- Email: [email protected]
No association found between the promoter variants of ADRA1A and schizophrenia in the Chinese population
Available online at www.sciencedirect.com
JOURNAL OF PSYCHIATRIC RESEARCH
Journal of Psychiatric Research 42 (2008) 384–388
www.elsevier.com/locate/jpsychires
No association found between the promoter variants of ADRA1A and schizophrenia in the Chinese population Ke Huang a,b,1, Yongyong Shi a,b,*,1, Wei Tang a,b,1, Ruqi Tang a,b, Shengzhen Guo Yifeng Xu c, Junwei Meng a,b, Xingwang Li a,b, Guoying Feng c, Lin He b,a,* b
b,d
,
a Bio-X Life Science Research Center, Shanghai Jiao Tong University, 1954 Huashan Road, Shanghai 200030, PR China Institute for Nutritional Sciences, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, PR China c Shanghai Institute of Mental Health, Shanghai 200030, PR China d NHGG, Bio-X Center, Shanghai Jiao Tong University, 1954 Huashan Road, Shanghai 200030, PR China
Received 12 September 2006; received in revised form 10 January 2007; accepted 1 February 2007
Abstract Schizophrenia is a chronic psychiatry disorder with a strong genetic component. A recent association study of a1A-adrenoceptor gene (ADRA1A) involving an isolated Spanish population, focusing on the promoter region of the ADRA1A, genotyped eight single SNPs at the promoter region of ADRA1A and found that two SNPs, 563G/A and 9625G/A, were associated with schizophrenia and schizoaffective disorders. We were interested in the two positive sites reported and selected five variants among the promoter region of ADRA1A, namely 563G/A, 9625G/A, 2760C/A, 4155G/C and a new substitution we detected between 508bp and 530bp upstream of the translation initiation site. Our sample consisted of 480 schizophrenia and 480 control subjects. All recruits were Han Chinese in Shanghai origin. However, neither individual SNP nor any haplotype was associated with schizophrenia in our study. These results suggest that the variants among the promoter of ADRA1A gene are unlikely to play a major role in the susceptibility to schizophrenia in the Chinese population. 2007 Elsevier Ltd. All rights reserved. Keywords: a1A-Adrenergic receptor; ADRA1A; Schizophrenia; Association; Promotor
1. Introduction Schizophrenia is a common, chronic and complex mental disorder with a significant genetic component in its etiology (Cardno and Gottesman, 2000; McGuffin et al., 1995). A large number of linkage studies have implicated several susceptibility loci for schizophrenia, including chro*
Corresponding authors. Address: Bio-X Life Science Research Center, Shanghai Jiao Tong University, P.O. Box 501, Haoran Building, 1954 Huashan Road, Shanghai 200030, PR China (Y. Shi). Institute for Nutritional Sciences, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences, 294 Taiyuan Road, Shanghai 200031, PR China (L. He). Tel./fax: +86 21 62822491. E-mail addresses: [email protected] (Y. Shi), [email protected] (L. He). 1 These authors contributed equally to this work. 0022-3956/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.jpsychires.2007.02.008
mosomes such as 1q, 2p, 6p, 8p, 22q, 13q and other locations in the genome (Badner and Gershon, 2002; Lewis et al., 2003). A series of studies have reported association between candidate genes on these loci and schizophrenia (Blouin et al., 1998; Kendler et al., 1996; Norton et al., 2006), including ADRA1A (Clark et al., 2005) on chromosome 8p21 where several genes, including DRP-2 (Nakata and Ujike, 2004), PPP3CC (Gerber et al., 2003), NRG1 (Zhao et al., 2004) and FZD-3 (Katsu et al., 2003) have been reported to be associated with schizophrenia on this locus. There are three subtypes, a1A, a1B and a1D in the family of the a1-adrenergic receptor. The function of each individual subtype has yet to be clarified, because of lacking relevant agonist, antagonist or antibodies which could interact specifically with the members of the family
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
(Koshimizu et al., 2003; Tanoue et al., 2002). It has been reported that the noradrenergic receptors exhibit a dependent status in response to the change of synaptic noradrenaline in the brain of laboratory animals (Ordway and Klimek, 2001). Furthermore, a1-adrenergic receptor is a kind of G-protein-coupled receptor. There is consensus that the G-protein involved in signaling is the Gq/G11 form. Activation of this G-protein could elevate the level of intracellular calcium (Summers and McMartin, 1993), which is considered to be a crucial factor involved in schizophrenia (Lidow, 2003). Although there is no credible evidence indicating that any particular subtype of a1-adrenergic receptors might be related to any particular physiological function (Koshimizu et al., 2003), it has been suggested that the a1-adrenergic subtypes have effects on the cognitive functions of prefrontal cortical (PFC) relevant to schizophrenia in animals (Friedman et al., 1999; Knauber and Muller, 2000; Sirvio et al., 1994). A very recent association study found that the polymorphisms in the promoter region of the ADRA1A are associated with schizophrenia/schizoaffective disorder (Clark et al., 2005). In Clark et al.’s study, a total of eight SNPs were genotyped, denoted as 9625G/A, 7255A/G, 6274C/T, 4884A/G, 4155C/G, 2760A/G, 1873G/ A, and 563G/A in an isolated Spanish population. Significant associations were found in 563G/A (p = 0.0005 for the allele and p = 0.007 for the genotype, after Bonferroni correction) and 9625G/A (p = 0.02 for allele and p = 0.03 for genotype, after Bonferroni correction). Significant differences in 54 haplotypes based on eight SNPs combinations were also found between patients and control subjects (p = 0.008, after Bonferroni correction). Clark et al.’s study was performed in a relatively genetically isolated population of Basque origin, and the low heterogeneity in the group was well suited for the identification of genetic factors related to complex disorders. And we were very interested in the two SNPs reported to be associated with schizophrenia/schizoaffective disorder. In order to further investigate the role of ADRA1A in susceptibility to schizophrenia and to enhance the detection power of association, we carried out a case-control study in the Chinese population trying to replicate Clark et al.’s results. Five variants, denoted as 9625G/A and 563G/A (two sites reported to be positive), 4155G/C, 2760C/A and S, a new substitution which was found by us between 508 and 530 of the promoter region of ADRA1A were investigated in our current study (Fig. 1).
