- Email: [email protected]
No association of IFI16 (interferon-inducible protein 16) variants with susceptibility to multiple sclerosis
Journal of Neuroimmunology 271 (2014) 49–52
Contents lists available at ScienceDirect
Journal of Neuroimmunology journal homepage: www.elsevier.com/locate/jneuroim
Short communication
No association of IFI16 (interferon-inducible protein 16) variants with susceptibility to multiple sclerosis Franca R. Guerini a, Mario Clerici a,b, Rachele Cagliani c, Sunny Malhotra d, Xavier Montalban d, Diego Forni c, Cristina Agliardi a, Stefania Riva c, Domenico Caputo a, Daniela Galimberti e, Rosanna Asselta f, Chiara Fenoglio e, Elio Scarpini e, Giacomo P. Comi e, Nereo Bresolin c,e, Manuel Comabella d,1, Manuela Sironi c,⁎,1 a
Don C. Gnocchi Foundation ONLUS, IRCCS, 20100 Milan, Italy Department of Physiopathology and Transplantation, University of Milan, 20090 Milano, Italy c Scientific Institute IRCCS E. Medea, 23842 Bosisio Parini, LC, Italy d Department of Neurology–Neuroimmunology, Centre d' Esclerosi Múltiple de Catalunya, Cemcat, Hospital Universitari Vall d' Hebron (HUVH), Barcelona, Spain e Dino Ferrari Centre, Department of Physiopathology and Transplantation, University of Milan, Fondazione Ca' Granda IRCCS Ospedale Maggiore Policlinico, 20122 Milan, Italy f Dipartimento di Biotecnologie Mediche e Medicina Traslazionale, Università degli Studi di Milano, Milano, Italy b
a r t i c l e
i n f o
Article history: Received 23 January 2014 Received in revised form 10 March 2014 Accepted 8 April 2014
Keywords: IFI16 (interferon-inducible protein 16) Multiple sclerosis Genetic susceptibility EBV infection
a b s t r a c t IFI16 encodes a nucleic acid-sensor which detects latent EBV and triggers inflammasome activation. We analysed IFI16 variants in two multiple sclerosis (MS) case–control cohorts from Italy and Spain; results were combined with a previous study. A risk variant for celiac disease/rheumatoid arthritis, a polymorphic exon 7 duplication, and a copy number variant (CNV) in the 5′ region were genotyped. No significant association was detected, although heterogeneity was noted for the 5′ CNV in the Italian plus GeneMSA cohorts and the Spanish sample. Thus, IFI16 variants do not contribute to MS susceptibility, although some heterogeneity may exist for the 5′ CNV. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system with an established genetic component. Large-scale efforts including genome-wide association studies (GWAS) and meta-analyses have identified 110 non-MHC (major histocompatibility complex) susceptibility variants for MS that, together with the MHC effects, explain 28% of the sibling recurrence risk (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013). Thus, a large part of the genetic risk factors for MS remains to be identified. Common variants with small effect, which have been treated as false-negatives in GWAS, are likely to account for a portion of the still undefined MS risk loci. Indeed, recent evidence has indicated a polygenic model of disease susceptibility with multiple markers (that fail to reach even nominal significance in GWAS) contributing to disease risk with very small effects
⁎ Corresponding author at: Scientific Institute IRCCS E. Medea, 23842 Bosisio Parini, (LC), Italy. E-mail address: [email protected] (M. Sironi). 1 These authors equally contributed to this work.
http://dx.doi.org/10.1016/j.jneuroim.2014.04.006 0165-5728/© 2014 Elsevier B.V. All rights reserved.
(International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2010). Rare polymorphisms, copy number variants (CNVs), and genetic interactions might help as well to explain a portion of the missing heritability of MS. Overall, these observations suggest that approaches distinct from large-scale genotyping might complement GWAS results. The overwhelming majority of identified susceptibility alleles for MS indicated that immune and inflammatory response genes are major contributors to disease pathogenesis and suggest a substantial overlap with risk loci for other autoimmune diseases (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013). The IFI16 (interferon-inducible protein 16) gene encodes a nucleic acidsensing receptor involved in the nuclear and cytoplasmic detection of double-strand DNA (Unterholzner et al., 2010). IFI16 has been involved in the pathogenesis of several autoimmune diseases (Mondini et al., 2010) and a susceptibility variant for rheumatoid arthritis (RA) and celiac disease has been identified in intron 7 (Zhernakova et al., 2011). Interestingly, IFI16 is up-regulated in peripheral blood cells of MS patients during the disease relapses (Arthur et al., 2008). Thus, we assessed the possible contribution of IFI16 single nucleotide polymorphisms (SNPs) and CNVs to MS genetic susceptibility.
