NLRP4 is an essential negative regulator of fructose-induced cardiac injury in vitro and in vivo

Biomedicine & Pharmacotherapy 91 (2017) 590–601

Available online at

ScienceDirect www.sciencedirect.com

Original article

NLRP4 is an essential negative regulator of fructose-induced cardiac injury in vitro and in vivo Yong-Gang Lian, Hai-Ying Zhao, Sheng-Ji Wang, Qin-Liang Xu, Xiang-Jun Xia* Department of Emergency Internal Medicine, Linyi People's Hospital, Jiefang Road 27, Linyi, Shandong Province, 276003, China

A R T I C L E I N F O

Article history: Received 18 March 2017 Received in revised form 19 April 2017 Accepted 27 April 2017 Keywords: Cardiac injury NLRP4 Inflammation TBK1/IRF3 IKK/NF-kB

A B S T R A C T

High fructose consumption leads to metabolic syndrome and enhances cardiovascular disease risk. However, our knowledge of the molecular mechanism underlying the cardiac disease caused by fructose feeding is still poor. Nod-like receptors (NLRs) are intracellular sensors, responding to a variety of intracellular danger signals to induce injuries. NLRP4 is a negative regulator of nuclear factor-kB (NF-kB) signaling pathway through interactions with kinase IkB kinase (IKK). Here, we illustrated that NLRP4 attenuates pro-inflammatory cytokines releasing, including Transforming growth factor (TGF-b1), Tumor necrosis factor-a (TNF-a), interleukin-1b (IL-1b), interleukin-18 (IL-18) and interleukin-6 (IL-6), in fructose-treated cardiac cells by means of RT-qPCR, and western blotting analysis. In addition, NLRP4 could reduce the expression of TANK-binding kinase 1/interferon regulatory factor 3 (TBK1/IRF3), reducing inflammation response and achieving its anti-hypertrophic action. TBK1 plays critical roles in the IRF3 signaling pathway, modulating inflammation response. The inhibition of IKK/NF-kB signaling pathway by NLRP4 is confirmed by NLRP4 over-expression and knockdown. In vivo, high fructose feeding induced cardiac injury, accompanied with reduced expression of NLRP4 in heart tissue samples, indicating the possible role of NLRP4 in ameliorating heart injury. In conclusion, the findings above indicated that NLRP4 is an important mediator of cardiac remodeling in vitro and in vivo through negatively regulating TBK1/IRF3 and IKK/NF-kB signaling pathways, indicating that NLRP4 might be a promising therapeutic target against cardiac inflammation. © 2017 Published by Elsevier Masson SAS.

1. Introduction More studies indicate that excess fructose consumption results in inflammation, oxidative stress, or autophagy to enhance the incidence of metabolic syndrome, and accelerates the risk of cardiac disease consequently [1,2]. And the diabetic cardiomyopathy is known as an essential complication of diabetes and characterized by persistent diastolic dysfunction, contributing to myocardial fibrosis [3]. Some recent reports have suggested a potential association between intake of fructose and adverse effects on cardiovascular health, which are major causes of serious health problems and increased mortality in world [4,5]. Inflammation is reported as a fundamental multi-step cellular in response to harmful stimuli, including toxins, pathogens, and trauma [6]. Therefore, it can be supposed that an essential role of the immune system is to sustain homeostatic tissue function [7].

* Corresponding author. E-mail addresses: [email protected], [email protected] (X.-J. Xia). http://dx.doi.org/10.1016/j.biopha.2017.04.120 0753-3322/© 2017 Published by Elsevier Masson SAS.

But, if inflammation response goes on unchecked, the maintained immune responses can result in serious inflammatory injury, leading to various diseases in host. High secretion of inflammatory cytokine significantly contributes to both acute and chronic inflammatory diseases. Increased pro-inflammatory cytokines, including IL-1b, TNF-a, IL-18 or IL-6, locally or systemic, have been associated with a variety of human diseases, including cardiac injury in diabetes [8,9]. Further, chronic inflammation, exhibiting in diet-induced metabolic syndrome animals, results in vascular and cardiac dysfunction [10]. During the process, the protein levels of NF-kB were accelerated, accompanied with a down-regulation of anti-oxidants or anti-inflammatory factors in cardiac tissues of animals with metabolic syndrome induced by high-carbohydrate or high-fat diet [11]. NLRs present a large group of protein family, which contains a conserved central nucleotide-binding and oligomerization domain (NOD), a leucine-rich repeat (LRR) region and a variable N-terminal effector domain [12,13]. For example, NLRX1 has been suggested to suppress type I IFN signal pathway and NF-kB phosphorylation by interacting with IKKa/IKKb or MAVS [14]. In our study, we reported that NLRP4 is a negative regulator of pro-inflammatory

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601 Table 1 The sequences of RT-PCR used in this study. Items

Primer (50 ! 30 )

mIL-1b (forward) mIL-1b (reverse) mTNF-a (forward) mTNF-a (reverse) mIL-6 (forward) mIL-6 (reverse) mIL-18 (forward) mIL-18 (reverse) mNLRP4 (forward) mNLRP4 (reverse) mTLR3 (forward) mTLR3 (reverse) mTLR4 (forward) mTLR4 (reverse) mTLR5 (forward) mTLR5 (reverse) mMyD88 (forward) mMyD88 (reverse) mTBK1 (forward) mTBK1 (reverse) mTGF-b1 (forward) mTGF-b1 (reverse) mIRF3 (forward) mIRF3 (reverse) mGAPDH (forward) mGAPDH (reverse) rIL-1b (forward) rIL-1b (reverse) rTNF-a (forward) rTNF-a (reverse) rIL-6 (forward) rIL-6 (reverse) rIL-18 (forward) rIL-18 (reverse) rNLRP4 (forward) rNLRP4 (reverse) rTLR3 (forward) rTLR3 (reverse) rTLR4 (forward) rTLR4 (reverse) rTLR5 (forward) rTLR5 (reverse) rMyD88 (forward) rMyD88 (reverse) rTBK1 (forward) rTBK1 (reverse) rTGF-b1 (forward) rTGF-b1 (reverse) rIRF3 (forward) rIRF3 (reverse) rGAPDH (forward) rGAPDH (reverse)