385
2. Method and materials 2.1. Subject We studied 480 unrelated schizophrenia patients (250 males and 230 females with a mean age of 50.52 years, SD = 12.96), and 480 control subjects (221 males and 259 females with a mean age of 34.00 years, SD = 9.00) for 9625G/A, 4155G/C, 2760C/A, S and 563G/A. The average onset age of disease was 26.81, SD = 8.23. All patients were recruited from the Shanghai Mental Health Center. All subjects were assessed using the DSMIV (American Psychiatric Association). A standard informed consent was obtained from all subjects, who were Han Chinese in Shanghai origin. Guidelines for ethical treatment were given by the Shanghai Jiao Tong University. 2.2. Genotyping A sample pool which consisting of 24 healthy subjects was used for screening the frequency of the five polymorphisms. Genomic DNA was prepared from venous blood using standard phenol–chloroform extraction for the genotyping of the five promoter polymorphisms, 4155G/C, 2760C/A, 563G/A and a novel substitution S. The 9625G/A was excluded because it was monomorphic in our sample. PCR amplifications producing a 562bp (for 563G/A and the novel substitution), a 331bp (for 2760C/A) and a 594bp (for 4155G/C) genomic segments, were first performed on the GeneAmp PCR 9700 System (Applied Biosystems) in a 15 ll reaction containing 10 ng genomic DNA, 1.2 U Taq polymerase, 0.2 ll of each primer (10 PM), 1.5 ll PCR buffer (10·, Qiagen), and 1.5 ll dNTPs (each 2 mM). Amplification conditions consisted of an initial 3 min at 95 C, 35 cycles of 30 s at 94 C, 30 s at 57 C for the 562bp and 594bp segments (touchdown at 62 C to 57 C for the 331bp segment), and 1 min at 72 C, followed by a final extension of 7 min at 72 C. We then genotyped the four variants using DNA sequencing on an ABI 3100 genetic analyzer with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). The primers and the sequence number definition of ADRA1A were constructed on the basis of NM_000680. Primer sequences are listed in Table 1. 2.3. Statistical analysis All the parameters, allele and genotype frequencies, Hardy–Weinberg equilibrium, pair-wised linkage
Fig. 1. Five selected variants in the five regions of the ADRA1A gene.
386
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
Table 1 Primers used in PCR for each of the five polymorphisms Primer
Sequence (5 0 –3 0 )
PCR product (bp)
Upper Lower
TGGGGTTTTGGGGATTTGT CTGGGGGAAGATTCAGCAT
562
2760C/A
Upper Lower
AAACTGGAAAAGATTGTGTGG TGTGTTCATAGGAATGTGCT
331
4155G/C
Upper Lower
GCATACAAAATGAGCAGAAAGG ACTCCCAGTCCCCACTCTACAA
594
Polymorphisms 563C/T& S
a
a
The new substitution discovered in our research.
disequilibrium and haplotype analysis were conducted online by http://analysis.bio-x.cn (Shi and He, 2005), a robust and user-friendly software platform has a series of highly efficient analytical tools for association studies. Power calculations were performed using the G*Power program (Erdfelder et al., 1996). Significance level was set at a = 0.05.
(Table 2). The total number of samples used differed between the variants because not all of them could be satisfactorily amplified with PCR. The SNP 9625G/A was not included in our assay as it was monomorphic in our samples. As strong pairwise linkage disequilibrium was found between all these SNPs tested (Table 3), we also performed haplotype analysis for the four variants. Again, no significant haplotype differences was observed (Table 4).
