTGGTCG 3′ Reverse primer 5′ CCTATCCCCATTGATGTCCG 3′ LFA-1 Probe 5′ FAM-TTTGGAGCCGCCATAACTG CCCT 3′-TAMRA We then measured the above transcripts (labeled with FAM dye) relative to the endogenous housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (labeled with VIC dye). Forward primer (GAPDH) 5′ ACTGGCATGGCCT TCCG 3′ Reverse primer (GAPDH) 5′ CAGGCGGCACGTCAG ATC 3′ GAPDH Probe VIC 5′ TTCCTACCCCCAATGTGTCC GTCGT 3′TAMRA Comparative Ct method The Comparative Ct method was used to quantify various transcripts to the control endogenous gene
119
GAPDH that is expressed in all tissue samples. GAPDH Ct values did not vary between tissue types or treatment. The following formula was used to calculate the target gene copy number as normalized to corresponding GAPDH expression: 2 −(Ct), where Ct=[Ct of Target molecule−Ct of GAPDH), Ct represents subtraction of a Ct value by the Ct calibrator value, which in this instance was the 3 month female NOD value for each respective organ.
Results Assay validation Our sequencing studies for the invariant NKT-TCR transcripts in NOD and C57BL/6 livers were found to be identical. Further, NKT cell-specific V14J281 TCR was readily detected in NOD, C57BL/6 and BALB/c mice by Real-Time RT-PCR method but not in the J281−/− mice as expected. The inter-assay and intraassay variabilities in Ct values for a control cDNA sample respectively were 0.023 and 0.029 for GAPDH, 0.029 and 0.026 for NKT TCR, 0.039 and 0.017 for LFA-1, 0.01 and 0.029 for caspase-9, 0.022 and 0.033 for annexin V, and 0.032 and 0.02 for CD 1.1 The natural history of NKT cell expression in NOD mice Thymi, spleens, livers, pancreata and bone marrows were collected from NOD males and females, C57BL/6 females and BALB/c females and studied at l, 2 and 3 months of age. We observed that the invariant NKT-TCR expression was dynamic being tissue, gender, and age dependent (Figure 1). There were striking differences in NKT-TCR levels in the pancreata of male and female NOD mice (Figure 1a). Pancreata of NOD females exhibited significantly reduced frequencies of NKT TCR as compared to pancreata of NOD males at all time points. As expected, pancreatic NKT TCR expression of control non-diabetes prone C57BL/6 and BALB/c mice that had no insulitis was low, and comparable to the low levels observed in pancreata of NOD females with insulitis. There was considerable age-associated variability evident in NKT-TCR transcripts in the liver. NOD levels were significantly reduced from those in the two control strains matched for age and sex (Figure 1b), with the exception of a significant transient increase in NOD females at 2 months of age that was not seen in NOD males. However by 3 months of age, when the first female mice are soon to develop diabetes, the NKT-TCR levels had fallen significantly below those of control mice. By 4 and 6 months, there was a modest increase in hepatic expression of NKTTCR in diabetic NOD females (data not shown). The control mice, on the other hand had increased expressions of NKT-TCR by 2 and 3 months of age compared to levels at 1 month, with all control levels being significantly increased over NOD, except when
120
A. Kukreja et al.
Figure 1. The panels show the levels of NKT cell canonical receptor transcripts in (a) pancreas (b) liver (c) spleen and (d) thymus with the bars representing the mean±1 SEM levels of 4 mice normalized to GAPDH transcript levels. Female NOD mice had significantly reduced NKT-TCR levels from the control mice (b,c,d) while male NOD mice had significantly higher expression than NOD female mice in the pancreas (a).
compared to 2-month-old NOD females. Reductions of splenic expressions of NOD NKT cells were less evident yet significant in female NOD mice (Figure 1c) than for livers at all time points. The thymic data showed NOD female and male NKT-TCR deficiencies at all ages (Figure 1d), in sharp contrast to the normal age-related rise in NKT cells in the thymi of the control females. These control data confirm the earlier suggestion of age-dependent increases of NKT cells in the thymus previously reported by indirect measurement of DN T cells [8]. NKT cells in diabetes resistant congenic NOD mice In an attempt to identify genetic loci associated with the NKT cell defect, we compared expression of the canonical TCR V14J281 expression in liver, spleen, and thymus from NOD to that of C57BL/6J, BALB/c and B6.NOD-H2g7 females aged to 3 months, since this was the age when the NOD defect was consistently expressed. We also analyzed this clonotypic
expression in a series of six recombinant congenic stocks sharing H2g7 identity with NOD. These mice are strongly resistant to intra-islet insulitis and diabetes [30]. The results are summarized in Table 1. We found that hepatic expression in all congenic/ recombinant congenic mice was significantly greater than in NOD. The expression data (with NOD set at ‘1’) show that H2g7 was not a major modifier in either liver or spleen (data not shown). Among the six recombinant congenic stocks, CBcNO-7D most resembled C57BL/6J in terms of expression level in various organs. Genome scans show that this line shares all markers present in CBcNO-7A, -7B, and -7C with the exception of segments of Chr. 10 and Chr 12, where CBcNO-7D has CBA alleles and the other three strains have NOD alleles. Interestingly, 3-month-old females from the NOcCB-1 strain, which shows the highest degree of genome sharing with NOD, exhibited NODlike low expression in spleen, but not in liver. Thymic expression levels among all strains were considerably more variable such that no genetic conclusions could be drawn based upon this tissue (data not shown). Thus there was no NOD genomic interval that
Immunoregulatory T cells in immune mediated diabetes in NOD mice
Table 1. The mean±1 SEM expression ratios of NKT-TCRs normalized to GAPDH expressions in congenic mice are shown relative to that in 3-month-old female NOD mice. Expressions in the liver show all mice to be significantly greater than that in the NOD mice Strain B6 NOD-H2g7 NO-CB1 CBcNO-6 CBcNO-7A CBcNO-7B CBcNO-7C CBcNO-7D NOD C57BL/6
Liver 16.4±4.91* 11.5±1.43* 8±1.35* 12±0.89* 8.4±0.7* 11.5±1.85* 16.4±0.7* 1 22.58±1.73*
*P<0.01 as compared to NOD.