TACGACTCACTGGATAGTTA AAGGTATATTGACACTAGCT TGTGACCACAATGGGTAGGAGA CTGAGCCTGTGGCCATATATC GCCGTCTGTTCTGCTCGGGCAT ATTATGTTAATGATTATGAAT CGAACATCCAATACGGTTC ACAGGAAAGACTCCCAGTCA GTCTTCGCGCAAGAGTAACCAT CGCGAGACTCCATACCTATGC GAGGTATCCCTCGATGTGAGA CTCCTTCACATTTGCTAGTG CGCCTTCTACCACTACGCT GACCGCAGTAGATGAGTCGCT TACTGCGGACAAGACGCAA TCCTCCAGGTAGCCACAGT CATTCTCGTAGGTGATTG CACCCTGAGTAAGCTCTCCT GACCGTGAACATCCAGCTCT TCACCACAGTGAGAGGAGTG AGAGCCGAATGCGCGAATA TAAGCAGCGGATGAGCTGAG GCAGTCCAGAACACTCAACG TGACTACAGGACTCAGGATCA AGTGGCGAGGGACTTTCATG GGAGCCATGCCCAGTATTCC TACGACTCAATAGGGAATCT ATTTAGGTGACACTGATATTC TGGGTTGACAGCAATACCGA CCCTGCAGTGTGTGGCTTACAT GTAGCCCTTTATCTCGTCT ATAATAATTTATGTAGGAG CATCCTTGCATGGTACAAGTC AGAAAGACTCCACCAGGTCA GTAACGACTGTAGCGCACGAAC CTGAGATACGCCATCTCAGTGA GAGATCCAGCTGCATGTCGGC CTAGTCTGTTGCACTGAAC GCCCTTAGCCCTTCCACTACTCC GTCCACTGATGAATTCGG GCCTAATGGACAAGGACAG CGTATGCCACCACTCCAGTG GCAGTTACTCTGTGAACT CTCTGCTGTAAAGGCTTCAT GCAGACCGTGACCTGCT TCGACAGTGAACGAGGG GAAGCACGTGCAGAGCAAT CGGATAAGAGCTGATCGGCTCA GCACGTAAGTCCACACACCT TGCAAGAGCCATAACGAGT AGCAGGCAAGGTTGCATTGCTGA GGACATCCACAGCTTCTGGC

cytokines, which was associated with inactivation of IKKa/NF-kB and down-regulation of TBK1/IRF3 in fructose-induced cardiac muscle cells, indicating that NLRP4 might be considered as a therapeutic target against cardiac inflammation. 2. Materials and methods 2.1. Cells and culture The rat and mouse cardiac muscle cells, H9C2 and HL1, were purchased from KeyGen Biotech (Nanjing, China). Cells were cultured in DMEM supplemented with 10% FBS (Invitrogen, USA), penicillin (100 units/mL), and streptomycin (100 mg/mL) at 37
C in an atmosphere of 5% CO2. All cells were cultured until 80% confluence and then pretreated with various concentrations (0, 0.3125, 0.625, 1.25, 2.5 and 5 mM) of fructose at the indicated concentrations for different time (0, 6, 12, 24, 36 and 48 h), which

591

were then harvested for further study. For transfection assays, H9C2 and HL-1 cells were plated in 6-well plates and transfected using Lipofectamine 2000 for 0.75 ul/well (Invitrogen), with plasmid encoding NLRP4 (0, 25, 50 and 100 ng). Empty pcDNA3.1 was performed to maintain equal amounts of plasmid among all wells. Cells were harvested at 24 h after transfection for further treatment. The NLRP4 specific plasmids were purchased from Santa Cruz Biotechnology (USA). They were transfected into H9C2 and HL-1 cells by using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction. 2.2. Animals and treatments The 40 male C57BL/6 mice ranging from 6 to 8 weeks old (20– 22 g weight) were purchased from the Experimental Animal Center of Shanghai (Shanghai, China). All animal experiments were performed to minimize animal suffering following the Guide for the Care and Use of Laboratory Animals which was issued by the National Institutes of Health in 1996. Before the experiments, all mice were housed in a specific pathogen-free, temperature (25  2
C) and humidity-controlled environment (50  5% humidity) with a standard 12 h/12 h light/dark cycle with food and water in their cages. The Institutional Animal Care and Use Committee at Linyi People's Hospital (Shandong, P.R., China) approved the animal study protocols. Mice were administrated with a standard diet containing most essential nutrients, such as vitamins A (14 000 IU), D (1500 IU), E (120 IU), K (5 mg), B1 (13 mg), B2 (12 mg), B6 (12 mg), B12 (0.022 mg), biotin (0.2 mg) and niacin (60 mg) per kg. All the mice were divided into 2 groups: Normal (without any treatment, n = 20); High fructose diet group (Fru, n = 20). The fructose (30%) solution in drinking water was given to mouse for 15 weeks. At the end of experiments, eyeball bloods were harvested for the test of pro-inflammatory cytokines levels. Subsequently, heart tissues were rapidly removed and stored at 80
C for RT-qPCR and western blot analyses. 2.3. ELISA methods The heart tissue samples were frozen in liquid nitrogen and crushed into a powder with a multi-bead shocker. Then, the powder was dissolved in cell lysis buffer (10 w/v of a protease inhibitor cocktail containing 10 nM EDTA, 2 mM PMSF, 0.1 mg/mL soybean trypsin inhibitor, 1.0 mg/mL BSA and 0.002% sodium azide in isotonic PBS (pH 7.0)). The extract was prepared by centrifugation at 12,000  g for 10 min at 4
C, and the supernatant was kept for further study. The sample protein concentrations were calculated using a BCA protein assay kit (Thermo Fisher Scientific Inc.). IL-1b, TNF-a, IL-18, IL-6 and TGF-b1 protein levels were assessed using respective Mouse ELISA kit (R&D Systems Inc, USA) following the manufacturer’s instruction. Finally, the absorbance was read at 450 nm by a microplate reader. 2.4. Heart function assessment Left ventricle (LV) internal cavity diameters at diastole (LVIDd) was measured from M-mode traces and the percent of fractional shortening was calculated. The echocardiography was performed using an array transducer system (GE, USA). 1.5–2.5% isoflurane administered via inhalation, and maintained in a supine position on a dedicated animal handling platform with limbs attached for electrocardiogram gating during imaging, and the chest hair was shaved. Body temperature was kept constant through feeding the signal of a rectal probe back to a heating pad, while the heart and the respiratory rates were continuously monitored. The transducer was placed on the left hemithorax. Fractional shortening (FS%) of left ventricle was calculated as follows: FS (%) = ((LVDd  LVSd)/