3. Results A total of 480 cases and 480 controls were studied in our experiment. The power of 563G/A, S, 2760C/A and 4155G/C were of 0.989, 0.670, 0.987 and 0.980, respectively, with an OR = 1.5 (95% CI) in our sample. Not all of the investigated polymorphisms were observed in HWE (supplement 1). The distribution of the 563G/A was not in HWE within patients. Genotyping error as a cause of this disequilibrium was discounted, for we performed the genotype work through direct DNA sequencing (supplement 2–5). Extraordinarily, we detected a novel substitution, which occurs between 508bp and 530bp upstream of the translation initiation site nearby the 563G/A, where a 23-bp fragment ACCTGTAGCGCTGCGCTACCCAA is replaced by a 4-bp fragment GATG. No significant difference was observed in individual SNP marker alleles or genotype distributions between patients and controls
Table 3 Linkage disequilibrium between SNPs in our samples, showing D 0 (above the diagonal) and r2 (below the diagonal)
563G/A S 2760C/A 4155G/C
563C/T
S
2760C/A
4155G/C
– 0.09 0.43 0.53
0.98 – 0.03 0.04
0.81 0.62 – 0.72
0.87 0.73 0.86 –
Table 4 The estimated haplotype frequencies in cases and controls Haplotype
Cases
Controls
Corrected v2 pvalue
Corrected global pvalue
G-1- C-G A-1-A-C A-1-C-G A-2-C-G
0.46 0.39 0.01 0.07
0.42 0.35 0.04 0.08
0.90 1.00 0.09 1.00
0.36 (d.f. = 3, X2 = 10.07)
Table 2 Distributions of genotypes and alleles for the four variants in the controls and cases SNP site
563C/T
Samples
Case Control
N
428 464
Allele
p
G
A
400 (47%) 452 (49%)
456 (53%) 476 (51%)
1a
2b
S
Case Control
420 460
771 (92%) 829 (90%) C
A
2760C/A
Case Control
438 452
519 (59%) 527 (58%)
357 (41%) 377 (42%)
G
C
437 (57%) 498 (58%)
333 (43%) 358 (42%)
4155G/C a b
Case Control
385 428
69 (8%) 91 (10%)
Odds ratio (95% CI)
Genotype
p
G/G
G/A
A/A
0.42
0.92(0.77–1.11)
104 (24%) 105 (23%)
192 (45%) 242 (52%)
132 (31%) 117 (25%)
1/1
1/2
2/2
0.24
1.22(0.88–1.70)
356 (85%) 377 (82%) C/C
C/A
0.69
0.96(0.80–1.16)
152 (35%) 156 (34%)
215(49%) 215 (48%)
G/G
G/C
129 (33%) 148 (34%)
179 (47%) 202 (47%)
0.56
1.06(0.87–1.29)
The number 1 represent short fragment, GATG. The number 2 represent long fragment, ACCTGTAGCGCTGCGCTACCCAA.
59 (14%) 75 (16%)
5 (1%) 8 (2%)
0.08
0.49
A/A 71 (16%) 81 (18%)
0.79
C/C 77 (20%) 78 (18%)
0.81
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
4. Discussion Although Clark et al.’s work provided evidences for association between ADRA1Aand schizophrenia, no significant differences of allele and genotype frequencies were observed in our Chinese population. The two positive SNPs reported previously, 563G/A and 9625G/A, also showed no significant differences between our patients and controls. The statistical power of our study was also enough to detect an association between the variants and schizophrenia. Moreover, Clark et al. utilized exonuclease assays to genotype the SNPs, we used direct sequencing to genotype, which is more reliable in distinguishing the variants. In this study, we genotyped four polymorphisms, and all the genotyping were in Hardy–Weinberg equilibrium except 563G/A. Although deviation within the case group, as in the cases of 563G/A, was not considered an issue because it might reflect an similar matter in the promoter region in comparison with the Clark et al.’s work, in which the 6724C/T and 7255G/A also deviated from HWE. This may be an interesting phenomenon occurred in the promoter region of ADRA1A, to which should be paid more attention. With regard to pairwise LD, we found that all the four variants were in strong LD and thereby a four-variant haplotype analysis was carried out. Only 3–4 out of 16 possible haplotypes exhibited at least 3% frequency in either cases or controls, covering over 95% of all the chromosomes (Table 4). The relatively low haplotype diversity indicates that the four polymorphisms lie in one haplotype block (Van den Oord and Neale, 2004; Wall and Pritchard, 2003). Poor replication is a common problem in association studies of human complex disease such as schizophrenia. Our failure to replicate the association may be attributed to genetic heterogeneity since the two studies were carried out in two distinct ethnic populations. The polymorphism 9625G/A reported in the Spanish population had no heterozygosity in our sample. We found a new substitution S between 508bp and 530bp upstream of the translation initiation site in most of our samples, where a 23-bp fragment ACCTGTAGCGCTGCGCTACCCAA was replaced by a 4-bp fragment GATG. This is a kind of substitution which was firstly reported in ADRA1Agene. In addition, two deletions, -ACCT and -GCGC, which had previously been reported by Cold Spring Harbor Laboratory around this region, were not detected in our study. All these suggested that different genetic backgrounds between independent populations might be the reason for the different results. The larger and more statistically power the sample, the more reliable an association study will be (Baron, 2001). The sample size in our study was 480 cases vs 480 controls, and the Clark et al.’s was 117 cases vs 176 controls, Our sample size is clearly much more robust, but we still observed no significance in either of the two significant polymorphisms, 9625G/A and 563G/A.
387
A latter study involved three members in the a1-adrenergic receptor family, where the function of the a1A-subtype still remained indistinct because of the dominance of the a1B-subtype (Tanoue et al., 2002). A study of the transcriptional regulation of the human ADRA1A gene has indicated that a region extending 125 base pairs upstream from the main transcription initiation site contains significant ADRA1A promoter activity (Razik et al., 1997). In addition, we also scanned the sequence around this region, but no SNP was detected. Furthermore, a recently published work also failed to find evidence to support ADRA1A as a risk gene of schizophrenia (Fallin et al., 2005). In summary, we failed to confirm the two SNP reported to be associated with schizophrenia in our Chinese population. Though our result did not support the promoter region of ADRA1A as a risk factor for schizophrenia, it may provide a reference for further studies of ADRA1A in other population. Its possible role in the etiology of schizophrenia will require repetition studies with additional samples and combined meta-analysis across different studies. Role of the funding sources The funding sources had no role in study design, data collection, data analysis, data interpretation, or writing of the report. The writing committee had full access to all the data in the study and had final responsibility for the decision to submit for publication. Conflict of interest statement We declare that we have no conflict of interest. Contributors Ke Huang, Wei Tang did the literature search, study selection, and data collection. Yongyong Shi did the statistical analyses. Ke Huang wrote the first draft of the original manuscript. All authors participated in the study design and contributed to the revision of the manuscript. Acknowledgements We are deeply grateful to all the participants as well as to the psychiatrists and mental health workers working on this project. This work was supported by the National 973 programs and the Key grant project of the Chinese Ministry of Education (No. 10414), PR China. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jpsychires.2007.02.008.