mapped the NOD NKT cell defect expressed in the most informative tissue, the liver. Expression of CD1.1 in various organs Whereas the NKT cell deficiency in NOD mice was confirmed, the reasons for it were not. Since NKT cells are CD1d restricted by glycolipid presentation by antigen presenting cells (APCs), we next studied effect of age on the expression of CD1.1. However, we found no differences in the expression of CD1.1 in various NOD organs as compared with control nonautoimmune prone mice (data not shown). In an attempt to stimulate tissue macrophages/DCs to learn whether they would in turn stimulate NKT cells indirectly, we infected NOD females with L. donovani without any increase in NKT-TCRs as covered below. Thus we could show no evidence of a possible abnormality of CD1d expression on APCs to explain the NOD NKT cell defect. We did not measure CD1.2 transcript levels. LFA-1-dependent maturation of NKT cells Since LFA-1 is required for the development of liver NKT cells [33], we next studied its expression in all tissues (Figure 2) already studied for NKT cells (Figure 1). In the pancreas there was a significant decrease in LFA-1 at three months of age in female mice (Figure 2a) compared to their male counterparts. Similarly, LFA-1 expressions were low in livers, spleens and thymi at various time points in female NOD mice. Furthermore, in both the spleen (Figure 2c) and thymus (Figure 2d), there was a significant increase in the expression of LFA-1 in male NOD mice at 1, 2, and 3 months of age over both female NOD and mice of the non-diabetes prone control strains. Thus NOD females exhibited statistically significant deficiencies in LFA-1 expression, as compared to male NOD and age matched control mice. Since LFA-1 has been shown to have a role in regulation of leukocyte
121
adhesion to endothelium and extravasation [34, 35] and T-cell co-stimulation during activation [36] besides specific effects on NKT cell development and homing as discussed above, we speculate that LFA-1 deficiency observed in female NOD mice might effect the development, migration or the functions of NKT cells. NKT cell expansions with various interventions Since deficiency of NKT cells paralleled the risk of diabetes in various NOD mice, we next studied pharmacological approaches which are known to protect against NOD diabetes, since if they stimulated NKT cells to expand in numbers and release potentially protective cytokines, this might have explained their beneficial effects. We show herein for the first time, that BCG vaccine does in fact increase NKT cell numbers in various organs, especially in the pancreas (Figure 3a). The stimulatory effect from tuberculin antigen was generally greater in the other tissues when CFA was given, especially in liver and spleen (Figure 3b & c). Since the NKT cells defect could result from a primary problem with APCs [37], we next attempted to stimulate NKT cells by infecting NOD mice with L. donovani since it is known to powerfully induce macrophage/DC activation and proliferation. Leishmania infection did not reduce the frequencies of diabetes (data not shown), nor was there any increase in NKT TCR levels (Figure 3b, c, and d), indicating NKT cell specificity for the above tuberculin-based stimuli. Importantly, bone marrow transplantation of the female NOD mice at 4 and 7 weeks of age from congenic B6.NOD-H2g7 donors drastically improved their NKT cell expressions at 3 months of age in livers and spleens. Diabetes-resistant congenic B6.NODH2g7 mice were used as donors since they lacked NKT cell defect seen in NOD females (Table 1). Finally, rosiglitazone (Avandia) was given to female NOD mice since it is a common class of drug used to treat type-2 diabetes which is also a powerful antiinflammatory agent acting through suppression of NfB and stimulation of IB in monocytes associated with a fall in peroxisome proliferator-activated receptor (PPAR-) and rise in PPAR- [38]. Troglitazone has been shown to attenuate the expression of experimentally induced encephalitis in C57BL/6 mice [39]. Rosiglitazone treatment mediated a striking increase in NKT-TCRs, specifically in the liver (Figure 3b). Thus it is may be possible to use NKT cell stimulation rather than T-cell suppression to treat autoimmune disease such as IMD. All of the mice were normoglycemic when studied (Figures 3 and 4) except for untreated control mice and those infested with Leishmania donovani. Since LFA-1 has been shown to be required for the development of the liver NKT cells [33], we next studied the effect of these interventions on LFA-1 expression, that protect NOD mice from diabetes by increasing NKT cells as described above. Increased LFA-1 transcripts expression was observed in BCGimmunized (pancreas and spleen) and bone marrow
122
A. Kukreja et al.
Figure 2. The panels show the mean±1 SEM levels of LFA-1 transcripts in (a) pancreas (b) liver (c) spleen and (d) thymus with the bars indicating the mean of 4 mice normalized to GAPDH expression. Significantly reduced levels were found in the diabetes prone NOD female mice.
recipients (pancreas, liver and spleen) following the increased NKT TCR expression pattern as a result of the interventions (Figure 4).
