- Email: [email protected]
No association of Presenilin-1 intronic polymorphism and Alzheimer's disease in Australia
Neuroscience Letters 246 (1998) 178–180
No association of Presenilin-1 intronic polymorphism and Alzheimer’s disease in Australia K. Taddei a,1, D. Yang a,1, C. Fisher a, R. Clarnette c, J. Hallmayer h, R. Barnetson f, R. Maller d, W.S. Brooks g, S. Whyte g, G.A. Nicholson f, C.L. Masters e, G.A. Broe g, S.E. Gandy b, R.N. Martins a ,* a
Department of Surgery, University of Western Australia and Sir James McCusker Alzheimer’s Disease Research Unit, Hollywood Private Hospital, Monash Avenue, Nedlands, Perth, Australia 6009 b Alzheimer Research Program, New York University, N.S. Kline Institute, Orangeburg NY 10962, USA c Department of Geriatric Medicine and Extended Care, Osborne Park Hospital, Perth, Australia 6009 d Department of Mathematics, University of Western Australia, Perth, Australia 6009 e Department of Pathology, The University of Melbourne and the Mental Health Research Institute of Victoria, Parkville, Victoria, Australia 3052 f Molecular Medicine Laboratory, University of Sydney and Concorde Repatriation General Hospital, Concord, NSW, Australia 2139 g Centre for Education and Research on Ageing, University of Sydney and Concord Repatriation General Hospital, Concord, NSW, Australia 2139 h Centre for Clinical Research in Neuropsychiatry, University of Western Australia and Graylands Hospital, Claremont, WA, Australia 6010 Received 5 December 1997; received in revised form 24 February 1998; accepted 13 March 1998
Abstract We screened 703 Australian subjects for an intronic polymorphism in the presenilin-1 (PS-1) gene. PS-1 intronic allele 1 homozygosity was not associated with individuals with early- or late-onset sporadic Alzheimer’s disease (EOAD or LOAD). Carriers for the PS-1 intronic allele 1 were also not associated with significantly increased risk for AD regardless of gender. Our results for the Australian population are consistent with those of recent reports for other populations and do not support the conclusion that the PS-1 intronic polymorphism is associated with AD. 1998 Elsevier Science Ireland Ltd.
Keywords: Alzheimer’s disease; Presenilin-1; Intronic polymorphism; Genetics; Chromosome
Mutations in the presenilin-1 (PS-1) gene account for about 50% of all early-onset autosomal dominant cases of familial Alzheimer’s disease (EOAD) [9]. Wragg et al. [11] have reported data suggesting involvement of PS-1 in the more common late-onset sporadic AD, demonstrating association between the 1/1 intronic genotype of PS-1 and sporadic late onset AD in Caucasian Americans. However, no such association was present in African-Americans [11] nor in a French population [7], suggesting that the association may vary among different ethnic groups. Independent studies from the United Kingdom [3] and Japan [1] have also described increased frequencies for homozygosity of the PS-1 intronic type 1 allele in late onset sporadic AD. * Corresponding author. Tel.: +61 8 93466703; fax: +61 8 93466666; e-mail address: [email protected] 1 These authors contributed equally to this work.
However, Scott et al. [8] studying 316 AD cases and 254 controls from the United States, did not observe any significant difference in the genotype homozygous for allele 1 between the two groups. In the current study, we report the PS-1 intronic genotypes of a sample of 703 individuals from an Australian caucasian population consisting of controls and EO and LO sporadic AD patients. With approval from our institute’s ethics committee, we studied 51 sporadic EOAD patients (43% female, mean age 60 years, range 34–73 years) and 210 late-onset sporadic AD patients (61% female, mean age 80 years, range 65–95 years). All patients fulfilled NINCDS-ADRDA [6] criteria for probable AD at time of venipuncture. The 442 control subjects (50% female, mean age 75 years, range 51–93 years) were Australian volunteers with no apparent cognitive deficits. DNA for PS-1 genotyping was extracted from white
0304-3940/98/$19.00 1998 Elsevier Science Ireland Ltd. All rights reserved PII S0304- 3940(98) 00248- 1
179
K. Taddei et al. / Neuroscience Letters 246 (1998) 178–180
Fig. 1. Acrylamide gel showing PS-1 polymorphism genotypes. Gel shows the 200 and 182 basepair (bp) band pattern for PS-1 polymorphism to distinguish between 1/1 and 2/2 homozygotes and 1/2 heterozygotes.