592

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

Fig. 1. NLRP4 expression is down-regulated in fructose-induced cardiac cells in vitro. (A) Rat cardiac muscle cell, H9C2, was exposed to 5 mM fructose for the indicted time, ranging from 0 to 48 h, followed by RT-qPCR analysis of NLRP4 mRNA levels. (B) The mouse cardiac muscle cell, HL1, was cultured with 5 mM fructose for the indicted time (0, 6, 12, 24, 36, and 48 h). Then, RT-qPCR analysis was carried out to analyze NLRP4 mRNA levels. (C) H9C2 and HL1 cells were treated with 5 mM fructose for the described time, and then the cells were harvested for western blotting analysis of NLRP4. (D) H9C2 cells were exposed to different concentrations of fructose for 24 h, which was followed by RT-qPCR analysis. (E) HL-1 cells were treated with various doses of fructose as indicated for 24 h. And then, RT-qPCR assay was performed to determine NLRP4 gene levels. (F) Western blotting analysis was used to calculate NLRP4 protein expression levels in H9C2 and HL-1 cells after different concentrations of fructose exposure. Data are shown as the mean  SEM (n = 8). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments).

LVDd)  100, where LVDd is left ventricle dimension at enddiastole and LVSd is left ventricle dimension at end-systole. 2.5. Western blotting analysis Cardiac muscle cells were harvested and washed with PBS for three times, and heart tissue samples stored at 80
C were taken out. Then, they were lysed using RIPA buffer (10 mM Tris-HCl, 1 mM EDTA and 250 mM sucrose, pH 7.4, containing 15 mg/mL aprotinin, 5 mg/mL leupeptin, 0.1 mM PMSF, 1 mM NaF and 1 mM Na3VO4) containing a 1:100 dilution of protease inhibitor and phosphatase inhibitor (Baomanbio, Shanghai). The lysates were then centrifuged at 12,000g for 20 min at 4
C to collect the supernatant. Protein concentrations were evaluated by a BCA protein assay (Thermo, USA), and equal protein samples (40 mg) were separated using 10% SDS-PAGE. Proteins were then electrophoretically

transferred to polyvinylidene difluoride membranes (Millipore), and then incubated with Tris-buffered saline containing 0.1% Tween 20 (TBST) with 5% skim milk (BD Difco, USA) for 2 h at room temperature. The primary antibodies dissolved in blocking buffer were used to detect the target protein blots at 4
C overnight for incubation. The bands on PVDF were covered by chemiluminescence with Pierce ECL Western Blotting Substrate reagents (Thermo Scientific Fermentas, USA). All experiments were performed in triplicate and done three times independently. The primary antibodies used in our study have been listed as followings: anti-TNF-a (1:1000, Cell Signaling Technology, USA), anti-IL-1b (1:1000, Cell Signaling Technology, USA), anti-NLRP4 (Abnova, USA), anti-IL-18 (1:1000, Cell Signaling Technology, USA), anti-IL-6 (1:1000, Abcam, USA), anti-TGF-b1 (1:1000, Abcam, USA), anti-p-IKKa (1:1000, Abcam, USA), anti-IkBa (1:1000, Abcam, USA), anti-p-IkBa (1:1000, Abcam, USA), anti-NF-kB

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

593

Fig. 2. NLRP4 reduces the expression of pro-inflammatory cytokines in fructose-treated cells. (A) H9C2 and (B) HL-1 cells were transfected with an expression vector of NLRP4 at 0, 25, 50 and 100 ng, followed by no fructose exposure or 5 mM fructose treatment for 24 h. Then, the cells were harvested for RT-qPCR analysis of TGF-b1, IL-1b, IL-18 and IL-6 gene levels. (C) H9C2 (Left) and HL-1 (Right) cells were transfected with an expression vector of NLRP4 at 0, 25, 50 and 100 ng, which were followed by fructose (5 mM) exposure or not for 24 h. Then, western blot analysis was used to calculate TNF-a, and IL-1b protein levels. Data are shown as the mean  SEM (n = 8). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments). * indicates P < 0.05, ** indicates P < 0.01 and *** indicates P < 0.001 (compared to the Fru group).

(1:1000, Abcam, USA), anti-p-NF-kB (1:1000, Abcam, USA), antiTBK1 (1:1000, Abcam, USA), anti-IRF3 (1:1000, Cell Signaling Technology, USA) and GAPDH (1:200, Santa cruz, USA). 2.6. Real time-quantitative (RT-qPCR) analysis Total RNA from cells and heart tissue samples was extracted using Trizol Reagent (Invitrogen) following the manufacturer’s instruction. Then, they were quantified and subjected to reverse transcription to prepare cDNA by RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific Fermentas). PCR reactions were performed using 2 mL cDNA and 10 mL iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, USA), 5 pmol of forward primer, 5 pmol of reverse primer and DEPC-treated H2O to 20 mL in a CFX96 Real-Time PCR Detection System (Bio-Rad). PCR was performed on a CFX96 Real-Time System (Bio-Rad Laboratory, USA). The sequences of primers were commercially synthesized and the sequences of primers are listed in Table 1. The reaction conditions were: denaturation step of 95
C for 10 min followed by 40 cycles of

amplification and quantification steps of 95
C for 30 s, 60
C for 30 s and 72
C for 1 min. The melt curve conditions were: 95
C for 15s, 60
C for 15 s and 95
C for 15s. mRNA expression normalized to the expression of the housekeeper of GAPDH was measured using the DCt method. The data were collected and analyzed using the comparative threshold cycle method. Briefly, the cycle threshold (¼Ct) values of each target gene were subtracted from the Ct values of the housekeeping genecy clophilin (DCt). Target gene DDCt was calculated as DCt of target gene minus DCt of control. The fold change in mRNA expression was calculated as 2DDCt. 2.7. The immunohistochemical analysis The heart tissue samples were isolated from mice and fixed in 4% paraformaldehyde for 24 h and embedded in paraffin. Blocks were cut into 4-um-thick sections, air-dried and deparaffinized in xylene. Sections were stained with hematoxylin and eosin (H&E; Beyotime) to evaluate the histological morphology, The Sirius Red