Discussion While recent studies have thrown light on mechanisms of peripheral regulation of adaptive immune responses mediated by NKT cells, we affirm here that the NOD mouse is deficient in NKT cells as assessed by a quantitative and specific molecular transcription assay. This defect may be part of an underlying thymic disorder in generating and/or exporting these cells to the periphery. This idea is supported by the positive results from our bone marrow transfer studies, which suggest an intrinsic defect in bone marrow derived progenitor-T cells and the diminished expression of LFA-1 in the study tissues. Whereas much of what is known about NKT cells has been derived from NK1.1-expressing C57BL/6 mice, the marker is found in only a subset of inbred mouse strains that express an allelic form of NK1.1 (among which are B6, NZB, and SJL) detectable by the
commercially available mAb PK136 [10]. Even in these mice, activated NK1.1+ T cells may down-regulate their own NK1.1 expression, making it difficult to follow these cells after their stimulation [40]. Because NK1.1 is also expressed on CD1d-independent T cells [41], most peripheral (splenic) DN T cells do not express NK1.1 even in C57BL/6 mice nor are they very biased towards V8.2 expression [42]. Assuming that a similar heterogeneity exists in NOD mice, much of the DN cells in spleen and lymph nodes represent non-NKT cells. NOD NK1.1 congenic mice that selectively express the NK1.1 marker on NK and NKT cell subsets [43–45] have been produced to obviate these analytical difficulties. Such mice manifest reduced diabetes incidence and improved NK and NKT cell performances as compared to wild type NOD mice. However we show here in wild type NOD mice an unambiguous deficiency in NKT cells specifically defined by their V14J281 transcripts in various organs in the absence of the NK1.1 allotypic marker. NKT cells are potent cytotoxic T cells that may have potential as mediators of cancer containment [26, 46] or regulators of self-tolerance [37, 47]. Our findings in NOD mice suggest that NKT cells are protective
Immunoregulatory T cells in immune mediated diabetes in NOD mice
123
Figure 3. The panels depict the effects of five different interventions on the levels of NKT-TCRs expressed at 3 months of age in female NOD mice in (a) pancreas (b) liver (c) spleen and (d) thymus. The bars represent the mean±1 SEM levels of 4 mice normalized to GAPDH expression. Whereas only BCG increased pancreatic expression, all interventions increased transcription in the other tissues except for infection with L. donovani.
tolerogenic cells in that they are overtly deficient in autoimmune prone NOD mice; there were increased numbers of pancreatic NKT cells in relatively diabetes resistant NOD males but they were essentially absent from the pancreata of highly diabetes prone NOD females despite their early and vigorous insulitis as has also been suggested by Naumov et al. [37]. Expression of normal levels of the canonical V14J281 NKT-TCR in liver and spleen cells in diabetes resistant recombinant congenic strains in which the MHC and at least 50% of the non-MHC markers tested were derived from NOD indicates the complex, non-MHC dependent genetic control of the defect in NOD. It is interesting to note that certain of the recombinant congenic lines would be expected to express CBA-derived genes adjacent to and including the Cd1 complex on Chromosome 3. The Cd1 locus is at 48 cM, and while CBcNO-7C is homozygous for CBA markers both proximal (Fcgr1, 45.2 cM) and distal (Amy1, 50.0 cM), it should carry the CBA-derived Cd1 complex. In contrast, CBcNO-7B and -7D carry NOD markers across this interval. CBcNO-7A carries the NOD allele at Fcgr1 and the CBA allele at Amy1 so that the origin of its Cd1 allele is indeterminate at this point. However, data in Table 1 indicate that allelic
variation in this segment of Chromosome 3 is not responsible for the increased hepatic expression of the V14J281 NKT-TCR in the recombinant congenic panel. The strains all appear to have inherited from the NOD progenitor the cluster of genes encoding the NK1 antigen (Nk1, 62.7 cM) and NK function receptors (Nkrp1 at 62.1 cM) on Chromosome 6, so these loci also are not implicated in the expression differences distinguishing the recombinant congenic strains from the parental NOD strain. Further, treatment of prediabetic NOD mice with IL-7 reportedly enhances NKT function [48]. All six recombinant congenic lines have a CBA-derived gene encoding IL-7 (Il7, 6.6 cM) on proximal Chromosome 3 based upon CBA origin of proximal and distal flanking markers at 2.4 cM and 10.5 cM respectively. Further, the NOcCB-1 and CBcNO-6 strains, but not the CBcNO-7 series, would be expected to express the CBA allele of the IL-7 receptor (Il7r, Chromosome 15). Possibly, IL-7 levels and/or signalling properties may in part account for the more normal development of the NKT population in certain of these NOD-related strains. The mechanism involved in the NKT cell deficiency in NOD mice needs to be explained. When DN thymocytes were transferred to NOD mice and
124
A. Kukreja et al.
Figure 4. The panels depict the effects of five different interventions on the levels of LFA-1 transcripts expressed at 3 months of age in female NOD mice in (a) pancreas (b) liver (c) spleen and (d) thymus. The bars represent the mean±1 SEM levels normalized to GAPDH expressions. All interventions increased LFA-1 expression in various organs following the increased NKT-TCR expression pattern as a result of these interventions.