blood cells using a standard protocol. In order to identify the intronic polymorphism situated 3′ of exon 8 of the PS-1 gene, PCR was performed as described by Wragg et al. [11], using the oligonucleotide primers, 5′ CACCCATTTACAAGTTTAGC 3′, and reverse (‘mismatched’) primer 5′ CACTGATTACTAATTCAGGATC 3′. Amplified DNA was then subjected to restriction enzyme digestion with BamHI to cleave fragments of 182 (allele 2) and/or 200 (allele 1) base pairs (Fig. 1). APOE genotyping was performed as described by Hixson and Vernier [2]. For the majority of subjects, the APOE genotype was known from previous studies [5]. The genotype and allele frequency for the intronic polymorphism of PS-1 are presented for control and groups which are segregated according to gender (Table 1). Distributions of alleles and genotypes were compared using x2 tests. Logistic regression was employed to test the effect of gender, APOE e4 genotype, PS-1 genotype/alleles and interaction between the variables. Two-tailed tests of significance were used throughout the analyses. Calculations were carried out using EXCELv7a for Windows and SPSSv7 for Windows.
As reported previously by several groups including our own, a significantly increased incidence of the APOE e4 allele was observed in AD patients as compared to controls (P , 0.0001). The increased risk with one e4 allele was greater than 2-fold (OR = 2.216) which is very similar to the OR value reported by Wragg et al. [11] for an American Caucasian population. A slightly higher increase in risk was calculated in males (OR = 2.5) when compared to females (OR = 1.9). In this study the presence of two e4 alleles increased the risk of developing AD more than 8-fold (OR = 8.7). There were substantial differences between males and females in the odds ratios for e4 homozygotes (females 5.6 and males 16.5). However, the total number of males and females homozygous for APOE e4 was low. The genotype distribution of the PS-1 alleles in the total sample was not significantly different from a distribution assuming Hardy–Weinberg equilibrium (x2 test, P = 0.092). No differences were detected in the genotype distributions when all AD cases (EOAD and LOAD combined) and controls were compared (P = 0.378). Comparing separately EOAD and LOAD cases with age-matched controls also produced non-significant results (P = 0.652 and P = 0.628, respectively). Neither the PS-1 1/1 (P = 0.214) nor the 2/2 (P = 0.845) genotype was associated with an increased risk for AD. Likewise, the PS-1 allele genotype shared no obvious effect on gender or on age of onset. In order to test for interaction between the PS-1 alleles and APOE e4 alleles, we stratified the total sample by the presence and absence of an e4 allele. Again no differences were detected between the distribution of PS-1 alleles of all AD cases versus age-matched controls (presence of an e4 allele P = 0.9 and absence of an e4 allele P = 0.234). The results were not significantly different when comparing separately LOAD and EOAD cases with age-matched controls (for LOAD cases, in the presence of an e4 allele P = 0.346 and in its absence P = 0.213; for EOAD cases, in the presence of an e4 allele P = 0.340 and in its absence P = 0.708). Results from logistic regression were also consistent with these conclusions. Thus, results for the Australian population are in agreement with recent reports for
Table 1 PS-1 intronic genotype and allele frequency distributions in Australian patients with probable Alzheimer’s disease Genotype frequency
Control female Control male EOAD female EOAD male LOAD female LOAD male Combined AD female Combined AD male Early onset, ,65 years.
Allele frequency
1/1
1/2
2/2
1/1 + 1/2
1
2
75 (0.34) 64 (0.29) 8 (0.36) 7 (0.24) 53 (0.41) 26 (0.32) 61 (0.40) 33 (0.30)
111 (0.51) 125 (0.56) 13 (0.59) 15 (0.52) 57 (0.44) 41 (0.51) 70 (0.47) 56 (0.51)
33 (0.15) 34 (0.15) 1 (0.05) 7 (0.24) 19 (0.15) 14 (0.17) 20 (0.13) 21 (0.19)
186 (0.84) 189 (0.85) 21 (0.95) 22 (0.76) 110 (0.85) 67 (0.83) 122 (0.87) 89 (0.81)
261 (0.60) 253 (0.57) 29 (0.66) 29 (0.50) 163 (0.63) 93 (0.57) 192 (0.64) 122 (0.55)
177 (0.40) 193 (0.43) 15 (0.34) 29 (0.50) 95 (0.37) 69 (0.43) 110 (0.36) 98 (0.45)
180
K. Taddei et al. / Neuroscience Letters 246 (1998) 178–180
other populations indicating that an intronic polymorphism in the PS-1 gene apparently does not modify risk for sporadic EOAD or LOAD [4,8,10,12]. The excellent technical assistance of Athena Paton and Georgia Martins is most appreciated for the collection and processing of blood samples. The authors thank Jenny Millar for typing this manuscript. Special thanks go to all Alzheimer’s disease patients, normal aged controls and their families for participation in this study. Supported by grants from Sir James McCusker, the Department of Veteran Affairs (R.N.M.), the USPHS (A.G. 11508 to S.G.) and the C.S. Starr Foundation (S.G). [1] Higuchi, S., Muramatsu, T., Matsushita, S., Arai, H. and Sasaki, H., Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1186. [2] Hixson, J.E. and Vernier, D.T., Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI, J. Lipid Res., 31 (1990) 545–548. [3] Kehoe, P., Williams, J., Lovestone, S., Wilcock, G., Owen, M.J., Holmans, P., Liddell, M., Holmes, C., Powall, J. and Neal, J., Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1185. [4] Lendon, C.L., Myers, A., Cumming, A., Goate, A.M. and St. Clair, D., A polymorphism in the presenilin 1 gene does not modify risk for Alzheimer’s disease in a cohort with sporadic early onset AD, Neurosci. Lett., 228 (1997) 212–214. [5] Martins, R.N., Clarnette, R., Fisher, C., Broe, G.A., Brooks, W.S., Montgomery, P. and Gandy, S.E., ApoE genotypes in Australia: roles in early and late onset Alzheimer’s disease and Down’s syndrome, NeuroReport, 6 (1995) 1513–1516.