388
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
References Badner JA, Gershon ES. Regional meta-analysis of published data supports linkage of autism with markers on chromosome 7. Molecular Psychiatry 2002;7:56–66. Baron M. Genetics of schizophrenia and the new millennium: progress and pitfalls. American Journal of Human Genetics 2001;68:299–312. Blouin JL, Dombroski BA, Nath SK, Lasseter VK, Wolyniec PS, Nestadt G, et al. Schizophrenia susceptibility loci on chromosomes 13q32 and 8p21. Nature Genetics 1998;20:70–3. Cardno AG, Gottesman II. Twin studies of schizophrenia: from bow-andarrow concordances to star wars Mx and functional genomics. American Journal of Human Genetics 2000;97:12–7. Clark DA, Arranz MJ, Mata I, Lopez-Ilundain J, Perez-Nievas F, Kerwin RW. Polymorphisms in the promoter region of the alpha1Aadrenoceptor gene are associated with schizophrenia/schizoaffective disorder in a Spanish isolate population. Biological Psychiatry 2005;58:435–9. Erdfelder E, Faul F, Buchner A. GPOWER: a general power analysis program. Behavior Research Methods, Instruments, & Computers 1996;28:1–11. Fallin MD, Lasseter VK, Avramopoulos D, Nicodemus KK, Wolyniec PS, McGrath JA, et al. American Journal of Human Genetics 2005;77:918–36. Friedman JI, Adler DN, Davis KL. The role of norepinephrine in the pathophysiology of cognitive disorders: potential applications to the treatment of cognitive dysfunction in schizophrenia and Alzheimer’s disease. Biological Psychiatry 1999;46:1243–52. Gerber DJ, Hall D, Miyakawa T, Demars S, Gogos JA, Karayiorgou M, et al. Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit. Proceedings of National Academy of Sciences, USA 2003;100:8993–8. Katsu T, Ujike H, Nakano T, Tanaka Y, Nomura A, Nakata K, et al. The human frizzled-3 (FZD3) gene on chromosome 8p21, a receptor gene for Wnt ligands, is associated with the susceptibility to schizophrenia. Neuroscience Letters 2003;353:53–6. Kendler KS, MacLean CJ, O’Neill FA, Burke J, Murphy B, Duke F, et al. Evidence for a schizophrenia vulnerability locus on chromosome 8p in the Irish Study of High-Density Schizophrenia Families. American Journal of Psychiatry 1996;153:1534–40.
Knauber J, Muller WE. Subchronic treatment with prazosin improves passive avoidance learning in aged mice: possible relationships to alpha1-receptor up-regulation. Journal of Neural Transmission 2000;107:1413–26. Koshimizu TA, Tanoue A, Hirasawa A, Yamauchi J, Tsujimoto G. Recent advances in alpha1-adrenoceptor pharmacology. Pharmacology & Therapeutics 2003;98:235–44. Lewis CM, Levinson DF, Wise LH, DeLisi LE, Straub RE, Hovatta I, et al. Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: Schizophrenia. American Journal of Human Genetics 2003;73:34–48. Lidow MS. Calcium signaling dysfunction in schizophrenia: a unifying approach. Brain Research: Brain Research Reviews 2003;43:70–84. McGuffin P, Owen MJ, Farmer AE. Genetic basis of schizophrenia. Lancet 1995;346:678–82. Nakata K, Ujike H. The human dihydropyrimidinase-related protein 2 (DRP-2) gene on chromosome 8p21 is associated with paranoid-type schizophrenia. Nihon Shinkei Seishin Yakurigaku Zasshi 2004;24:33–7. Norton N, Williams HJ, Owen MJ. Current Opinion in Psychiatry 2006;19:158–64. Ordway GA, Klimek V. Noradrenergic pathology in psychiatric disorders: postmortem studies. CNS Spectrums 2001;6:697–703. Razik MA, Lee K, Price RR, Williams MR, Ongjoco RR, Dole MK, et al. Transcriptional regulation of the human alpha1a-adrenergic receptor gene. Characterization of the 5 0 -regulatory and promoter region. Journal Of Biological Chemistry 1997;272:28237–46. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Research 2005;15:97–8. Sirvio J, Lahtinen H, Riekkinen Jr P, Riekkinen PJ. Spatial learning and noradrenaline content in the brain and periphery of young and aged rats. Experimental Neurology 1994;125:312–5. Summers RJ, McMartin LR. Adrenoceptors and their second messenger systems. Journal of Neurochemistry 1993;60:10–23. Tanoue A, Koshimizu TA, Tsujimoto G. Transgenic studies of alpha(1)adrenergic receptor subtype function. Life Sciences 2002;71:2207–15. Van den Oord EJ, Neale BM. Will haplotype maps be useful for finding genes? Molecular Psychiatry 2004;9:227–36. Wall JD, Pritchard JK. Haplotype blocks and linkage disequilibrium in the human genome. Nature Reviews: Genetics 2003;4:587–97. Zhao X, Shi Y, Tang J, Tang R, Yu L, Gu N, et al. Journal of Medical Genetics 2004;41:31–4.