showed protection from diabetes, Baxter et al. inferred that it was due to transfer of the NKT cells [8], albeit they used F1 mouse donors that could have induced a graft versus host response (GVHR). Similarly, LaFace [49] showed that allogeneic bone marrow transplantations to lethally irradiated NOD mice were antidiabetic while syngeneic bone marrow transplantation of the irradiated thymectomized mice gave rise to NKT cells in various organs including the liver [50]. Still others have shown that bone marrow transplants protect the NOD mouse from diabetes [51, 52]. We performed the experiment with MHC compatible bone marrow and showed that NKT cell numbers generated from B6.NOD-H2g7 marrow precursors could be greatly increased this way. As above, these donors have normal NKT cell TCR transcript expressions. Our studies of the natural history of prediabetic events showed that repositories of NKT cells are deficient in NOD mice, suggesting that production of these cells is defective. However our findings indicate that the NOD thymic epithelial cells that expand T cells in context of MHC cannot be responsible for the NKT cell defect. That leaves two possibilities. First that the bone marrow transplants replaced medullary
macrophages in the thymus which in turn expanded NKT cells or replaced bone marrow T-cell precursors which in turn were expanded in the NOD thymus. In respect to the former possibility, we found that CD1.1 transcripts to be normal while stimulation of macrophages by L. donovani did not induce NKT cells to rise (they actually fell), results that offer no support that the NKT problem is due to defective antigenic stimulation. However our studies herein cannot confirm one over the other of these two possibilities. The transient increase in the numbers of these cells in the female liver at 2 months of age (the results were reproducible), could have been due to their aggregation by a ‘graveyard’ phenomena [53], albeit we were unable to confirm increased apoptosis of these cells in this site through measurement of annexin V or caspase 9 transcripts (data not shown). This area needs further investigation, possibly by specifically studying apoptosis markers (annexin V) for NKT cells isolated by use of -Ga1Cer loaded CD1d tetramers. Furthermore, it has been suggested that liver NK1.1+ NKT cells have a high death rate, and migrate from the liver where they undergo phenotypic changes [54]. Since intra-hepatic population of NKT cells is cytotoxic through both Fas ligand-mediated and
Immunoregulatory T cells in immune mediated diabetes in NOD mice
perforin-mediated mechanisms, we speculate that initially NKT cells undergo expansion around 2 months of age in response to the rise in islet cell autoreactive T cells, but that during this process they die themselves leaving the undefended NOD mice to develop diabetes. Furthermore, deletion of liver NKT cells occurs within 1 day after the administration of IL-12 [55]. We hypothesize that in NOD mice, a biased Thl type response (more IL-12 and IFN) leads indirectly to deletion of NKT cells and diabetes by 3 months of age. Interestingly, we found that expression of LFA-1 was also defective in NOD mice at peripheral sites, especially in the pancreas of female mice. LFA-1 (CD11a/18) is a member of 2 integrin family of cell adhesion molecules that is expressed exclusively on leukocytes, including T cells, and is involved in cell migrations into tissues expressing ICAM-1 [56]. NKT cells in thymus and lymph nodes express high levels of LFA-1 as they do in liver [57]. On the other hand however, it has been reported that LFA-1 is also expressed on liver cells other than NKT cells and may play a pivotal role in accumulation of immunoregulatory cells in liver [58]. Thus LFA-1 may play a role in trafficking to or retention of CD4+ NKT cells by the liver, or their proliferation once there. In contrast Moriyama et al. [59] and Bertry-Coussot et al. [60] have shown that the transient blockade of LFA-1/ICAM pathway leads to induction of tolerance and long term reversal of established autoimmunity in NOD mice. However in our natural history study, we have shown that like NKT cell expression, LFA-1 expression is also reduced in various organs and upon immunization of the NOD mice with interventions that prevent the disease, increase both NKT cell as well as LFA-1 transcript expressions. This suggests the specificity of LFA-1 expression for NKT cells mediating their migration to various organs. By contrast, the studies of Monyama et al. [59], and Bertry-Coussot et al. [60], showed that diabetes could be prevented by LFA-1 blockade, indicating that positive expression of LFA-1 has been involved in the migration of effector T cells that mediate cell damage. We suggest that the findings are not mutually exclusive. It remains unknown how NKT cells mediate tolerogenesis to self, albeit these cells are cytokine rich and could be involved in supporting a Th2 response that is generally associated with