50
F.R. Guerini et al. / Journal of Neuroimmunology 271 (2014) 49–52
2. Materials and methods 2.1. HapMap samples, patients, and controls Human genomic DNA from HapMap subjects was obtained from the Coriell Institute for Medical Research. For the Italian MS case/control association study, we enrolled 849 MS patients (561 females, 288 males) and 516 age-matched healthy controls (HC; 278 females, 238 males). The Spanish cohort comprised 571 MS cases (370 females, 201 males) and 534 HC (283 females, 251 males). All patients and controls were Italian or Spanish of European origin and were recruited at the MS Centre of the Don Gnocchi Foundation in Milan and at Department of Neurological Sciences, University of Milan, and at the Centre d'Esclerosi Múltiple de Catalunya (Cemcat), in Barcelona. All patients satisfied McDonald's criteria for clinically definite MS (McDonald et al., 2001). All subjects gave informed consent according to protocols approved by the corresponding local Ethics Committees. 2.2. Genotyping The insertion/deletion polymorphism upstream the transcription start site of IFI16 was initially analysed using primer pairs that flank the predicted location of the CNV; these analyses revealed the presence of a 4.85 kb (NCBI/hg19, chr1: 158961352–158966201) insertion/ deletion polymorphism ~ 13.5 kb upstream the transcription start site of IFI16. The CNV was genotyped in the case–control cohorts by PCR amplification using a fluorescently labelled forward primer (F: GCAGAGAGAGTTGCCTGGATG) and two unlabelled reverse primers (R-ins: CAGGCTGGTCTCAAACTCCTG, R-del: GACATGGGTG TAGACAACTGTG) that specifically amplify the inserted or deleted alleles. PCR-amplified fluorescently tagged samples were run on 3500xL Genetic Analyzer (Life Technologies) using the GeneScanTM 600 LIZ® size standard (Life Technologies). The PCR amplicons were separated by size electrophoresis and the dye labelled products were identified by fluorescence detection. GeneMapper® Software Version 4.0 was applied to size and genotype the alleles. The segmental duplication of exon 7 in IFI16 was analysed using a PCR-based method. In particular, PCR amplifications were performed with JumpStart AccuTaq LA DNA Polymerase (Sigma-Aldrich) and two sets of primers: one that amplifies only the duplicated form (F: GTCC TGTGCACCTTGTGTCA; R: CTGATGTATGGTGAGAGAGC), and one that flanks the segmental duplication (F: GTCCATTTCTGTAGCCATAGG; R: TCTGAGTTGTAGGAGAGCACT). The PCR products were electrophoretically separated on agarose gels. Genotypes for rs1772408 and rs62621173 were obtained by allelic discrimination real-time PCR, using predesigned TaqMan probe assays (Applied Biosystems, Foster City, CA). Reactions were performed using TaqMan Genotyping Master Mix in an ABI 9700 analyser (Applied Biosystems). Genotyping rate was N0.98 for all variants. Analysed polymorphisms were in Hardy–Weinberg equilibrium in all cohorts, as assessed by the application of Exact Tests (Wigginton et al., 2005). 2.3. GWAS data and statistical analysis GeneMSA data (International Multiple Sclerosis Genetics Consortium et al., 2007) were retrieved through dbGAP (http://www.ncbi.nlm.nih.
gov/). Association p values for the International Multiple Sclerosis Genetics Consortium (IMSGC) ImmunoChip study (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013) were retrieved from ImmunoBase website (https://www.immunobase. org/). Genetic association was investigated by logistic regression using genotypes/haplotypes as the independent predictor variables with sex as a covariate. Results from different cohorts/studies were combined using a random-effect meta-analysis; all analyses were performed using PLINK (Purcell et al., 2007). 3. Results 3.1. Genetic diversity at IFI16 As mentioned above, a common variant in IFI16 (rs1772408, intronic) has previously been associated with autoimmune diseases (Zhernakova et al., 2011). Because CNVs are thought to contribute significantly to human phenotypic diversity (Gamazon et al., 2011) but are often not surveyed in GWASs, we analysed CNVs in IFI16. Specifically, the human IFI16 gene carries a polymorphic segmental duplication of exon 7 (the duplicated exons are identical in sequence) (Fig. 1). Also, a CNV located upstream the gene transcription start site has been repeatedly described (database of Genomic Variants, http:// dgv.tcag.ca/dgv/app/home) (Fig. 1). Thus, we applied a PCR-based approach to determine the allelic status of these CNVs in 20 HapMap subjects of European ancestry (CEU). Results showed that the minor alleles (deletion in both cases) for the 5′ CNV and the exon 7 segmental duplication had a frequency of 17.5% and 7.5%, respectively in CEU. Analysis of SNP genotype data (as derived from HapMap) indicated that the 5′ CNV is tagged by rs9887904 (r2 = 1), whereas several SNPs (the closest being rs62621173) are in full linkage disequilibrium (LD, r2 = 1) with the exon 7 duplication polymorphism; none of the variants tagging the exon 7 duplication is included in GWAS platforms (http://www.broadinstitute.org/mpg/snap). LD analyses were replicated for 50 Italian and 50 Spanish healthy controls with the same results (r2 = 1 in all instances). 3.2. Association with MS susceptibility To determine whether IFI16 variants/haplotypes modulate the risk to develop MS, we recruited two case–control cohorts, one from Italy (MS = 849, HC = 516) and one from Spain (MS = 571, HC = 534). Genotypes for the 5′ CNV, rs1772408, and rs62621173 (for the exon 7 CNV) were obtained for all subjects. Logistic regression (additive model) indicated a significant association between the 5′ CNV polymorphism and MS susceptibility in the Italian cohort; this finding was not observed in the Spanish sample (Table 1). Overall, a meta-analysis of the two samples plus data from the GeneMSA study (with rs9887904 used as a proxy for the 5′ CNV) (International Multiple Sclerosis Genetics Consortium et al., 2007) indicated that, after multiple test correction, none of the variants we analysed was significantly associated with the risk of developing MS (Table 1). Results from the IMSGC ImmunoChip study (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013) indicated a very weak association with MS susceptibility for the 5′ CNV and for rs1772408 (Table 1).
Fig. 1. Analysed variants. Representation of the IFI16 gene region within the UCSC Genome Browser view. The exon 7 segmental duplication is shown (grey bars), as well as the 5′ CNV and the SNPs we analysed.
F.R. Guerini et al. / Journal of Neuroimmunology 271 (2014) 49–52
51
Table 1 Association of IFI16 polymorphisms with MS susceptibility. SNP
Minor allele
Italian
Spanish
Allele frequency
5′ CNV rs1772408 rs62621173 a b c d e f g h
Del A T
MS
HC
0.1389 0.196 0.057
0.185 0.219 0.073
pb
OR (95% CI)c
0.003 0.182 0.177
0.71 (0.57–0.88) 0.87 (0.72–1.06) 0.80 (0.58–1.11)
Allele frequency MS
HC
0.156 0.158 0.046
0.155 0.180 0.060
GeneMSA
Combineda
IMSGC ImmunoChip
pb
OR (95% CI)c
pd
I2
p
OR
Corrected pe
pf
0.993 0.237 0.211
0.99 (0.79–1.27) 0.87 (0.69–1.09) 0.78 (0.53–1.15)
0.0002g 0.326 n.a.