594

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

Fig. 3. NLRP4-knockdown accelerates pro-inflammatory cytokines expression in vitro. (A) Western blot analysis of NLRP4 in both H9C2 and HL-1 cells after knockdown of NLRP4. (B) H9C2 and (C) HL-1 cells were treated with NLRP4-specific siRNA or the scrambled siRNA for 24 h, followed by fructose treatment or not for another 24 h. Then, all cells were harvested for mRNA determination through RT-qPCR analysis of TGF-b1, TNF-a, IL-1b, IL-18 and IL-6. (D) H9C2 and HL-1 cells were treated with NLRP4-specific siRNA or the scrambled siRNA for 24 h, which were followed by fructose treatment or not for another 24 h. And western blot analysis was performed to evaluate TGF-b1, TNFa, IL-1b, IL-18 and IL-6 protein expression levels. Data are shown as the mean  SEM (n = 8). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments). * indicates P < 0.05, ** indicates P < 0.01 and *** indicates P < 0.001 (compared to the Fru group).

(Beyotime) to evaluate the cardiac fibrosis levels and with wheat germ agglutinin (WGA) to calculate the cardiomyocyte size. Quantification of cardiomyocyte was determined after incubation with wheat germ agglutinin conjugate of Alexa Fluor 488 (1:200) at room temperature for 1 h. The fibrosis levels were calculated using Picro Sirius Red Stain (Abcam, USA) according to the manufacturer’s instruction. Paraffin-fixed heart sections were treated with xylene and a graded ethanol series to diminish paraffin and for rehydration. The sections were immunostained with primary antibody against NLRP4 (Abnova, USA) overnight at 4
C, and treated with secondary antibody according to the manufacturer’s instructions.

PBS twice and then blocked with 1% bovine serum albumin at room temperature for 30 min. Then the cells were incubated overnight with rabbit anti-NF-kB primary antibody (1:50, Abcam). After being washed with PBS for three times, the samples were performed with goat anti-rabbit secondary antibody (Alexa Fluor 488 goat anti-rabbit IgG) conjugated to Alexa Fluor 488 (1:400, Beyotime) for 1 h under dark condition. Then, the cells were counterstained with DAPI (Beyotime) for 15 min, and analyzed using an immunofluorescence microscope. Three slides per experimental condition, and repeated three times using separate cell cultures. 2.9. Statistical analysis

2.8. Immunofluorescent analysis For measurement of NF-kB, immunofluorescence staining was performed. Briefly, after the H9C2 cells were placed in 6 well plates and treated under various conditions. The cells were washed with

Statistical analysis was performed using the GraphPad Prism 5 program (GraphPad Software Inc.). Statistical differences were evaluated using Student’s t-test with the confidence interval set at 95% level, and by ANOVA with Dunnet’s least significant difference

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

595

Fig. 4. NLRP4 is associated with TBK1/IRF3 in fructose-induced muscle cells. (A) H9C2 and (B) HL-1 cells were transfected with an expression vector of NLRP4 at 0, 25, 50 and 100 ng, followed by no fructose exposure or 5 mM fructose treatment for 24 h. Then, the cells were harvested for RT-qPCR analysis of TLR3, TLR4, TLR5 and MyD88 gene expression levels. Meanwhile, TBK1 and IRF3 mRNA levels in (C) H9C2 and (D) HL1 cells were calculated by RT-qPCR analysis. H9C2 and (F) HL-1 cells were treated with NLRP4-specific siRNA or the scrambled siRNA for 24 h, followed by fructose treatment or not for another 24 h. Then, all cells were harvested for determination of TBK1 and IRF3 through (E) RT-qPCR and (F) Western blot analysis. Data are shown as the mean  SEM (n = 8). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments). * indicates P < 0.05, ** indicates P < 0.01 and *** indicates P < 0.001 (compared to the Fru group).

596

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

Fig. 5. NLRP4 negatively regulates TBK1/IRF3 pathway in cells without fructose. H9C2 and HL-1 cells were transfected with an expression vector of NLRP4 at 0, 25, 50 and 100 ng in the absence of fructose treatment for 24 h. Then, the cells were harvested for (A) western blot and (B) RT-qPCR analysis of TBK1 and IRF3. Data are shown as the mean  SEM (n = 8). * indicates P < 0.05, ** indicates P < 0.01 and *** indicates P < 0.001 (compared to the 0 ng group).

post-hoc tests. A p-value less than 0.05 will be considered significant. 3. Results 3.1. NLRP4 expression is down-regulated in fructose-induced cardiac cells in vitro Rat cardiac muscle cell, H9C2, and mouse cardiac muscle cell, HL-1, were exposed to 5 mM fructose for various time, ranging from 0 to 48 h, followed by RT-qPCR analysis of NLRP4 mRNA levels. As shown in Fig. 1A and B, we found that the gene levels of NLRP4 were down-regulated in H9C2 and HL-1 cells timedependently after 5 mM fructose induction. Also, western blotting analysis further indicated that NLRP4 protein levels in H9C2 and HL-1 cells were highly reduced in a time-dependent manner, which was in line with the results of RT-qPCR analysis (Fig. 1C). Next, the H9C2 and HL1 cells were exposed to various concentrations of fructose for 24 h, which were then used for gene calculation. RT-qPCR analysis suggested that NLRP4 mRNA levels were significantly decreased in cardiac muscle cells dosedependently, which was comparable to the group in the absence of any treatments (Fig. 1D and E). Further, western blotting analysis further confirmed that NLRP4 was down-regulated in a dosedependent manner in fructose-induced cardiac muscle cells (Fig. 1F). 3.2. NLRP4 reduces the expression of pro-inflammatory cytokines in fructose-treated cells H9C2 (Fig. 2A) and HL-1 (Fig. 2B) cells were transfected with an expression vector of NLRP4 at 0, 25, 50 and 100 ng for 24 h,