protective immunomodulatory strategies rather than a Thl anti-islet response constituent of a destructive insulitis [61]. This simple hypothesis however, is unlikely to provide a complete explanation for NKT cell mediated tolerogenesis since murine NKT cells secrete quantities of both INF- and IL-4, while Falcone et al. found impaired rather than enhanced INF- secretion from NOD splenocytes enriched for NKT cells [62]. In our published patient studies, we likewise found that IMD patient T cells like that of NOD mice had a reduced ability to secrete INF in response to PMA plus calcium ionomycin stimulation in vitro. Furthermore, two recent studies suggest functionally distinct subsets of NKT cells as identified by using alpha-galactosylceramide (-Ga1Cer)-loaded CD1d tetramers. Whereas DN
125
NKT cells have a strict Thl profile, CD4+ NKT cells exclusively produce IL-4 and IL-13 on primary stimulation [63, 64]. It remains to be seen if these lineages are differentially altered in type-1 diabetes. Another report has alternatively suggested that NKT cell mediated immune suppression may be mediated through dendritic cells (DCs), especially those in the regional pancreatic lymph nodes [37]. We did not study this attractive possibility ourselves. There may be a therapeutic potential for glycolipid antigenic agents that stimulate NKT cells to mitigate against autoimmune diseases. To date, the only antigen known to stimulate isolated NKT cells in the context of CD1d is -Ga1Cer. Three separate groups have now shown protection when the agent is administered directly to the mice [47, 65] while another group has shown protection when DCs are exposed to -Ga1Cer in vitro before being reinfused to NOD recipients [37]. In all cases, protection against diabetes could be demonstrated, an effect which was less evident with mice as they aged [65]. Boitard had previously shown that the efficiency of splenocyte transfer of diabetes became progressively reduced with aging of the donor mice [66]. We could show herein, that over time, non-diabetic NOD mice gained NKT cells associated with a diminished tendency to develop overt diabetes (data not shown). We now add to the therapeutic possibilities of NKT cell stimulation, by showing that NKT cell numbers were greatly improved in vivo by tuberculin administration in the form of BCG or CFA, interventions that are well known to be anti-diabetic [29, 67]. Whereas there may be a glycolipid in the membrane of the organism that stimulates NKT cells, the rise in NKT cells in vivo may have an indirect explanation. The specificity of this mycobacterial antigenic effect was shown by our negative results with Leishmania. The infection showed a decrease in the canonical NKT-TCR expression in all organs. The effect we believe is possibly due to induction of IL-12 post infection [68] leading to IL-12 mediated death of NKT cells [55]. Our positive results on NKT cell numbers after rosiglitazone treatments were intriguing, especially since adults with late onset type-1 diabetes are often thought to have type-2 diabetes and may receive a PPAR- agonist [69]. While there is a perturbation in multiple cytokines with this agent the mechanism of action for its effect on NKT cells needs to be explored. In summary, we demonstrate here that NOD mice are deficient in NKT cells like their human counterparts, and provide suggestive evidence that these defects may be part of a more generalized bone marrow progenitor disorder as suggested by Yang et al. [70]. The genetic complexity underlying control of this NKT cell defect did not permit identification of controlling loci by studying recombinant congenic stocks containing NOD MHC as well as NOD alleles at multiple other loci. It appears likely that the defect while not absolute is inherent, albeit likely influenced by the environment. The therapeutic possibilities from approaches that are immuno-stimulatory to NKT cells in treating or preventing autoimmune diseases like type-1 diabetes appear exciting and immediately
126
A. Kukreja et al.
embraceable through clinical trials of appropriate immunostimulatory vaccines [71]. 13.
Acknowledgements We thank Dr Edward Leiter (The Jackson Laboratory, Bar Harbor) for kindly supplying the NOD-related congenic and recombinant congenic mice and for his critical reading of the manuscript. We also thank Dr Steven Porcelli (Albert Einstein College of Medicine, New York, NY) for kindly supplying J281−/− mice. This work was supported through an Innovation Grant (7-01-IN-06) from the American Diabetes Association. A.K. was supported by a fellowship grant (3-1999-768) from the Juvenile Diabetes Foundation.