52.05 0 0
0.051 0.048 0.066
0.83 0.89 0.79
0.066 0.066 0.066
0.022g 0.023h n.a.
Heterogeneity index, p value and OR for a random-effect meta-analysis. Logistic regression p value (additive model). Odds ratio (OR) and 95% confidence intervals. p value from the GeneMSA study (GWAS). False discovery rate (FDR)-corrected p value. p value from the IMSGC ImmunoChip study. p value for rs9887904 (r2 = 1 with the 5′ CNV). p value for rs1772415 (r2 = 1 with rs1772408, http://www.broadinstitute.org/mpg/snap/, data from the 1000 Genomes Pilot Project).
Haplotype analysis detected significant associations, mainly driven by the 5′ CNV polymorphism, in the Italian sample, but the results were not replicated in the Spanish cohort (Table 2). Overall, these data suggest that SNP and structural variants in IFI16 do not contribute substantially to MS susceptibility.
often been reported (Ascherio and Munger, 2007). Given the central role of the gene in the antiviral response, it may be worth exploring whether IFI16 variants modulate the susceptibility to MS in the interaction with specific viral infection or EBV strains (Ascherio and Munger, 2007).
4. Discussion References We have analysed three polymorphisms in IFI16 for association with MS. These variants were selected on the basis of previous association results (Zhernakova et al., 2011) or of their likely functional significance (in the case of CNVs). Results indicated that IFI16 cannot be regarded as a risk gene for MS, although some heterogeneity was observed for the 5′ CNV in the Italian plus GeneMSA cohorts (showing significant association) and in the Spanish sample (showing not even marginally significant frequency differences). Data from a large-scale ImmunoChip study confirmed an extremely weak association, although they do not provide information on possible heterogeneity sources (if any). At least three different reasons point to IFI16 being a very good candidate as a susceptibility gene for MS. First, a variant in the gene has been associated with RA and celiac disease, which share genetic risk alleles with MS (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013); also, IFI16 has been implicated in the pathogenesis of systemic sclerosis, systemic lupus erythematosus, and Sjögren's syndrome (Mondini et al., 2010). Second, IFI16 is upregulated during MS relapses (Arthur et al., 2008). Third, recent evidences have indicated that IFI16 senses Epstein–Barr virus (EBV) during all latency stages and determines constitutive inflammasome activation and cytokine (IL-1b, IL-33, and Il-18) production (Ansari et al., 2013). As EBV constitutes the strongest environmental risk factor for the disease (Ascherio and Munger, 2007), this represents an important link with the pathogenesis of MS. In this respect it is worth mentioning that several viral infections have been associated with the risk of developing MS, although contrasting results have
Table 2 Haplotype association. Haplotype (5′ CNV–rs1772408– rs62621173)
Italian a
Ins–G–T Del–G–C Ins–A–C Del–A–C a
Logistic regression p value and OR.
Spanish a
OR
p
ORa
pa
0.79 0.69 0.93 1.32
0.181 0.009 0.513 0.002
0.84 1.11 0.96 1.04
0.423 0.481 0.754 0.662
Ansari, M.A., Singh, V.V., Dutta, S., Veettil, M.V., Dutta, D., Chikoti, L., Lu, J., Everly, D., Chandran, B., 2013. Constitutive interferon-inducible protein 16-inflammasome activation during Epstein–Barr virus latency I, II, and III in B and epithelial cells. J. Virol. 87, 8606–8623. Arthur, A.T., Armati, P.J., Bye, C., Southern MS Genetics Consortium, Heard, R.N., Stewart, G.J., Pollard, J.D., Booth, D.R., 2008. Genes implicated in multiple sclerosis pathogenesis from consilience of genotyping and expression profiles in relapse and remission. BMC Med. Genet. 9 (17-2350-9-17). Ascherio, A., Munger, K.L., 2007. Environmental risk factors for multiple sclerosis. Part I: the role of infection. Ann. Neurol. 61, 288–299. Gamazon, E.R., Nicolae, D.L., Cox, N.J., 2011. A study of CNVs as trait-associated polymorphisms and as expression quantitative trait loci. PLoS Genet. 7, e1001292. International Multiple Sclerosis Genetics Consortium (IMSGC), Bush, W.S., Sawcer, S.J., de Jager, P.L., Oksenberg, J.R., McCauley, J.L., Pericak-Vance, M.A., Haines, J.L., 2010. Evidence for polygenic susceptibility to multiple sclerosis—the shape of things to come. Am. J. Hum. Genet. 