JOURNAL OF PSYCHIATRIC RESEARCH
Journal of Psychiatric Research 42 (2008) 384–388
www.elsevier.com/locate/jpsychires
No association found between the promoter variants of ADRA1A and schizophrenia in the Chinese population Ke Huang a,b,1, Yongyong Shi a,b,*,1, Wei Tang a,b,1, Ruqi Tang a,b, Shengzhen Guo Yifeng Xu c, Junwei Meng a,b, Xingwang Li a,b, Guoying Feng c, Lin He b,a,* b
b,d
,
a Bio-X Life Science Research Center, Shanghai Jiao Tong University, 1954 Huashan Road, Shanghai 200030, PR China Institute for Nutritional Sciences, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, PR China c Shanghai Institute of Mental Health, Shanghai 200030, PR China d NHGG, Bio-X Center, Shanghai Jiao Tong University, 1954 Huashan Road, Shanghai 200030, PR China
Received 12 September 2006; received in revised form 10 January 2007; accepted 1 February 2007
Abstract Schizophrenia is a chronic psychiatry disorder with a strong genetic component. A recent association study of a1A-adrenoceptor gene (ADRA1A) involving an isolated Spanish population, focusing on the promoter region of the ADRA1A, genotyped eight single SNPs at the promoter region of ADRA1A and found that two SNPs, 563G/A and 9625G/A, were associated with schizophrenia and schizoaffective disorders. We were interested in the two positive sites reported and selected five variants among the promoter region of ADRA1A, namely 563G/A, 9625G/A, 2760C/A, 4155G/C and a new substitution we detected between 508bp and 530bp upstream of the translation initiation site. Our sample consisted of 480 schizophrenia and 480 control subjects. All recruits were Han Chinese in Shanghai origin. However, neither individual SNP nor any haplotype was associated with schizophrenia in our study. These results suggest that the variants among the promoter of ADRA1A gene are unlikely to play a major role in the susceptibility to schizophrenia in the Chinese population. 2007 Elsevier Ltd. All rights reserved. Keywords: a1A-Adrenergic receptor; ADRA1A; Schizophrenia; Association; Promotor
1. Introduction Schizophrenia is a common, chronic and complex mental disorder with a significant genetic component in its etiology (Cardno and Gottesman, 2000; McGuffin et al., 1995). A large number of linkage studies have implicated several susceptibility loci for schizophrenia, including chro*
Corresponding authors. Address: Bio-X Life Science Research Center, Shanghai Jiao Tong University, P.O. Box 501, Haoran Building, 1954 Huashan Road, Shanghai 200030, PR China (Y. Shi). Institute for Nutritional Sciences, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences, 294 Taiyuan Road, Shanghai 200031, PR China (L. He). Tel./fax: +86 21 62822491. E-mail addresses: [email protected] (Y. Shi), [email protected] (L. He). 1 These authors contributed equally to this work. 0022-3956/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.jpsychires.2007.02.008
mosomes such as 1q, 2p, 6p, 8p, 22q, 13q and other locations in the genome (Badner and Gershon, 2002; Lewis et al., 2003). A series of studies have reported association between candidate genes on these loci and schizophrenia (Blouin et al., 1998; Kendler et al., 1996; Norton et al., 2006), including ADRA1A (Clark et al., 2005) on chromosome 8p21 where several genes, including DRP-2 (Nakata and Ujike, 2004), PPP3CC (Gerber et al., 2003), NRG1 (Zhao et al., 2004) and FZD-3 (Katsu et al., 2003) have been reported to be associated with schizophrenia on this locus. There are three subtypes, a1A, a1B and a1D in the family of the a1-adrenergic receptor. The function of each individual subtype has yet to be clarified, because of lacking relevant agonist, antagonist or antibodies which could interact specifically with the members of the family
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
(Koshimizu et al., 2003; Tanoue et al., 2002). It has been reported that the noradrenergic receptors exhibit a dependent status in response to the change of synaptic noradrenaline in the brain of laboratory animals (Ordway and Klimek, 2001). Furthermore, a1-adrenergic receptor is a kind of G-protein-coupled receptor. There is consensus that the G-protein involved in signaling is the Gq/G11 form. Activation of this G-protein could elevate the level of intracellular calcium (Summers and McMartin, 1993), which is considered to be a crucial factor involved in schizophrenia (Lidow, 2003). Although there is no credible evidence indicating that any particular subtype of a1-adrenergic receptors might be related to any particular physiological function (Koshimizu et al., 2003), it has been suggested that the a1-adrenergic subtypes have effects on the cognitive functions of prefrontal cortical (PFC) relevant to schizophrenia in animals (Friedman et al., 1999; Knauber and Muller, 2000; Sirvio et al., 1994). A very recent association study found that the polymorphisms in the promoter region of the ADRA1A are associated with schizophrenia/schizoaffective disorder (Clark et al., 2005). In Clark et al.’s study, a total of eight SNPs were genotyped, denoted as 9625G/A, 7255A/G, 6274C/T, 4884A/G, 4155C/G, 2760A/G, 1873G/ A, and 563G/A in an isolated Spanish population. Significant associations were found in 563G/A (p = 0.0005 for the allele and p = 0.007 for the genotype, after Bonferroni correction) and 9625G/A (p = 0.02 for allele and p = 0.03 for genotype, after Bonferroni correction). Significant differences in 54 haplotypes based on eight SNPs combinations were also found between patients and control subjects (p = 0.008, after Bonferroni correction). Clark et al.’s study was performed in a relatively genetically isolated population of Basque origin, and the low heterogeneity in the group was well suited for the identification of genetic factors related to complex disorders. And we were very interested in the two SNPs reported to be associated with schizophrenia/schizoaffective disorder. In order to further investigate the role of ADRA1A in susceptibility to schizophrenia and to enhance the detection power of association, we carried out a case-control study in the Chinese population trying to replicate Clark et al.’s results. Five variants, denoted as 9625G/A and 563G/A (two sites reported to be positive), 4155G/C, 2760C/A and S, a new substitution which was found by us between 508 and 530 of the promoter region of ADRA1A were investigated in our current study (Fig. 1).