followed by no fructose exposure or 5 mM fructose treatment for another 24 h. Then, the cells were harvested for RT-qPCR analysis. As shown in Fig. 2A and B, we found that high fructose alone treatment to H9C2 and HL-1 cells significantly induced the gene expression of TGF-b1, IL-1b, IL-18 and IL-6 in comparison to the control group. Of note, after an expression vector for NLRP4 treatments at 0, 25, 50 and 100 ng, we found that these proinflammatory cytokines gene levels were highly reduced in a dosedependent manner. Further, western blotting analysis showed that fructose caused high expression of TNF-a and IL-1b, which was inhibited by NLRP4 in both H9C2 and HL-1 cells (Fig. 2C). Taken together, the results above revealed that NLRP4 is a negative regulator for the release of pro-inflammatory cytokines. 3.3. NLRP4 knockdown accelerates pro-inflammatory cytokines expression in vitro According to the results above, we could suppose that NLRP4 is a negative modulator for inflammatory response. Hence, in this regard, it was aimed to further confirm our hypothesis. And NLRP4 was silenced in both H9C2 and HL1 cells using NLRP4 specific siRNA for 24 h, followed by fructose exposure for another 24 h. And western blot analysis was used to calculate the results. As shown in Fig. 3A, after NLRP4 knockdown using specific siRNA, it was highly reduced in NLRP4-siRNA groups in both two cells, applied for further study. From Fig. 3B and C, we found that fructose exposure triggered high expression of pro-inflammatory cytokines. Interestingly, NLRP4 knockdown showed elevated effects on the expression of TGF-b1, TNF-a, IL-1b, IL-18 and IL-6, demonstrating that NLRP4, indeed, at least partly plays as an inhibitor of proinflammatory cytokines in fructose-induced cardiac cells. Moreover, western blotting assays revealed that high protein levels of

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

597

Fig. 6. NLRP4 negatively modulates IKKa/NF-kB signaling pathway in fructose-treated cells. (A) H9C2 cells were transfected with an expression vector of NLRP4 at 0, 25, 50 and 100 ng, followed by no fructose exposure or 5 mM fructose treatment for 24 h. Next, western blotting analysis was carried out to calculate phosphorylated IKKa, IkBa, phosphorylated NF-kB protein levels in cells. (B) H9C2 cells were treated with NLRP4-specific siRNA or the scrambled siRNA for 24 h, followed by fructose treatment or not for another 24 h. Then, the immunofluorescence analysis was used to determine NF-kB translocation into the nuclear. Data are shown as the mean  SEM (n = 8). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments). * indicates P < 0.05, ** indicates P < 0.01 and *** indicates P < 0.001 (compared to the Fru group).

TGF-b1, TNF-a, IL-1b, IL-18 and IL-6 induced by fructose were further augmented by NLRP4 silence in H9C2 and HL1 cells after fructose induction (Fig. 3D). 3.4. NLRP4 negatively regulates TBK1/IRF3 pathway in fructoseinduced cells As shown in Fig. 4A and B, H9C2 and HL-1 cells after different treatments as indicated, were collected for gene analysis of TLR3, TLR4, TLR5, and MyD88 through RT-qPCR analysis. The findings indicated that NLRP4 activation showed no significant difference on the expression of these signals after fructose exposure. TBK1 and IRF3, two important molecules in regulating NF-kB phosphorylation, are reported to have close relationship with NLRP4. Thus, we investigated the expression of TBK1 and IRF3 in cells through RT-qPCR analysis. From Fig. 4C and D, we found that TBK1 and IRF3 were markedly enhanced for fructose treatment, which were significantly down-regulated by NLRP4 in a concentration-dependent manner. Finally, NLRP4 was silenced with specific NLRP4 siRNA. The results indicated that NLRP4 knockdown enhanced fructose-induced TBK1 and IRF3 expression from gene levels (Fig. 4E and F). As it was shown in Fig. 4G, western blot analysis further indicated that NLRP4 knockdown significantly elevated fructose-triggered over-expression of TBK1 and IRF3 in both H9C2 and HL-1 cells, which further confirmed that NLRP4 negatively regulated TBK1/IRF3 pathway. In order to further reveal the association of NLRP4 between TBK1/IRF3, NLRP4 expression was enhanced in H9C2 and HL-1 cells, which were in absence of fructose. Then, western and RTqPCR assays indicated that in H9C2 and HL-1 cells without fructose treatment, the expression of TBK1 and IRF3 were suppressed by

NLRP4 treatment dose-dependently both from the protein and gene levels (Fig. 5A and B). The data here indicated that NLRP4 might have a function to negatively regulate the expression of TBK1 and IRF3. 3.5. NLRP4 negatively modulates IKKa/NF-kB signaling pathway in fructose-treated cells Inflammation response is closely linked to IKKa/NF-kB signaling pathway, which has been associated with TBK1/IRF3 expression levels to modulate pro-inflammatory cytokines secretion [15]. From Fig. 6A, we found that phosphorylated IKKa, phosphorylated IkBa, and phosphorylated NF-kB protein levels were expressed highly in fructose-exposed H9C2 cells, while IkBa was inactivated. Significantly, NLRP4 treatment reduced IKKa, IkBa, and NF-kB phosphorylation, which was shown in a dose-dependent manner. And in contrast, IkBa was up-regulated after NLRP4 treatment. In addition, NF-kB translocation from the cytoplasm into the nuclear was measured using immunofluorescence analysis in H9C2 cells treated with NLRP4 specific siRNA to inhibit NLRP4 expression. As shown in Fig. 6B, we found that the translocation of NF-kB from cytoplasm into nucleus was enhanced in fructose-induced cells, evidenced by fluorescent intensity, which was accelerated for the suppression of NLRP4. The data above revealed that NLRP4 negatively regulated IKKa/NF-kB signaling pathway, a potential molecular mechanism to inhibit inflammation response. 3.6. Fructose feeding induces cardiac injury in mice Fructose feeding to mice for a long time could induce cardiac injury regarding to cardiovascular diseases [16]. Here in our study,

598

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

Fig. 7. Fructose feeding to mice induces cardiac injury. (A) The gross hearts, H&E staining, WGA, and Sirius Red staining of heart isolated from high fructose-feeding mice for consecutive 15 weeks. (B) The analysis of HW/BW, HW/TL, cross-sectional area, and fibrosis levels were measured. (C) Representative echocardiographic images of hearts derived from mice. The percentage of FS and the thickness of LVIDd were assessed. (D) RT-qPCR analysis was used to calculate ANP and BNP levels to evaluate the cardiac injury of hypertrophic hearts. Data are shown as the mean  SEM (n = 10). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments).