86, 621–625. International Multiple Sclerosis Genetics Consortium (IMSGC), Beecham, A.H., Patsopoulos, N.A., Xifara, D.K., Davis, M.F., Kemppinen, A., Cotsapas, C., Shah, T.S., Spencer, C., Booth, D., Goris, A., Oturai, A., Saarela, J., Fontaine, B., Hemmer, B., Martin, C., Zipp, F., D'Alfonso, S., Martinelli-Boneschi, F., Taylor, B., Harbo, H.F., Kockum, I., Hillert, J., Olsson, T., Ban, M., Oksenberg, J.R., Hintzen, R., Barcellos, L.F., Wellcome Trust Case Control Consortium 2 (WTCCC2), International IBD Genetics Consortium (IIBDGC), Agliardi, C., Alfredsson, L., Alizadeh, M., Anderson, C., Andrews, R., Sondergaard, H.B., Baker, A., Band, G., Baranzini, S.E., Barizzone, N., Barrett, J., Bellenguez, C., Bergamaschi, L., Bernardinelli, L., Berthele, A., Biberacher, V., Binder, T.M., Blackburn, H., Bomfim, I.L., Brambilla, P., Broadley, S., Brochet, B., Brundin, L., Buck, D., Butzkueven, H., Caillier, S.J., Camu, W., Carpentier, W., Cavalla, P., Celius, E.G., Coman, I., Comi, G., Corrado, L., Cosemans, L., Cournu-Rebeix, I., Cree, B.A., Cusi, D., Damotte, V., Defer, G., Delgado, S.R., Deloukas, P., di Sapio, A., Dilthey, A.T., Donnelly, P., Dubois, B., Duddy, M., Edkins, S., Elovaara, I., Esposito, F., Evangelou, N., Fiddes, B., Field, J., Franke, A., Freeman, C., Frohlich, I.Y., Galimberti, D., Gieger, C., Gourraud, P.A., Graetz, C., Graham, A., Grummel, V., Guaschino, C., Hadjixenofontos, A., Hakonarson, H., Halfpenny, C., Hall, G., Hall, P., Hamsten, A., Harley, J., Harrower, T., Hawkins, C., Hellenthal, G., Hillier, C., Hobart, J., Hoshi, M., Hunt, S.E., Jagodic, M., Jelcic, I., Jochim, A., Kendall, B., Kermode, A., Kilpatrick, T., Koivisto, K., Konidari, I., Korn, T., Kronsbein, H., Langford, C., Larsson, M., Lathrop, M., Lebrun-Frenay, C., Lechner-Scott, J., Lee, M.H., Leone, M.A., Leppa, V., Liberatore, G., Lie, B.A., Lill, C.M., Linden, M., Link, J., Luessi, F., Lycke, J., Macciardi, F., Mannisto, S., Manrique, C.P., Martin, R., Martinelli, V., Mason, D., Mazibrada, G., McCabe, C., Mero, I.L., Mescheriakova, J., Moutsianas, L., Myhr, K.M., Nagels, G., Nicholas, R., Nilsson, P., Piehl, F., Pirinen, M., Price, S.E., Quach, H., Reunanen, M., Robberecht, W., Robertson, N.P., Rodegher, M., Rog, D., Salvetti, M., Schnetz-Boutaud, N.C., Sellebjerg, F., Selter, R.C., Schaefer, C., Shaunak, S., Shen, L., Shields, S., Siffrin, V., Slee, M., Sorensen, P.S., Sorosina, M., Sospedra, M., Spurkland, A., Strange, A., Sundqvist, E., Thijs, V., Thorpe, J., Ticca, A., Tienari, P., van Duijn, C., Visser, E.M., Vucic, S., Westerlind, H., Wiley, J.S., Wilkins, A., Wilson, J.F., Winkelmann, J., Zajicek, J., Zindler, E., Haines, J.L., Pericak-Vance, M.A., Ivinson, A.J., Stewart, G., Hafler, D., Hauser, S.L., Compston, A., McVean, G., De Jager, P., Sawcer, S.J., McCauley, J.L., 2013. Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis. Nat. Genet. 45, 1353–1360.
52
F.R. Guerini et al. / Journal of Neuroimmunology 271 (2014) 49–52
International Multiple Sclerosis Genetics Consortium, Hafler, D.A., Compston, A., Sawcer, S., Lander, E.S., Daly, M.J., De Jager, P.L., de Bakker, P.I., Gabriel, S.B., Mirel, D.B., Ivinson, A.J., Pericak-Vance, M.A., Gregory, S.G., Rioux, J.D., McCauley, J.L., Haines, J.L., Barcellos, L.F., Cree, B., Oksenberg, J.R., Hauser, S.L., 2007. Risk alleles for multiple sclerosis identified by a genomewide study. N. Engl. J. Med. 357, 851–862. McDonald, W.I., Compston, A., Edan, G., Goodkin, D., Hartung, H.P., Lublin, F.D., McFarland, H.F., Paty, D.W., Polman, C.H., Reingold, S.C., Sandberg-Wollheim, M., Sibley, W., Thompson, A., van den Noort, S., Weinshenker, B.Y., Wolinsky, J.S., 2001. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann. Neurol. 50, 121–127. Mondini, M., Costa, S., Sponza, S., Gugliesi, F., Gariglio, M., Landolfo, S., 2010. The interferon-inducible HIN-200 gene family in apoptosis and inflammation: implication for autoimmunity. Autoimmunity 43, 226–231. Purcell, S., Neale, B., Todd-Brown, K., Thomas, L., Ferreira, M.A., Bender, D., Maller, J., Sklar, P., de Bakker, P.I., Daly, M.J., Sham, P.C., 2007. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575.
Unterholzner, L., Keating, S.E., Baran, M., Horan, K.A., Jensen, S.B., Sharma, S., Sirois, C.M., Jin, T., Latz, E., Xiao, T.S., Fitzgerald, K.A., Paludan, S.R., Bowie, A.G., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997–1004. Wigginton, J.E., Cutler, D.J., Abecasis, G.R., 2005. A note on exact tests of Hardy–Weinberg equilibrium. Am. J. Hum. Genet. 76, 887–893. Zhernakova, A., Stahl, E.A., Trynka, G., Raychaudhuri, S., Festen, E.A., Franke, L., Westra, H.J., Fehrmann, R.S., Kurreeman, F.A., Thomson, B., Gupta, N., Romanos, J., McManus, R., Ryan, A.W., Turner, G., Brouwer, E., Posthumus, M.D., Remmers, E.F., Tucci, F., Toes, R., Grandone, E., Mazzilli, M.C., Rybak, A., Cukrowska, B., Coenen, M.J., Radstake, T.R., van Riel, P.L., Li, Y., de Bakker, P.I., Gregersen, P.K., Worthington, J., Siminovitch, K.A., Klareskog, L., Huizinga, T.W., Wijmenga, C., Plenge, R.M., 2011. Meta-analysis of genome-wide association studies in celiac disease and rheumatoid arthritis identifies fourteen non-HLA shared loci. PLoS Genet. 7, e1002004.