385
2. Method and materials 2.1. Subject We studied 480 unrelated schizophrenia patients (250 males and 230 females with a mean age of 50.52 years, SD = 12.96), and 480 control subjects (221 males and 259 females with a mean age of 34.00 years, SD = 9.00) for 9625G/A, 4155G/C, 2760C/A, S and 563G/A. The average onset age of disease was 26.81, SD = 8.23. All patients were recruited from the Shanghai Mental Health Center. All subjects were assessed using the DSMIV (American Psychiatric Association). A standard informed consent was obtained from all subjects, who were Han Chinese in Shanghai origin. Guidelines for ethical treatment were given by the Shanghai Jiao Tong University. 2.2. Genotyping A sample pool which consisting of 24 healthy subjects was used for screening the frequency of the five polymorphisms. Genomic DNA was prepared from venous blood using standard phenol–chloroform extraction for the genotyping of the five promoter polymorphisms, 4155G/C, 2760C/A, 563G/A and a novel substitution S. The 9625G/A was excluded because it was monomorphic in our sample. PCR amplifications producing a 562bp (for 563G/A and the novel substitution), a 331bp (for 2760C/A) and a 594bp (for 4155G/C) genomic segments, were first performed on the GeneAmp PCR 9700 System (Applied Biosystems) in a 15 ll reaction containing 10 ng genomic DNA, 1.2 U Taq polymerase, 0.2 ll of each primer (10 PM), 1.5 ll PCR buffer (10·, Qiagen), and 1.5 ll dNTPs (each 2 mM). Amplification conditions consisted of an initial 3 min at 95 C, 35 cycles of 30 s at 94 C, 30 s at 57 C for the 562bp and 594bp segments (touchdown at 62 C to 57 C for the 331bp segment), and 1 min at 72 C, followed by a final extension of 7 min at 72 C. We then genotyped the four variants using DNA sequencing on an ABI 3100 genetic analyzer with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). The primers and the sequence number definition of ADRA1A were constructed on the basis of NM_000680. Primer sequences are listed in Table 1. 2.3. Statistical analysis All the parameters, allele and genotype frequencies, Hardy–Weinberg equilibrium, pair-wised linkage
Fig. 1. Five selected variants in the five regions of the ADRA1A gene.
386
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
Table 1 Primers used in PCR for each of the five polymorphisms Primer
Sequence (5 0 –3 0 )
PCR product (bp)
Upper Lower
TGGGGTTTTGGGGATTTGT CTGGGGGAAGATTCAGCAT
562
2760C/A
Upper Lower
AAACTGGAAAAGATTGTGTGG TGTGTTCATAGGAATGTGCT
331
4155G/C
Upper Lower
GCATACAAAATGAGCAGAAAGG ACTCCCAGTCCCCACTCTACAA
594
Polymorphisms 563C/T& S
a
a
The new substitution discovered in our research.
disequilibrium and haplotype analysis were conducted online by http://analysis.bio-x.cn (Shi and He, 2005), a robust and user-friendly software platform has a series of highly efficient analytical tools for association studies. Power calculations were performed using the G*Power program (Erdfelder et al., 1996). Significance level was set at a = 0.05.
(Table 2). The total number of samples used differed between the variants because not all of them could be satisfactorily amplified with PCR. The SNP 9625G/A was not included in our assay as it was monomorphic in our samples. As strong pairwise linkage disequilibrium was found between all these SNPs tested (Table 3), we also performed haplotype analysis for the four variants. Again, no significant haplotype differences was observed (Table 4).
3. Results A total of 480 cases and 480 controls were studied in our experiment. The power of 563G/A, S, 2760C/A and 4155G/C were of 0.989, 0.670, 0.987 and 0.980, respectively, with an OR = 1.5 (95% CI) in our sample. Not all of the investigated polymorphisms were observed in HWE (supplement 1). The distribution of the 563G/A was not in HWE within patients. Genotyping error as a cause of this disequilibrium was discounted, for we performed the genotype work through direct DNA sequencing (supplement 2–5). Extraordinarily, we detected a novel substitution, which occurs between 508bp and 530bp upstream of the translation initiation site nearby the 563G/A, where a 23-bp fragment ACCTGTAGCGCTGCGCTACCCAA is replaced by a 4-bp fragment GATG. No significant difference was observed in individual SNP marker alleles or genotype distributions between patients and controls
Table 3 Linkage disequilibrium between SNPs in our samples, showing D 0 (above the diagonal) and r2 (below the diagonal)
563G/A S 2760C/A 4155G/C
563C/T
S
2760C/A
4155G/C
– 0.09 0.43 0.53
0.98 – 0.03 0.04
0.81 0.62 – 0.72
0.87 0.73 0.86 –
Table 4 The estimated haplotype frequencies in cases and controls Haplotype
Cases
Controls
Corrected v2 pvalue
Corrected global pvalue
G-1- C-G A-1-A-C A-1-C-G A-2-C-G
0.46 0.39 0.01 0.07
0.42 0.35 0.04 0.08
0.90 1.00 0.09 1.00
0.36 (d.f. = 3, X2 = 10.07)
Table 2 Distributions of genotypes and alleles for the four variants in the controls and cases SNP site
563C/T
Samples
Case Control
N
428 464
Allele
p
G
A
400 (47%) 452 (49%)
456 (53%) 476 (51%)
1a
2b
S
Case Control
420 460
771 (92%) 829 (90%) C
A
2760C/A
Case Control
438 452
519 (59%) 527 (58%)
357 (41%) 377 (42%)
G
C
437 (57%) 498 (58%)
333 (43%) 358 (42%)
4155G/C a b
Case Control
385 428
69 (8%) 91 (10%)
Odds ratio (95% CI)
Genotype
p
G/G
G/A
A/A
0.42
0.92(0.77–1.11)
104 (24%) 105 (23%)
192 (45%) 242 (52%)
132 (31%) 117 (25%)
1/1
1/2
2/2
0.24
1.22(0.88–1.70)
356 (85%) 377 (82%) C/C
C/A
0.69
0.96(0.80–1.16)
152 (35%) 156 (34%)
215(49%) 215 (48%)
G/G
G/C
129 (33%) 148 (34%)
179 (47%) 202 (47%)
0.56
1.06(0.87–1.29)
The number 1 represent short fragment, GATG. The number 2 represent long fragment, ACCTGTAGCGCTGCGCTACCCAA.