the experimental animals were fed with fructose for consecutive 15 weeks to explore if NLRP4 was altered among different groups. As shown in Fig. 7A and B, we found that the heart size was significantly larger in the fructose-feeding group compared to the control group, accompanied with enhanced HW/BW (heart weight/body weight), as well as HW/TL (heart weight/tibia length), indicating the injured heart of mice with high fructose feeding. Further, H&E staining and WGA analysis indicated that the significantly enlarged cell size of cardiomyocyte cross-sectional areas was observed in the Fru group compared to the Con group. And finally, the Sirius Red staining indicated that fibrosis was induced due to high fructose feeding for long time, further suggesting cardiac injury was induced by fructose feeding. Next, the representative images of echocardiogram exhibited that the thickness of left ventricular end-diastolic dimension (LVIDd) was increased after fructose treatment for 15 weeks, while fractional shortening (FS) percentage was reduced due to fructose diets

(Fig. 7C). In the end of this part, ANP and BNP, two essential signals indicating cardiac injury, were found to be highly enhanced in mice with fructose induction from gene levels via RT-qPCR analysis (Fig. 7D). Fructose feeding induced pro-inflammatory cytokines expression in vitro in our study. And according to previous studies, animals administered with fructose consumption in large number were found to be with severe inflammation response [17,18]. Here, we further ensured the results that fructose feeding indeed led to high secretion of pro-inflammatory cytokines in the serum and heart tissue samples, including TGF-b1, TNF-a, IL-1b, IL-18 and IL6, evidenced by ELISA methods (Fig. 8A and B). In addition, RTqPCR analysis suggested that these cytokines gene expression levels were enhanced by fructose feeding (Fig. 8C). Taken together, the data above confirmed that high fructose feeding could result in cardiac injury, indicated by cardiac dysfunction, as well as inflammatory response.

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

599

Fig. 8. Fructose diet induces the secretion of pro-inflammatory cytokines. Pro-inflammatory cytokines of TGF-b1, TNF-a, IL-1b, IL-18 and IL-6 in the (A) serum and (B) heart tissue samples isolated from mice were calculated using ELISA methods. (C) RT-qPCR analysis was used to calculate TGF-b1, TNF-a, IL-1b, IL-18 and IL-6 gene levels in the heart tissue samples of mice. Data are shown as the mean  SEM (n = 10). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments).

3.7. NLRP4 is down-regulated in high fructose-feeding-induced mice

4. Discussion

Also, in vivo, NLRP4 gene levels and protein levels were measured using RT-qPCR and western blotting analysis. As shown in Fig. 9A and B, we found that NLRP4 gene and protein levels were significantly reduced in heart tissue samples with fructose diet induction. Moreover, the immunohistochemical analysis illustrated that NLRP4 was suppressed by fructose in mice, which was comparable to the control group (Fig. 9C). Next, phosphorylated IKKa, phosphorylated NF-kB protein levels were found to be upregulated in Fru group, which was in lines with previous reported studies [19]. In contrast, IkBa was down-regulated (Fig. 9D). Finally, TBK1 and IRF3 were discovered with accelerated protein levels due to fructose feeding (Fig. 8E). In conclusion, the findings above indicated that in fructose-feeding mice, NLRP4 was significantly reduced, while IKKa/NF-kB, and TBK1/IRF3 signaling pathways were elevated, leading to cardiac injury, which was in agreement with the results in vitro.

Although NLRs were identified as intracellular pathogen sensors originally, recent studies indicate that a variety of NLRs can also function beyond the pathogen detection [12,13,20,21]. NLRP4 has been characterized as a negative modulator for NF-kB signaling pathway. However, its role in various disease conditions is remained to be elucidated, especially from the inflammatory response. According to previous studies, it is important that preinflammatory cytokines release through NF-kB plays an essential role in contribution of cardiac disease induced by fructose in vitro and in vivo [11,22]. Also, the molecular mechanism to reveal the cardiac injury is still required further study to find out a novel target for drug researching. First, in our study, we found that the release of pro-inflammatory cytokines, including TGF-b1, TNF-a, IL-1b, IL-18 and IL-6, was highly induced by fructose in vitro and in vivo, which was in line with previous studies. Over-expression of pro-inflammatory cytokines is critically important to induce

600

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

Fig. 9. NLRP4 is down-regulated in high fructose-feeding-induced mice. (A) RT-qPCR and (B) western blotting analysis were used to evaluate NLRP4 gene and protein levels in the heart tissue samples of mice with high fructose diet. (C) NLRP4 positive cells in heart tissue sections obtained from mice were evaluated. (D) Western blotting analysis was used to evaluate phosphorylated IKKa, IkBa, phosphorylated NF-kB protein levels in the heart tissue samples. (E) TBK1 and IRF3 protein levels were calculated using western blotting analysis. Data are shown as the mean  SEM (n = 10). + indicates P < 0.05, ++ indicates P < 0.01, and +++ indicates P < 0.001 (compared to the group in absence of any treatments).

inflammation response, which is a key point to induce development and progression of various diseases, including heart injury [23]. The increased gene levels of IL-1b, IL-18, IL-6 and TNF, are associated with enhanced risk of vascular disease [8,9,24]. IL-1b is produced by macrophages activated as proteins and is also known as catabolin. This cytokine proliferation is known as an important mediator of inflammatory response and various cellular functions, such as differentiation and apoptosis [25,26]. IL-6 has been mainly considered to be a pro-inflammatory cytokine with a broad range of effects, including augmentation of IL-1 and TNF, and to be an inducer of obesity-related insulin resistance in inactive subjects [27]. Indeed, blood IL-6 levels do rise early in response to acute proinflammatory stimuli and are usually elevated above baseline in chronic inflammatory states. TNF-a was considered to be an inflammatory response primarily, known to be causally related to insulin resistance and metabolic syndrome state. Consequently, cardiac injury under various situations is induced [28]. Here, we found that NLRP4 expression significantly reduced pro-inflammatory cytokines expression, while the silencing of NLRP4 elevated these pro-inflammatory cytokines releasing, indicating that NLRP4 might be a negative modulator for pro-inflammatory cytokines secretion in vitro. In vivo, we found that circulating and local inflammatory cytokines in heart were also up-regulated by fructose induction, which was in agreement with previous studies. However, as for the specific role of NLRP4 in vivo to modulate cytokines release, further study is still needed through NLRP4 knockout in mice. In the present study, we have investigated the effects of NLRP4 in regulating fructose-induced cardiac muscle cells in vitro, as well as its alteration in fructose-induced mice in vivo. And the possible molecular mechanism was explored, which might rely on TBK1/ IRF3 and IKKa/NF-kB signaling pathways to regulate inflammation