Contents lists available at ScienceDirect
Journal of Neuroimmunology journal homepage: www.elsevier.com/locate/jneuroim
Short communication
No association of IFI16 (interferon-inducible protein 16) variants with susceptibility to multiple sclerosis Franca R. Guerini a, Mario Clerici a,b, Rachele Cagliani c, Sunny Malhotra d, Xavier Montalban d, Diego Forni c, Cristina Agliardi a, Stefania Riva c, Domenico Caputo a, Daniela Galimberti e, Rosanna Asselta f, Chiara Fenoglio e, Elio Scarpini e, Giacomo P. Comi e, Nereo Bresolin c,e, Manuel Comabella d,1, Manuela Sironi c,⁎,1 a
Don C. Gnocchi Foundation ONLUS, IRCCS, 20100 Milan, Italy Department of Physiopathology and Transplantation, University of Milan, 20090 Milano, Italy c Scientific Institute IRCCS E. Medea, 23842 Bosisio Parini, LC, Italy d Department of Neurology–Neuroimmunology, Centre d' Esclerosi Múltiple de Catalunya, Cemcat, Hospital Universitari Vall d' Hebron (HUVH), Barcelona, Spain e Dino Ferrari Centre, Department of Physiopathology and Transplantation, University of Milan, Fondazione Ca' Granda IRCCS Ospedale Maggiore Policlinico, 20122 Milan, Italy f Dipartimento di Biotecnologie Mediche e Medicina Traslazionale, Università degli Studi di Milano, Milano, Italy b
a r t i c l e
i n f o
Article history: Received 23 January 2014 Received in revised form 10 March 2014 Accepted 8 April 2014
Keywords: IFI16 (interferon-inducible protein 16) Multiple sclerosis Genetic susceptibility EBV infection
a b s t r a c t IFI16 encodes a nucleic acid-sensor which detects latent EBV and triggers inflammasome activation. We analysed IFI16 variants in two multiple sclerosis (MS) case–control cohorts from Italy and Spain; results were combined with a previous study. A risk variant for celiac disease/rheumatoid arthritis, a polymorphic exon 7 duplication, and a copy number variant (CNV) in the 5′ region were genotyped. No significant association was detected, although heterogeneity was noted for the 5′ CNV in the Italian plus GeneMSA cohorts and the Spanish sample. Thus, IFI16 variants do not contribute to MS susceptibility, although some heterogeneity may exist for the 5′ CNV. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system with an established genetic component. Large-scale efforts including genome-wide association studies (GWAS) and meta-analyses have identified 110 non-MHC (major histocompatibility complex) susceptibility variants for MS that, together with the MHC effects, explain 28% of the sibling recurrence risk (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013). Thus, a large part of the genetic risk factors for MS remains to be identified. Common variants with small effect, which have been treated as false-negatives in GWAS, are likely to account for a portion of the still undefined MS risk loci. Indeed, recent evidence has indicated a polygenic model of disease susceptibility with multiple markers (that fail to reach even nominal significance in GWAS) contributing to disease risk with very small effects
⁎ Corresponding author at: Scientific Institute IRCCS E. Medea, 23842 Bosisio Parini, (LC), Italy. E-mail address: [email protected] (M. Sironi). 1 These authors equally contributed to this work.
http://dx.doi.org/10.1016/j.jneuroim.2014.04.006 0165-5728/© 2014 Elsevier B.V. All rights reserved.
(International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2010). Rare polymorphisms, copy number variants (CNVs), and genetic interactions might help as well to explain a portion of the missing heritability of MS. Overall, these observations suggest that approaches distinct from large-scale genotyping might complement GWAS results. The overwhelming majority of identified susceptibility alleles for MS indicated that immune and inflammatory response genes are major contributors to disease pathogenesis and suggest a substantial overlap with risk loci for other autoimmune diseases (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013). The IFI16 (interferon-inducible protein 16) gene encodes a nucleic acidsensing receptor involved in the nuclear and cytoplasmic detection of double-strand DNA (Unterholzner et al., 2010). IFI16 has been involved in the pathogenesis of several autoimmune diseases (Mondini et al., 2010) and a susceptibility variant for rheumatoid arthritis (RA) and celiac disease has been identified in intron 7 (Zhernakova et al., 2011). Interestingly, IFI16 is up-regulated in peripheral blood cells of MS patients during the disease relapses (Arthur et al., 2008). Thus, we assessed the possible contribution of IFI16 single nucleotide polymorphisms (SNPs) and CNVs to MS genetic susceptibility.