59 (14%) 75 (16%)
5 (1%) 8 (2%)
0.08
0.49
A/A 71 (16%) 81 (18%)
0.79
C/C 77 (20%) 78 (18%)
0.81
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
4. Discussion Although Clark et al.’s work provided evidences for association between ADRA1Aand schizophrenia, no significant differences of allele and genotype frequencies were observed in our Chinese population. The two positive SNPs reported previously, 563G/A and 9625G/A, also showed no significant differences between our patients and controls. The statistical power of our study was also enough to detect an association between the variants and schizophrenia. Moreover, Clark et al. utilized exonuclease assays to genotype the SNPs, we used direct sequencing to genotype, which is more reliable in distinguishing the variants. In this study, we genotyped four polymorphisms, and all the genotyping were in Hardy–Weinberg equilibrium except 563G/A. Although deviation within the case group, as in the cases of 563G/A, was not considered an issue because it might reflect an similar matter in the promoter region in comparison with the Clark et al.’s work, in which the 6724C/T and 7255G/A also deviated from HWE. This may be an interesting phenomenon occurred in the promoter region of ADRA1A, to which should be paid more attention. With regard to pairwise LD, we found that all the four variants were in strong LD and thereby a four-variant haplotype analysis was carried out. Only 3–4 out of 16 possible haplotypes exhibited at least 3% frequency in either cases or controls, covering over 95% of all the chromosomes (Table 4). The relatively low haplotype diversity indicates that the four polymorphisms lie in one haplotype block (Van den Oord and Neale, 2004; Wall and Pritchard, 2003). Poor replication is a common problem in association studies of human complex disease such as schizophrenia. Our failure to replicate the association may be attributed to genetic heterogeneity since the two studies were carried out in two distinct ethnic populations. The polymorphism 9625G/A reported in the Spanish population had no heterozygosity in our sample. We found a new substitution S between 508bp and 530bp upstream of the translation initiation site in most of our samples, where a 23-bp fragment ACCTGTAGCGCTGCGCTACCCAA was replaced by a 4-bp fragment GATG. This is a kind of substitution which was firstly reported in ADRA1Agene. In addition, two deletions, -ACCT and -GCGC, which had previously been reported by Cold Spring Harbor Laboratory around this region, were not detected in our study. All these suggested that different genetic backgrounds between independent populations might be the reason for the different results. The larger and more statistically power the sample, the more reliable an association study will be (Baron, 2001). The sample size in our study was 480 cases vs 480 controls, and the Clark et al.’s was 117 cases vs 176 controls, Our sample size is clearly much more robust, but we still observed no significance in either of the two significant polymorphisms, 9625G/A and 563G/A.
387
A latter study involved three members in the a1-adrenergic receptor family, where the function of the a1A-subtype still remained indistinct because of the dominance of the a1B-subtype (Tanoue et al., 2002). A study of the transcriptional regulation of the human ADRA1A gene has indicated that a region extending 125 base pairs upstream from the main transcription initiation site contains significant ADRA1A promoter activity (Razik et al., 1997). In addition, we also scanned the sequence around this region, but no SNP was detected. Furthermore, a recently published work also failed to find evidence to support ADRA1A as a risk gene of schizophrenia (Fallin et al., 2005). In summary, we failed to confirm the two SNP reported to be associated with schizophrenia in our Chinese population. Though our result did not support the promoter region of ADRA1A as a risk factor for schizophrenia, it may provide a reference for further studies of ADRA1A in other population. Its possible role in the etiology of schizophrenia will require repetition studies with additional samples and combined meta-analysis across different studies. Role of the funding sources The funding sources had no role in study design, data collection, data analysis, data interpretation, or writing of the report. The writing committee had full access to all the data in the study and had final responsibility for the decision to submit for publication. Conflict of interest statement We declare that we have no conflict of interest. Contributors Ke Huang, Wei Tang did the literature search, study selection, and data collection. Yongyong Shi did the statistical analyses. Ke Huang wrote the first draft of the original manuscript. All authors participated in the study design and contributed to the revision of the manuscript. Acknowledgements We are deeply grateful to all the participants as well as to the psychiatrists and mental health workers working on this project. This work was supported by the National 973 programs and the Key grant project of the Chinese Ministry of Education (No. 10414), PR China. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jpsychires.2007.02.008.