response. Ectopic expression of NLRP4 suppressed TBK1 and IRF3 expression. In contrast, NLRP4 knockdown accelerated TBK1 and IRF3 expression. TBK1 is known as an essential component of type I interferon signaling [29]. Additionally, TBK1 has been shown to have a critical role in tumor development, dependent on AKT/NFkB signaling pathway [30,31]. NF-kB modulates the expression of pro-inflammatory cytokines, such as IL-1, IL-18, type-I interferon (IFN-a, and IFN-b), TNF-a, as well as chemoattractant cytokines (chemokines). Translocation of NF-kB to the nucleus is known to activate transcription of several genes [32]. Similarly, in our study, we found that through immunofluorescent analysis, NF-kB translocation into the nuclear is enhanced in cardiac muscle cells after NLRP4 knockdown. According to previous studies, TBK1 plays an important role in regulating NF-kB signaling pathway, which is related to inflammation regulation [33]. Consistently, NLRP4 expression impeded NF-kB phosphorylation, accompanied with reduced phosphorylation of IKKa and IkBa, as well as elevated IkBa levels. The results above further confirmed the findings as before that NLRP4 is a negative regulator for NF-kB activation. NLRP4-regulated TBK1 is signal dependent. NLRP4 could bind to the activated form of TBK1, which was able to activate IRF3. Under normal situation, TBK1 and IRF3 maintain the inactivated form, which could be conversed by stimulation [29,34,35]. Here, fructose feeding might be a stimuli, which enhances the total TBK1 and IRF3, a possible factor that enhances their activation through interacting with NLRP4. TLR/MyD88 signaling pathway is crucial for inflammation under a variety of conditions, including fructose feeding or induction in a number of diseases, such as obesity, diabetes, as well as cardiovascular disease [36,37]. In our study, we found that NLRP4 expression showed no significant effect on TLRs (TLR3, TLR4 and TLR5) and MyD88 expression from gene levels, suggesting that

Y.-G. Lian et al. / Biomedicine & Pharmacotherapy 91 (2017) 590–601

NLRP4-regulated inflammation was not dependent on TLRs/ MyD88 signaling pathways, which was in line with previous study that NLRP4 did not interact with MyD88 [35]. In vivo, high fructose feeding induced cardiac injury by promoting inflammation response via NF-kB activation. In contrast, NLRP4 was reduced for fructose feeding, suggesting that it might has a negative relationship with inflammation response by regulating TBK1/IRF3 and IKKa/NF-kB signaling pathways. However, further study is still needed to reveal the underlying molecular mechanism. Overall, our study has demonstrated an unrecognized molecular mechanism of fructose-induced cardiac injury in vitro and in vivo. NLRP4 might be a crucial target to suppress TBK1/IRF3 and IKKa/NF-kB signaling pathways, reducing pro-inflammatory cytokines release and preventing cardiac injury. Conflict of interest statement The authors see no conflict of interest. References [1] Y. Zhang, Y. Zhang, Toll-like receptor-6 (TLR6) deficient mice are protected from myocardial fibrosis induced by high fructose feeding through antioxidant and inflammatory signaling pathway, Biochem. Biophys. Res. Commun. 473 (2) (2016) 388–395. [2] R. Geetha, M.K. Radika, E. Priyadarshini, et al., Troxerutin reverses fibrotic changes in the myocardium of high-fat high-fructose diet-fed mice, Mol. Cell. Biochem. 407 (1–2) (2015) 263–279. [3] T. Miki, S. Yuda, H. Kouzu, et al., Diabetic cardiomyopathy: pathophysiology and clinical features, Heart Fail. Rev. 18 (2) (2013) 149–166. [4] D.A. Kubli, Å.B. Gustafsson, Unbreak my heart: targeting mitochondrial autophagy in diabetic cardiomyopathy, Antioxid. Redox Signal. 22 (17) (2015) 1527–1544. [5] J. Lasheras, M. Vilà, M. Zamora, et al., Gene expression profiling in hearts of diabetic mice uncovers a potential role of estrogen-related receptor g in diabetic cardiomyopathy, Mol. Cell. Endocrinol. 430 (2016) 77–88. [6] J.R. Scalea, J. Bromberg, S.T. Bartlett, et al., Mechanistic similarities between trauma: atherosclerosis, and other inflammatory processes, J. Crit. Care 30 (6) (2015) 1344–1348. [7] F. Ginhoux, S. Jung, Monocytes and macrophages: developmental pathways and tissue homeostasis, Nat. Rev. Immunol. 14 (6) (2014) 392–404. [8] N. Abate, H.S. Sallam, M. Rizzo, et al., Resistin: an inflammatory cytokine. Role in cardiovascular diseases, diabetes and the metabolic syndrome, Curr. Pharm. Des. 20 (31) (2014) 4961–4969. [9] N.A. Turner, Effects of interleukin-1 on cardiac fibroblast function: relevance to post-myocardial infarction remodelling, Vasc. Pharmacol. 60 (1) (2014) 1–7. [10] S. Xiao, N. Fei, X. Pang, et al., A gut microbiota-targeted dietary intervention for amelioration of chronic inflammation underlying metabolic syndrome, FEMS Microbiol. Ecol. 87 (2) (2014) 357–367. [11] X. Peng, Y. Nie, J. Wu, et al., Juglone prevents metabolic endotoxemia-induced hepatitis and neuroinflammation via suppressing TLR4/NF-kB signaling pathway in high-fat diet rats, Biochem. Biophys. Res. Commun. 462 (3) (2015) 245–250. [12] G.K. Silva, F.R.S. Gutierrez, P.M.M. Guedes, et al., Cutting edge: nucleotidebinding oligomerization domain 1-dependent responses account for murine resistance against Trypanosoma cruzi infection, J. Immunol. 184 (3) (2010) 1148–1152. [13] J. Mo, J.P. Boyle, C.B. Howard, et al., Pathogen sensing by nucleotide-binding oligomerization domain-containing protein 2 (NOD2) is mediated by direct binding to muramyl dipeptide and ATP, J. Biol. Chem. 287 (27) (2012) 23057– 23067. [14] K.H. Richards, A. Macdonald, Putting the brakes on the anti-viral response: negative regulators of type I interferon (IFN) production, Microbes Infect. 13 (4) (2011) 291–302.