50
F.R. Guerini et al. / Journal of Neuroimmunology 271 (2014) 49–52
2. Materials and methods 2.1. HapMap samples, patients, and controls Human genomic DNA from HapMap subjects was obtained from the Coriell Institute for Medical Research. For the Italian MS case/control association study, we enrolled 849 MS patients (561 females, 288 males) and 516 age-matched healthy controls (HC; 278 females, 238 males). The Spanish cohort comprised 571 MS cases (370 females, 201 males) and 534 HC (283 females, 251 males). All patients and controls were Italian or Spanish of European origin and were recruited at the MS Centre of the Don Gnocchi Foundation in Milan and at Department of Neurological Sciences, University of Milan, and at the Centre d'Esclerosi Múltiple de Catalunya (Cemcat), in Barcelona. All patients satisfied McDonald's criteria for clinically definite MS (McDonald et al., 2001). All subjects gave informed consent according to protocols approved by the corresponding local Ethics Committees. 2.2. Genotyping The insertion/deletion polymorphism upstream the transcription start site of IFI16 was initially analysed using primer pairs that flank the predicted location of the CNV; these analyses revealed the presence of a 4.85 kb (NCBI/hg19, chr1: 158961352–158966201) insertion/ deletion polymorphism ~ 13.5 kb upstream the transcription start site of IFI16. The CNV was genotyped in the case–control cohorts by PCR amplification using a fluorescently labelled forward primer (F: GCAGAGAGAGTTGCCTGGATG) and two unlabelled reverse primers (R-ins: CAGGCTGGTCTCAAACTCCTG, R-del: GACATGGGTG TAGACAACTGTG) that specifically amplify the inserted or deleted alleles. PCR-amplified fluorescently tagged samples were run on 3500xL Genetic Analyzer (Life Technologies) using the GeneScanTM 600 LIZ® size standard (Life Technologies). The PCR amplicons were separated by size electrophoresis and the dye labelled products were identified by fluorescence detection. GeneMapper® Software Version 4.0 was applied to size and genotype the alleles. The segmental duplication of exon 7 in IFI16 was analysed using a PCR-based method. In particular, PCR amplifications were performed with JumpStart AccuTaq LA DNA Polymerase (Sigma-Aldrich) and two sets of primers: one that amplifies only the duplicated form (F: GTCC TGTGCACCTTGTGTCA; R: CTGATGTATGGTGAGAGAGC), and one that flanks the segmental duplication (F: GTCCATTTCTGTAGCCATAGG; R: TCTGAGTTGTAGGAGAGCACT). The PCR products were electrophoretically separated on agarose gels. Genotypes for rs1772408 and rs62621173 were obtained by allelic discrimination real-time PCR, using predesigned TaqMan probe assays (Applied Biosystems, Foster City, CA). Reactions were performed using TaqMan Genotyping Master Mix in an ABI 9700 analyser (Applied Biosystems). Genotyping rate was N0.98 for all variants. Analysed polymorphisms were in Hardy–Weinberg equilibrium in all cohorts, as assessed by the application of Exact Tests (Wigginton et al., 2005). 2.3. GWAS data and statistical analysis GeneMSA data (International Multiple Sclerosis Genetics Consortium et al., 2007) were retrieved through dbGAP (http://www.ncbi.nlm.nih.
gov/). Association p values for the International Multiple Sclerosis Genetics Consortium (IMSGC) ImmunoChip study (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013) were retrieved from ImmunoBase website (https://www.immunobase. org/). Genetic association was investigated by logistic regression using genotypes/haplotypes as the independent predictor variables with sex as a covariate. Results from different cohorts/studies were combined using a random-effect meta-analysis; all analyses were performed using PLINK (Purcell et al., 2007). 3. Results 3.1. Genetic diversity at IFI16 As mentioned above, a common variant in IFI16 (rs1772408, intronic) has previously been associated with autoimmune diseases (Zhernakova et al., 2011). Because CNVs are thought to contribute significantly to human phenotypic diversity (Gamazon et al., 2011) but are often not surveyed in GWASs, we analysed CNVs in IFI16. Specifically, the human IFI16 gene carries a polymorphic segmental duplication of exon 7 (the duplicated exons are identical in sequence) (Fig. 1). Also, a CNV located upstream the gene transcription start site has been repeatedly described (database of Genomic Variants, http:// dgv.tcag.ca/dgv/app/home) (Fig. 1). Thus, we applied a PCR-based approach to determine the allelic status of these CNVs in 20 HapMap subjects of European ancestry (CEU). Results showed that the minor alleles (deletion in both cases) for the 5′ CNV and the exon 7 segmental duplication had a frequency of 17.5% and 7.5%, respectively in CEU. Analysis of SNP genotype data (as derived from HapMap) indicated that the 5′ CNV is tagged by rs9887904 (r2 = 1), whereas several SNPs (the closest being rs62621173) are in full linkage disequilibrium (LD, r2 = 1) with the exon 7 duplication polymorphism; none of the variants tagging the exon 7 duplication is included in GWAS platforms (http://www.broadinstitute.org/mpg/snap). LD analyses were replicated for 50 Italian and 50 Spanish healthy controls with the same results (r2 = 1 in all instances). 3.2. Association with MS susceptibility To determine whether IFI16 variants/haplotypes modulate the risk to develop MS, we recruited two case–control cohorts, one from Italy (MS = 849, HC = 516) and one from Spain (MS = 571, HC = 534). Genotypes for the 5′ CNV, rs1772408, and rs62621173 (for the exon 7 CNV) were obtained for all subjects. Logistic regression (additive model) indicated a significant association between the 5′ CNV polymorphism and MS susceptibility in the Italian cohort; this finding was not observed in the Spanish sample (Table 1). Overall, a meta-analysis of the two samples plus data from the GeneMSA study (with rs9887904 used as a proxy for the 5′ CNV) (International Multiple Sclerosis Genetics Consortium et al., 2007) indicated that, after multiple test correction, none of the variants we analysed was significantly associated with the risk of developing MS (Table 1). Results from the IMSGC ImmunoChip study (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013) indicated a very weak association with MS susceptibility for the 5′ CNV and for rs1772408 (Table 1).
Fig. 1. Analysed variants. Representation of the IFI16 gene region within the UCSC Genome Browser view. The exon 7 segmental duplication is shown (grey bars), as well as the 5′ CNV and the SNPs we analysed.
F.R. Guerini et al. / Journal of Neuroimmunology 271 (2014) 49–52
51
Table 1 Association of IFI16 polymorphisms with MS susceptibility. SNP
Minor allele
Italian
Spanish
Allele frequency
5′ CNV rs1772408 rs62621173 a b c d e f g h
Del A T
MS
HC
0.1389 0.196 0.057
0.185 0.219 0.073
pb
OR (95% CI)c
0.003 0.182 0.177
0.71 (0.57–0.88) 0.87 (0.72–1.06) 0.80 (0.58–1.11)
Allele frequency MS
HC
0.156 0.158 0.046
0.155 0.180 0.060
GeneMSA
Combineda
IMSGC ImmunoChip
pb
OR (95% CI)c
pd
I2
p
OR
Corrected pe
pf
0.993 0.237 0.211
0.99 (0.79–1.27) 0.87 (0.69–1.09) 0.78 (0.53–1.15)
0.0002g 0.326 n.a.