References 1. Maclaren N.K., Kukreja A. 2000. Type 1 Diabetes. In The Metabolic and Molecular Bases of Inherited Disease, Vol. II, 8th edition M.D. William, S. Sly, eds. McGraw-Hill, St Louis, pp. 1471–1488 2. Atkinson M.A., Eisenbarth G.S. 2001. Type 1 diabetes: new perspectives on disease pathogenesis and treatment. Lancet 358: 221–229 3. Todd J.A., Bell J.I., McDevitt H.O. 1987. HLA-DQ beta gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 329: 599–604 4. Quartey-Papafio R., Lund T., Chandler P., Picard J., Ozegbe P., Day S., Hutchings P.R., O’Reilly L., Kioussis D., Simpson E. 1995. Aspartate at position 57 of nonobese diabetic I-Ag7 beta-chain diminishes the spontaneous incidence of insulin-dependent diabetes mellitus. J. Immunol. 154: 5567–5575 5. Singer S.M., Tisch R., Yang X.D., Sytwu H.K., Liblau R., McDevitt H.O. 1998. Prevention of diabetes in NOD mice by a mutated I-Ab transgene. Diabetes 47: 1570–1577 6. Leiter E.H., Serreze D.V. 1992. Antigen presenting cells and the immunogenetics of autoimmune diabetes in NOD mice. Reg. Immunol. 4: 263–273 7. Serreze D., Gaskins H.R., Leiter E. 1993. Defects in the differentiation and function of antigen presenting cells in NOD/Lt mice. J. Immunol. 150: 2534–2543 8. Baxter A.G., Kinder S.J., Hammond K.J., Scollay R., Godfrey D.I. 1997. Association between alphabetaTCR+CD4−CD8− T-cell deficiency and IDDM in NOD/Lt mice. Diabetes 46: 572–582 9. Salomon B., Lenschow D.J., Rhee L., Ashourian N., Singh B., Sharpe A., Bluestone J.A. 2000. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12: 431–440 10. Bendelac A., Rivera M.N., Park S.H., Roark J.H. 1997. Mouse CD1-specific NKl T cells: development, specificity, and function. Annu. Rev. Immunol. 15: 535–562 11. Bendelac A. 1995. Positive selection of mouse NK1+ T cells by CD1-expressing cortical thymocytes. J. Exp. Med. 182: 2091–2096 12. Kawano T., Cui J., Koezuka Y., Toura L, Kaneko Y., Motoki K., Ueno H., Nakagawa R., Sato H., Kondo E.,
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Koseki H., Taniguchi M. 1997. CDld-restricted and TCR-mediated activation of valphal4 NKT cells by glycosylceramides. Science 278: 1626–1629 Schofield L., McConville M.J., Hansen D., Campbell A.S., Fraser-Reid B., Brusby M.J., Tachado S.D. 1999. CD1d-restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells. Science 283: 225–229 Ohteki T., MacDonald H.R. 1994. Major histocompatibility complex class I related molecules control the development of CD4+8− and CD4−8− subsets of natural killer 1.1+ T cell receptor-alpha/beta+ cells in the liver of mice. J. Exp. Med. 180: 699–704 Yankelevich B., Knobloch C., Nowicki M., Dennert G. 1989. A novel cell type responsible for marrow graft rejection in mice. T cells with NK phenotype cause acute rejection of marrow grafts. J. Immunol. 142: 3423–3430 Ballas Z.K., Rasmussen W. 1990. NK1.1+ thymocytes. Adult murine CD4−, CD8− thymocytes contain an NK1.1+, CD3+, CD5hi, CD44hi, TCR-V beta 8+ subset. J. Immunol. 145: 1039–1045 Sykes M., Hoyles K.A., Romick M.L., Sachs D.H. 1990. In vitro and in vivo analysis of bone marrow-derived CD3+, CD4−, CD8−, NK1.1+ cell lines. Cell Immunol. 129: 478–493 Mieza M.A., Itoh T., Cui J.Q., Makino Y., Kawano T., Tsuchida K., Koike T., Shirai T., Yagita H., Matsuzawa A., Koseki H., Taniguchi M. 1996. Selective reduction of V alpha 14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156: 4035–4040 Yoshimoto T., Bendelac A., Hu-Li J., Paul W.E. 1995. Defective IgE production by SJL mice is linked to the absence of CD4+, NK1.1+ T cells that promptly produce interleukin 4. Proc. Natl Acad. Sci. USA 92: 11931–11934 Gombert J.M., Herbelin A., Tancrede-Bohin E., Dy M., Carnaud C., Bach J.F. 1996. Early quantitative and functional deficiency of NK1+-like thymocytes in the NOD mouse. Eur. J. Immunol. 26: 2989–2998 Laloux V., Beaudoin L., Jeske D., Carnaud C., Lehuen A. 2001. NK T cell-induced protection against diabetes in V alpha 14-J alpha 281 transgenic nonobese diabetic mice is associated with a Th2 shift circumscribed regionally to the islets and functionally to islet autoantigen. J. Immunol. 166: 3749–3756 Iwakoshi N.N., Greiner D.L., Rossini A.A., Mordes J.P. 1999. Diabetes prone BB rats are severely deficient in natural killer T cells. Autoimmunity 31: 1–14 Wilson S.B., Kent S.C., Patton K.T., Orban T., Jackson R.A., Exley M., Porcelli S., Schatz D.A., Atkinson M.A., Balk S.P., Strominger J.L., Hafler D.A. 1998. Correction: Extreme Thl bias of invariant Valpha24JalphaQ T cells in type 1 diabetes. Nature 391: 177–181 Kukreja A., Costi G., Marker J., Zhang C., Sun Z., Lin-Su K., Ten S., Sanz M., Exley M., Wilson B., Porcelli S., Maclaren N. 2002. Multiple immuno-regulatory defects in type-1 diabetes. J. Clin. Invest. 109: 131–140 Lehuen A., Lantz O., Beaudoin L., Laloux V., Carnaud C., Bendelac A., Bach J.F., Monteiro R.C. 1998. Overexpression of natural killer T cells protects Valphal4-Jalpha281 transgenic nonobese diabetic mice against diabetes. J. Exp. Med. 188: 1831–1839
Immunoregulatory T cells in immune mediated diabetes in NOD mice