601

[15] P. Liu, M. Lu, B. Tian, et al., Expression of an IKKg splice variant determines IRF3 and canonical NF-kB pathway utilization in ssRNA virus infection, PLoS One 4 (11) (2009) e8079. [16] K.L. Stanhope, V. Medici, A.A. Bremer, et al., A dose-response study of consuming high-fructose corn syrup–sweetened beverages on lipid/ lipoprotein risk factors for cardiovascular disease in young adults, Am. J. Clin. Nutr. 101 (6) (2015) 1144–1154. [17] J.D. Botezelli, A. Coope, A.C. Ghezzi, et al., Strength training prevents hyperinsulinemia, insulin resistance, and inflammation independent of weight loss in fructose-fed animals, Sci. Rep. 6 (2016). [18] Q.Y. Zhang, Y. Pan, R. Wang, et al., Quercetin inhibits AMPK/TXNIP activation and reduces inflammatory lesions to improve insulin signaling defect in the hypothalamus of high fructose-fed rats, J. Nutr. Biochem. 25 (4) (2014) 420– 428. [19] Z. Hu, L. Ren, C. Wang, et al., Effect of chenodeoxycholic acid on fibrosis: inflammation and oxidative stress in kidney in high-fructose-fed Wistar rats, Kidney Blood Press. Res. 36 (1) (2012) 85–97. [20] G. Wang, B. Roux, F. Feng, et al., The decoy substrate of a pathogen effector and a pseudokinase specify pathogen-induced modified-self recognition and immunity in plants, Cell Host Microbe 18 (3) (2015) 285–295. [21] G. Wang, B. Roux, F. Feng, et al., The decoy substrate of a pathogen effector and a pseudokinase specify pathogen-induced modified-self recognition and immunity in plants, Cell Host Microbe 18 (3) (2015) 285–295. [22] A. Kauppinen, T. Suuronen, J. Ojala, et al., Antagonistic crosstalk between NFkB and SIRT1 in the regulation of inflammation and metabolic disorders, Cell. Signal. 25 (10) (2013) 1939–1948. [23] N.G. Frangogiannis, Inflammation in cardiac injury, repair and regeneration, Curr. Opin. Cardiol. 30 (3) (2015) 240. [24] S. Tsimikas, G.W. Duff, P.B. Berger, et al., Pro-inflammatory interleukin-1 genotypes potentiate the risk of coronary artery disease and cardiovascular events mediated by oxidized phospholipids and lipoprotein (a), J. Am. Coll. Cardiol. 63 (17) (2014) 1724–1734. [25] N. Ozeki, N. Hase, T. Hiyama, et al., IL-1b-induced, matrix metalloproteinase3-regulated proliferation of embryonic stem cell-derived odontoblastic cells is mediated by the Wnt5 signaling pathway, Exp. Cell Res. 328 (1) (2014) 69–86. [26] W.S. Lee, J.H. Lim, M.S. Sung, et al., Ethyl acetate fraction from Angelica sinensis inhibits IL-1b-induced rheumatoid synovial fibroblast proliferation and COX2, PGE2, and MMPs production, Biol. Res. 47 (1) (2014) 41. [27] J. Mauer, B. Chaurasia, J. Goldau, et al., Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin, Nat. Immunol. 15 (5) (2014) 423–430. [28] H. Pei, X. Song, C. Peng, et al., TNF-a inhibitor protects against myocardial ischemia/reperfusion injury via Notch1-mediated suppression of oxidative/ nitrative stress, Free Radic. Biol. Med. 82 (2015) 114–121. [29] H. Xiao, M. Du, J. Liu, et al., 201: Casine kinase II is a novel regulator of TBK1/ IRF3 and type I interferon induction by various innate receptors, Cytokine 70 (1) (2014) 76–77. [30] L. Gao, Z. Xu, Y. Wang, et al., Anticancer effect of SZC017: a novel derivative of oleanolic acid, on human gastric cancer cells, Oncol. Rep. 35 (2) (2016) 1101– 1108. [31] L.Y. Bai, C.F. Chiu, N.P. Kapuriya, et al., BX795, a TBK1 inhibitor, exhibits antitumor activity in human oral squamous cell carcinoma through apoptosis induction and mitotic phase arrest, Eur. J. Pharmacol. 769 (2015) 287–296. [32] Q. Lei, L. Li, J. Cai, et al., ORF3 of hepatitis E virus inhibits the expression of proinflammatory cytokines and chemotactic factors in LPS-stimulated human PMA-THP1 cells by inhibiting NF-kB pathway, Viral Immunol. 29 (2) (2016) 105–111. [33] T. Abe, G.N. Barber, Cytosolic-DNA-mediated, STING-dependent proinflammatory gene induction necessitates canonical NF-kB activation through TBK1, J. Virol. 88 (10) (2014) 5328–5341. [34] C. Qian, X. Cao, Regulation of toll-like receptor signaling pathways in innate immune responses, Ann. N. Y. Acad. Sci. 1283 (1) (2013) 67–74. [35] J. Cui, Y. Li, L. Zhu, et al., NLRP4 negatively regulates type I interferon signaling by targeting the kinase TBK1 for degradation via the ubiquitin ligase DTX4, Nat. Immunol. 13 (4) (2012) 387–395. [36] Y. Naiki, R. Sorrentino, M.H. Wong, et al., TLR/MyD88 and liver X receptor a signaling pathways reciprocally control Chlamydia pneumoniae-induced acceleration of atherosclerosis, J. Immunol. 181 (10) (2008) 7176–7185. [37] M.V. Singh, P.D. Swaminathan, E.D. Luczak, et al., MyD88 mediated inflammatory signaling leads to CaMKII oxidation: cardiac hypertrophy and death after myocardial infarction, J. Mol. Cell. Cardiol. 52 (5) (2012) 1135–1144.