52.05 0 0
0.051 0.048 0.066
0.83 0.89 0.79
0.066 0.066 0.066
0.022g 0.023h n.a.
Heterogeneity index, p value and OR for a random-effect meta-analysis. Logistic regression p value (additive model). Odds ratio (OR) and 95% confidence intervals. p value from the GeneMSA study (GWAS). False discovery rate (FDR)-corrected p value. p value from the IMSGC ImmunoChip study. p value for rs9887904 (r2 = 1 with the 5′ CNV). p value for rs1772415 (r2 = 1 with rs1772408, http://www.broadinstitute.org/mpg/snap/, data from the 1000 Genomes Pilot Project).
Haplotype analysis detected significant associations, mainly driven by the 5′ CNV polymorphism, in the Italian sample, but the results were not replicated in the Spanish cohort (Table 2). Overall, these data suggest that SNP and structural variants in IFI16 do not contribute substantially to MS susceptibility.
often been reported (Ascherio and Munger, 2007). Given the central role of the gene in the antiviral response, it may be worth exploring whether IFI16 variants modulate the susceptibility to MS in the interaction with specific viral infection or EBV strains (Ascherio and Munger, 2007).
4. Discussion References We have analysed three polymorphisms in IFI16 for association with MS. These variants were selected on the basis of previous association results (Zhernakova et al., 2011) or of their likely functional significance (in the case of CNVs). Results indicated that IFI16 cannot be regarded as a risk gene for MS, although some heterogeneity was observed for the 5′ CNV in the Italian plus GeneMSA cohorts (showing significant association) and in the Spanish sample (showing not even marginally significant frequency differences). Data from a large-scale ImmunoChip study confirmed an extremely weak association, although they do not provide information on possible heterogeneity sources (if any). At least three different reasons point to IFI16 being a very good candidate as a susceptibility gene for MS. First, a variant in the gene has been associated with RA and celiac disease, which share genetic risk alleles with MS (International Multiple Sclerosis Genetics Consortium (IMSGC) et al., 2013); also, IFI16 has been implicated in the pathogenesis of systemic sclerosis, systemic lupus erythematosus, and Sjögren's syndrome (Mondini et al., 2010). Second, IFI16 is upregulated during MS relapses (Arthur et al., 2008). Third, recent evidences have indicated that IFI16 senses Epstein–Barr virus (EBV) during all latency stages and determines constitutive inflammasome activation and cytokine (IL-1b, IL-33, and Il-18) production (Ansari et al., 2013). As EBV constitutes the strongest environmental risk factor for the disease (Ascherio and Munger, 2007), this represents an important link with the pathogenesis of MS. In this respect it is worth mentioning that several viral infections have been associated with the risk of developing MS, although contrasting results have
Table 2 Haplotype association. Haplotype (5′ CNV–rs1772408– rs62621173)
Italian a
Ins–G–T Del–G–C Ins–A–C Del–A–C a
Logistic regression p value and OR.
Spanish a
OR
p
ORa
pa
0.79 0.69 0.93 1.32
0.181 0.009 0.513 0.002
0.84 1.11 0.96 1.04
0.423 0.481 0.754 0.662
Ansari, M.A., Singh, V.V., Dutta, S., Veettil, M.V., Dutta, D., Chikoti, L., Lu, J., Everly, D., Chandran, B., 2013. Constitutive interferon-inducible protein 16-inflammasome activation during Epstein–Barr virus latency I, II, and III in B and epithelial cells. J. Virol. 87, 8606–8623. Arthur, A.T., Armati, P.J., Bye, C., Southern MS Genetics Consortium, Heard, R.N., Stewart, G.J., Pollard, J.D., Booth, D.R., 2008. Genes implicated in multiple sclerosis pathogenesis from consilience of genotyping and expression profiles in relapse and remission. BMC Med. Genet. 9 (17-2350-9-17). Ascherio, A., Munger, K.L., 2007. Environmental risk factors for multiple sclerosis. Part I: the role of infection. Ann. Neurol. 61, 288–299. Gamazon, E.R., Nicolae, D.L., Cox, N.J., 2011. A study of CNVs as trait-associated polymorphisms and as expression quantitative trait loci. PLoS Genet. 7, e1001292. International Multiple Sclerosis Genetics Consortium (IMSGC), Bush, W.S., Sawcer, S.J., de Jager, P.L., Oksenberg, J.R., McCauley, J.L., Pericak-Vance, M.A., Haines, J.L., 2010. Evidence for polygenic susceptibility to multiple sclerosis—the shape of things to come. Am. J. Hum. Genet. 