26. Cui J., Shin T., Kawano T., Sato H., Kondo E., Toura I., Kaneko Y., Koseki H., Kanno M., Taniguchi M. 1997. Requirement for Valphal4 NKT cells in IL-12-mediated rejection of tumors. Science 278: 1623–1626 27. Yui M., Muralidharan K., Moreno-Altamirano B., Perrin G., Chestnut K., Wakeland E. 1995. Production of congenic mouse strains carrying NOD-derived diabetogenic genetic intervals: an approach for the genetic dissection of complex traits. Mammalian Genome 7: 331–334 28. Reifsnyder P., Flynn J., Gavin A., Simone E., Sharp J., Herberg L., Leiter E. 1998. Genotypic and phenotypic characterization of six new recombinant congenic strains derived from NOD/Shi and CBA/J genomes. Mammalian Genome 10 29. Qin H.Y., Singh B. 1997. BCG vaccination prevents insulin-dependent diabetes mellitus (IDDM) in NOD mice after disease acceleration with cyclophosphamide. J. Autoimmun. 10: 271–278 30. Sadelain M.W., Qin H.Y., Sing B. 1990. Prevention of type 1 diabetes in NOD mice by adjuvant immunotherapy. Diabetes 39: 583–589 31. Murray H.W., Nathan C.F. 1999. Macrophage microbicidal mechanisms in vivo: reactive nitrogen versus oxygen intermediates in the killing of intracellular visceral Leishmania donovani. J. Exp. Med. 189: 741–746 32. Gorski J., Wassai M., Zhu X., Kissela B., Keever C., Flomenberg N. 1994. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping. Correlation with immune status. J. Immunol. 152: 5109–5119 33. Ohteki T., Maki C., Koyasu S., Mak T.W., Ohashi P.S. 1999. Cutting edge: LFA-1 is required for liver NK1.1+TCR alpha beta+ cell development: evidence that liver NK1.1+TCR alpha beta+ cells originate from multiple pathways. J. Immunol. 162: 3753–3756 34. Staunton D.E., Dustin M.L., Springer T.A. 1989. Functional cloning of ICAM-2, a cell adhesion ligand for LFA-1 homologous to ICAM-1. Nature 339: 61–64 35. Wang J.H., Springer T.A. 1998. Structural specializations of immunoglobulin superfamily members of adhesion to integrins and viruses. Immunol. Reviews 163: 197–215 36. Green J.M., Thompson C.B. 1994. Modulation of T cell proliferation responses by acessory cell interactions. Immunol. Research 13: 234–243 37. Naumov Y.N., Bahjat K.S., Gausling R., Abraham R., Exley M.A., Koezuka Y., Balk S.B., Strominger J.L., Clare-Salzer M., Wilson S.B. 2001. Activation of CD 1 d-restricted T cells protects NOD mice from developing diabetes by regulating dendritic cell subsets. Proc. Natl Acad. Sci. USA 98: 13838–13843 38. Aljada A., Ghanim H., Friedman J., Garg R., Mohanty P., Dadona P. 2001. Troglitazone reduces the expression of PPAR gamma while stimulating that of PPAR alpha in mononuclear cells in obese subjects. J. Clin. Endocrinol. Metab. 86: 3130–3133 39. Niino M., Iwabuchi K., Kikuchi S., Ato M., Morohashi T., Ogata A., Tashiro K., Onoe K. 2001. Amelioration of experimental autoimmune encephalomyelitis in C57BL/6 mice by an agonist of peroxisome proliferator-activated receptor gamma. J. Neuroimmunol. 116: 40–48
127
40. Chen H., Paul W.E. 1998. A population of CD62L low Nk1.1-CD4+T cells that resembles NK1.1+CD4+ T cells. Eur. J. Immunol. 25: 3172–3182 41. Eberl G., Lees R., Smiley S.T., Taniguchi M., Grusby M.J., MacDonald H.R. 1999. Tissue-specific segregation of CD Id-dependent and CD 1d-independent NK T cells. J. Immunol. 162: 6410–6419 42. Zlotnik A., Godfrey D.I., Fischer M., Suda T. 1992. Cytokine production by mature and immature CD4−CD8−T cells. Alpha beta-T cell receptor+ CD4−CD8− T cells produce IL-4. J. Immunol. 149: 1211–1215 43. Carnaud C., Gombert J., Donnars O., Garchon H., Herbelin A. 2001. Protection T cell performance in NOD.NK1.1 mice congenic at the NK, complex. J. Immunol. 166: 2404–2411 44. Poulton L.D., Smyth M.J., Hawke C.G., Silveira P., Shpherd D., Naidenko O.V., Godfrey D.I., Baxter A.G. 2001. Cytometric and functional analyses of NK and NKT cell deficiencies in NOD mice. Int. Immunol. 13: 887–896 45. Hammond K.J., Pellicci D.G., Poulton L.D., Naidenko O.V., Scalzo A.A., Baxter A.G., Godfrey D.I. 2001. CD1d-restricted NKT cells: an interstrain comparison. J. Immunol. 167: 1164–1173 46. Smyth M., Godfrey D. 2000. NKT cells and tumor immunity—a double-edged sword. Nature Immunol. 1: 459–460 47. Sharif S., Arreaza G.A., Zucker P., Mi Q.S., Sondhi J., Naidenko O.V., Kronenberg M., Koezuka Y., Delovitch T.L., Gombert J.M., Leite-De-Moraes M., Gouarin C., Zhu R., Hameg A., Nakayama T., Taniguchi M., Lepault F., Lehuen A., Bach J.F., Herbelin A. 2001. Activation of natural killer T-cells by alpha-galactosylceramide treatment prevents the onset and recurrence of autoimmune type 1 diabetes. Nature Med. 7: 1057–1062 48. Gombert J.M., Tancrede-Bohin E., Hameg A., Leite-de-Moraes M.C., Vicari A., Bach J.F., A. H. 1996. IL-7 reverses NKI+ T cell-defective IL-4 production in the non-obese diabetic mouse. Int. Immunol. 8: 1751–1758 49. LaFace D.M., Peck A.B. 1989. Reciprocal allogeneic bone marrow transplantation between NOD mice and diabetes-nonsusceptible mice associated with transfer and prevention of autoimmune diabetes. Diabetes 38: 894–901 50. Sato K., Ohtsuka K., Hasegawa K., Yamagiwa S., Wantanabe H., Asakura H., Abo T. 1995. Evidence for extrathymic generation of intermediate T cell receptor cells in the liver revealed in thymectomized, irradiated mice subjected to bone marrow transplantation. J. Exp. Med. 182: 759–767 51. Ikehara S., Ohtsuki H., Good R.A., Asamoto H., Nakamura T., Sekita K., Muso E., Tochino Y., Ida T., Kuzuya H. 1985. Prevention of type I diabetes in nonobese diabetic mice by allogeneic bone marrow transplantation. Proc. Natl Acad. Sci. USA 82: 7743–7747 52. Ikehara S., Nakamura T., Sekita K., Muso E., Yasumizu R., Ohtsuki H., Hamashima Y., Good R.A. 1987. Treatment of systemic and organ-specific autoimmune disease in mice by allogeneic bone marrow transplantation. Prog. Clin. Biol. Res. 229: 131–146 53. Crispe I.N., Dao T., Klugewitz K., Mehal W.Z.a., Metz D.P. 2000. The liver as a site of T-cell apoptosis: graveyard, or killing field? Immunol. Rev. 174: 47–62