388
K. Huang et al. / Journal of Psychiatric Research 42 (2008) 384–388
References Badner JA, Gershon ES. Regional meta-analysis of published data supports linkage of autism with markers on chromosome 7. Molecular Psychiatry 2002;7:56–66. Baron M. Genetics of schizophrenia and the new millennium: progress and pitfalls. American Journal of Human Genetics 2001;68:299–312. Blouin JL, Dombroski BA, Nath SK, Lasseter VK, Wolyniec PS, Nestadt G, et al. Schizophrenia susceptibility loci on chromosomes 13q32 and 8p21. Nature Genetics 1998;20:70–3. Cardno AG, Gottesman II. Twin studies of schizophrenia: from bow-andarrow concordances to star wars Mx and functional genomics. American Journal of Human Genetics 2000;97:12–7. Clark DA, Arranz MJ, Mata I, Lopez-Ilundain J, Perez-Nievas F, Kerwin RW. Polymorphisms in the promoter region of the alpha1Aadrenoceptor gene are associated with schizophrenia/schizoaffective disorder in a Spanish isolate population. Biological Psychiatry 2005;58:435–9. Erdfelder E, Faul F, Buchner A. GPOWER: a general power analysis program. Behavior Research Methods, Instruments, & Computers 1996;28:1–11. Fallin MD, Lasseter VK, Avramopoulos D, Nicodemus KK, Wolyniec PS, McGrath JA, et al. American Journal of Human Genetics 2005;77:918–36. Friedman JI, Adler DN, Davis KL. The role of norepinephrine in the pathophysiology of cognitive disorders: potential applications to the treatment of cognitive dysfunction in schizophrenia and Alzheimer’s disease. Biological Psychiatry 1999;46:1243–52. Gerber DJ, Hall D, Miyakawa T, Demars S, Gogos JA, Karayiorgou M, et al. Evidence for association of schizophrenia with genetic variation in the 8p21.3 gene, PPP3CC, encoding the calcineurin gamma subunit. Proceedings of National Academy of Sciences, USA 2003;100:8993–8. Katsu T, Ujike H, Nakano T, Tanaka Y, Nomura A, Nakata K, et al. The human frizzled-3 (FZD3) gene on chromosome 8p21, a receptor gene for Wnt ligands, is associated with the susceptibility to schizophrenia. Neuroscience Letters 2003;353:53–6. Kendler KS, MacLean CJ, O’Neill FA, Burke J, Murphy B, Duke F, et al. Evidence for a schizophrenia vulnerability locus on chromosome 8p in the Irish Study of High-Density Schizophrenia Families. American Journal of Psychiatry 1996;153:1534–40.
Knauber J, Muller WE. Subchronic treatment with prazosin improves passive avoidance learning in aged mice: possible relationships to alpha1-receptor up-regulation. Journal of Neural Transmission 2000;107:1413–26. Koshimizu TA, Tanoue A, Hirasawa A, Yamauchi J, Tsujimoto G. Recent advances in alpha1-adrenoceptor pharmacology. Pharmacology & Therapeutics 2003;98:235–44. Lewis CM, Levinson DF, Wise LH, DeLisi LE, Straub RE, Hovatta I, et al. Genome scan meta-analysis of schizophrenia and bipolar disorder, part II: Schizophrenia. American Journal of Human Genetics 2003;73:34–48. Lidow MS. Calcium signaling dysfunction in schizophrenia: a unifying approach. Brain Research: Brain Research Reviews 2003;43:70–84. McGuffin P, Owen MJ, Farmer AE. Genetic basis of schizophrenia. Lancet 1995;346:678–82. Nakata K, Ujike H. The human dihydropyrimidinase-related protein 2 (DRP-2) gene on chromosome 8p21 is associated with paranoid-type schizophrenia. Nihon Shinkei Seishin Yakurigaku Zasshi 2004;24:33–7. Norton N, Williams HJ, Owen MJ. Current Opinion in Psychiatry 2006;19:158–64. Ordway GA, Klimek V. Noradrenergic pathology in psychiatric disorders: postmortem studies. CNS Spectrums 2001;6:697–703. Razik MA, Lee K, Price RR, Williams MR, Ongjoco RR, Dole MK, et al. Transcriptional regulation of the human alpha1a-adrenergic receptor gene. Characterization of the 5 0 -regulatory and promoter region. Journal Of Biological Chemistry 1997;272:28237–46. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Research 2005;15:97–8. Sirvio J, Lahtinen H, Riekkinen Jr P, Riekkinen PJ. Spatial learning and noradrenaline content in the brain and periphery of young and aged rats. Experimental Neurology 1994;125:312–5. Summers RJ, McMartin LR. Adrenoceptors and their second messenger systems. Journal of Neurochemistry 1993;60:10–23. Tanoue A, Koshimizu TA, Tsujimoto G. Transgenic studies of alpha(1)adrenergic receptor subtype function. Life Sciences 2002;71:2207–15. Van den Oord EJ, Neale BM. Will haplotype maps be useful for finding genes? Molecular Psychiatry 2004;9:227–36. Wall JD, Pritchard JK. Haplotype blocks and linkage disequilibrium in the human genome. Nature Reviews: Genetics 2003;4:587–97. Zhao X, Shi Y, Tang J, Tang R, Yu L, Gu N, et al. Journal of Medical Genetics 2004;41:31–4.