86, 621–625. International Multiple Sclerosis Genetics Consortium (IMSGC), Beecham, A.H., Patsopoulos, N.A., Xifara, D.K., Davis, M.F., Kemppinen, A., Cotsapas, C., Shah, T.S., Spencer, C., Booth, D., Goris, A., Oturai, A., Saarela, J., Fontaine, B., Hemmer, B., Martin, C., Zipp, F., D'Alfonso, S., Martinelli-Boneschi, F., Taylor, B., Harbo, H.F., Kockum, I., Hillert, J., Olsson, T., Ban, M., Oksenberg, J.R., Hintzen, R., Barcellos, L.F., Wellcome Trust Case Control Consortium 2 (WTCCC2), International IBD Genetics Consortium (IIBDGC), Agliardi, C., Alfredsson, L., Alizadeh, M., Anderson, C., Andrews, R., Sondergaard, H.B., Baker, A., Band, G., Baranzini, S.E., Barizzone, N., Barrett, J., Bellenguez, C., Bergamaschi, L., Bernardinelli, L., Berthele, A., Biberacher, V., Binder, T.M., Blackburn, H., Bomfim, I.L., Brambilla, P., Broadley, S., Brochet, B., Brundin, L., Buck, D., Butzkueven, H., Caillier, S.J., Camu, W., Carpentier, W., Cavalla, P., Celius, E.G., Coman, I., Comi, G., Corrado, L., Cosemans, L., Cournu-Rebeix, I., Cree, B.A., Cusi, D., Damotte, V., Defer, G., Delgado, S.R., Deloukas, P., di Sapio, A., Dilthey, A.T., Donnelly, P., Dubois, B., Duddy, M., Edkins, S., Elovaara, I., Esposito, F., Evangelou, N., Fiddes, B., Field, J., Franke, A., Freeman, C., Frohlich, I.Y., Galimberti, D., Gieger, C., Gourraud, P.A., Graetz, C., Graham, A., Grummel, V., Guaschino, C., Hadjixenofontos, A., Hakonarson, H., Halfpenny, C., Hall, G., Hall, P., Hamsten, A., Harley, J., Harrower, T., Hawkins, C., Hellenthal, G., Hillier, C., Hobart, J., Hoshi, M., Hunt, S.E., Jagodic, M., Jelcic, I., Jochim, A., Kendall, B., Kermode, A., Kilpatrick, T., Koivisto, K., Konidari, I., Korn, T., Kronsbein, H., Langford, C., Larsson, M., Lathrop, M., Lebrun-Frenay, C., Lechner-Scott, J., Lee, M.H., Leone, M.A., Leppa, V., Liberatore, G., Lie, B.A., Lill, C.M., Linden, M., Link, J., Luessi, F., Lycke, J., Macciardi, F., Mannisto, S., Manrique, C.P., Martin, R., Martinelli, V., Mason, D., Mazibrada, G., McCabe, C., Mero, I.L., Mescheriakova, J., Moutsianas, L., Myhr, K.M., Nagels, G., Nicholas, R., Nilsson, P., Piehl, F., Pirinen, M., Price, S.E., Quach, H., Reunanen, M., Robberecht, W., Robertson, N.P., Rodegher, M., Rog, D., Salvetti, M., Schnetz-Boutaud, N.C., Sellebjerg, F., Selter, R.C., Schaefer, C., Shaunak, S., Shen, L., Shields, S., Siffrin, V., Slee, M., Sorensen, P.S., Sorosina, M., Sospedra, M., Spurkland, A., Strange, A., Sundqvist, E., Thijs, V., Thorpe, J., Ticca, A., Tienari, P., van Duijn, C., Visser, E.M., Vucic, S., Westerlind, H., Wiley, J.S., Wilkins, A., Wilson, J.F., Winkelmann, J., Zajicek, J., Zindler, E., Haines, J.L., Pericak-Vance, M.A., Ivinson, A.J., Stewart, G., Hafler, D., Hauser, S.L., Compston, A., McVean, G., De Jager, P., Sawcer, S.J., McCauley, J.L., 2013. Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis. Nat. Genet. 45, 1353–1360.
52
F.R. Guerini et al. / Journal of Neuroimmunology 271 (2014) 49–52
International Multiple Sclerosis Genetics Consortium, Hafler, D.A., Compston, A., Sawcer, S., Lander, E.S., Daly, M.J., De Jager, P.L., de Bakker, P.I., Gabriel, S.B., Mirel, D.B., Ivinson, A.J., Pericak-Vance, M.A., Gregory, S.G., Rioux, J.D., McCauley, J.L., Haines, J.L., Barcellos, L.F., Cree, B., Oksenberg, J.R., Hauser, S.L., 2007. Risk alleles for multiple sclerosis identified by a genomewide study. N. Engl. J. Med. 357, 851–862. McDonald, W.I., Compston, A., Edan, G., Goodkin, D., Hartung, H.P., Lublin, F.D., McFarland, H.F., Paty, D.W., Polman, C.H., Reingold, S.C., Sandberg-Wollheim, M., Sibley, W., Thompson, A., van den Noort, S., Weinshenker, B.Y., Wolinsky, J.S., 2001. Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Ann. Neurol. 50, 121–127. Mondini, M., Costa, S., Sponza, S., Gugliesi, F., Gariglio, M., Landolfo, S., 2010. The interferon-inducible HIN-200 gene family in apoptosis and inflammation: implication for autoimmunity. Autoimmunity 43, 226–231. Purcell, S., Neale, B., Todd-Brown, K., Thomas, L., Ferreira, M.A., Bender, D., Maller, J., Sklar, P., de Bakker, P.I., Daly, M.J., Sham, P.C., 2007. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575.
Unterholzner, L., Keating, S.E., Baran, M., Horan, K.A., Jensen, S.B., Sharma, S., Sirois, C.M., Jin, T., Latz, E., Xiao, T.S., Fitzgerald, K.A., Paludan, S.R., Bowie, A.G., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997–1004. Wigginton, J.E., Cutler, D.J., Abecasis, G.R., 2005. A note on exact tests of Hardy–Weinberg equilibrium. Am. J. Hum. Genet. 76, 887–893. Zhernakova, A., Stahl, E.A., Trynka, G., Raychaudhuri, S., Festen, E.A., Franke, L., Westra, H.J., Fehrmann, R.S., Kurreeman, F.A., Thomson, B., Gupta, N., Romanos, J., McManus, R., Ryan, A.W., Turner, G., Brouwer, E., Posthumus, M.D., Remmers, E.F., Tucci, F., Toes, R., Grandone, E., Mazzilli, M.C., Rybak, A., Cukrowska, B., Coenen, M.J., Radstake, T.R., van Riel, P.L., Li, Y., de Bakker, P.I., Gregersen, P.K., Worthington, J., Siminovitch, K.A., Klareskog, L., Huizinga, T.W., Wijmenga, C., Plenge, R.M., 2011. Meta-analysis of genome-wide association studies in celiac disease and rheumatoid arthritis identifies fourteen non-HLA shared loci. PLoS Genet. 7, e1002004.