128
54. Coles M.C., Raulet D.H. 2000. NK1.1+T cells in the liver arise in the thymus and are selected by interactions with class I molecules on CD4+CD8+ cells. J. Immunol. 164: 2412–2418 55. Eberl G., MacDonald H.R. 1998. Rapid death and regeneration of NKT cells in anti-CD3epsilon- or IL-12-treated mice: a major role for bone marrow in NKT cell homeostasis. Immunity 9: 345–353 56. Huang C., Springer T.A. 1995. A binding interface on the I domain of lymphocyte function-associated antigen-1 (LFA-1) required for specific interaction with intercellular adhesion molecule 1 (ICAM-1). J. Biol. Chem. 270: 19008–19016 57. Matsumoto Y., Emoto M., Usami J., Maeda K., Yoshikai Y. 1994. A protective role of extrathymic alpha beta TcR cells in the liver in primary murine salmonellosis. Immunology 81: 8–14 58. Emoto M., Mittrucker H.W., Schmits R., Mak T.W., Kaufmann S.H. 1999. Critical role of leukocyte function-associated antigen-1 in liver accumulation of CD4+NKT cells. J. Immunol. 162: 5094–5098 59. Moriyama H., Yokono K., Amano K., Nagata M., Hasegawa Y., Okamoto N., Tsukamoto K., Miki M., Yoneda R., Yagi N., Tominaga Y., Kikutani H., Hioki K., Okumura K., Yagita H., Kasuga M. 1996. Induction of tolerance in murine autoimmune diabetes by transient blockade of leukocyte function-associated antigen-1/intercellular adhesion molecule-1 pathway. J. Immunol. 157: 3737–3743 60. Bertry-Coussot L., Lucas B., Danel C., Halbwachs-Mecarelli L., Bach J.F., Chatenoud L., Lemarchand P. 2002. Long-term reversal of established autoimmunity upon transient blockade of the LFA-1/intercellular adhesion molecule-1 pathway. J. Immunol. 168: 3641–3648 61. Muir A., Peck A., Clare-Salzler M., Song Y.H., Cornelius J., Luchetta R., Krischer J., Maclaren N. 1995. Insulin immunization of nonobese diabetic mice induces a protective insulitis characterized by diminished intraislet interferon gamma transcription. J. Clin. Invest. 95: 628–634 62. Falcone M., Yeung B., Tucker L., Rodriguez E., Sarvetnick N. 1999. A defect in interleukin 12-induced activation and interferon gamma secretion of peripheral natural killer T cells in nonobese diabetic mice suggests new pathogenic mechanisms for
A. Kukreja et al.
63.
64.
65.
66.
67.
68.
69.
70.
71.
insulin-dependent diabetes mellitus. J. Exp. Med. 190: 963–972 Gumperz J.E., Miyake S., Yamamura T., Brenner M.B. 2002. Functionally distinct subsets of CD 1d-restricted natural killer T cells revealed by CD Id tetramer staining. J. Exp. Med. 195: 625–636 Lee P.T., Benlagha K., Teyton L., Bendelac A. 2002. Distinct functional lineages of human V(alpha)24 natural killer T cells. J. Exp. Med. 195: 637–641 Hong S., Wilson M.T., Serizawa I., Wu L., Singh N., Naidenko O.V., Miura T., Haba T., Scherer D.C., Wei J., Kronenberg M., Koezuka Y., Van Kaer L. 2001. The natural killer T-cell ligand alpha-galactosylceramide prevents autoimmune diabetes in non-obese mice. Nature Med. 7: 1057–1062 Boitard C., Yasunami R., Dardenne M., JF B. 1989. T cell mediated inhibition of the transfer of autoimmune diabetes in the NOD mice. J. Exp. Med. 169: 1669–1680 Qin H.Y., Sadelain M.W., Hitchon C., Lauzon J., Singh B. 1993. Complete Freund’s adjuvant-induced T cells prevent the development and adoptive transfer of diabetes in nonobese diabetic mice. J. Immunol. 150: 2072–2080 Quinones M., Ahuja S.K., Melby P.C., Pate L., Reddick R.L., Ahuja S.S. 2000. Preformed membrane-associated stores of interleukin (IL)-12 are a previously unrecognized source of bioactive IL-12 that is mobilized within minutes of contact with an intracellular parasite. J. Exp. Med. 192: 507–516 Maclaren N., Lan M., Coutant R., Schatz D., Silverstein J., Muir A., Clare-Salzer M., She J.X., Malone J., Crockett S., Schwartz S., Quattrin T., De Silva M., Vander Vegt P., Notkins A., Krischer J. 1999. Only multiple autoantibodies to islet cells (ICA), insulin, GAD65, IA-2 and IA-2beta predict immune-mediated (Type 1) diabetes in relatives. J. Autoimmun. 12: 279–287 Yang Y., Bao M., Yoon J.W. 2001. Intrinsic defects in the T-cell lineage results in natural killer T-cell deficiency and the development of diabetes in the nonobese diabetic mouse. Diabetes 50: 2691–2699 Lin-Su K., Kukreja A., Maclaren N.K. 2001. Diabetes Vaccines: A Future to Be Realized. Diabetes Technol. & Therap. 3: 451–431