[6] McKhann, G., Drachman, D., Folstein, M., Katzman, R., Price, D. and Stadlan, E.M., Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s disease, Neurology, 34 (1984) 939–944. [7] Perez-Tur, J., Wavrant-De Vrieze, F., Lambert, J.C., ChartierHarlin, M.C. and the Alzheimer’s Study group, Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1560. [8] Scott, W.K., Roses, A.D., Haines, J.L. and Pericak-Vance, M.A., Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1561–1561. [9] Sherrington, R., Rogaev, E., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., Tsuda, T., Mar, L., Foncin, J.F., Bruni, A.C., Montesi, M.P., Sorbi, S., Rainero, I., Pinessi, L., Nee, L., Chumakov, I., Pollen, D., Brookes, A., Sanseau, P., Polinsky, R.J., Wasco, W., Da Silva, H.A.R., Haines, J.L., Pericak-Vance, M.A., Tanzi, R.E., Roses, A.D., Fraser, P.E., Rommens, J.M. and St. GeorgeHyslop, P.H., Cloning of a gene bearing mis-sense mutations in early-onset familial Alzheimer’s disease, Nature, 375 (1995) 754–760. [10] Singleton, A.B., Gibson, A.M., Atkinson, A.L., Daly, A. and Morris, C.M., Presenilin polymorphisms in Alzheimer’s disease, Lancet, 350 (1997) 958–959. [11] Wragg, M., Hutton, M., Talbot, C. and the Alzheimer’s Disease Collaborative Group, Genetic association between intronic polymorphism in presenilin-1 gene and late-onset Alzheimer’s disease, Lancet, 347 (1996) 509–512. [12] Xingang, C., Stanton, J., Fallin, D., Hoyne, J., Duara, R., Gold, M., Sevush, S., Scibelli, P., Crawford, F. and Mullan, M., No association between the intronic presenilin-1 polymorphism and Alzheimer’s disease in clinic and population-based samples, Am. J. Med. Genet. (Neuropsychiatric Genet.), 74 (1997) 202–203.
No association of Presenilin-1 intronic polymorphism and Alzheimer’s disease in Australia K. Taddei a,1, D. Yang a,1, C. Fisher a, R. Clarnette c, J. Hallmayer h, R. Barnetson f, R. Maller d, W.S. Brooks g, S. Whyte g, G.A. Nicholson f, C.L. Masters e, G.A. Broe g, S.E. Gandy b, R.N. Martins a ,* a
Department of Surgery, University of Western Australia and Sir James McCusker Alzheimer’s Disease Research Unit, Hollywood Private Hospital, Monash Avenue, Nedlands, Perth, Australia 6009 b Alzheimer Research Program, New York University, N.S. Kline Institute, Orangeburg NY 10962, USA c Department of Geriatric Medicine and Extended Care, Osborne Park Hospital, Perth, Australia 6009 d Department of Mathematics, University of Western Australia, Perth, Australia 6009 e Department of Pathology, The University of Melbourne and the Mental Health Research Institute of Victoria, Parkville, Victoria, Australia 3052 f Molecular Medicine Laboratory, University of Sydney and Concorde Repatriation General Hospital, Concord, NSW, Australia 2139 g Centre for Education and Research on Ageing, University of Sydney and Concord Repatriation General Hospital, Concord, NSW, Australia 2139 h Centre for Clinical Research in Neuropsychiatry, University of Western Australia and Graylands Hospital, Claremont, WA, Australia 6010 Received 5 December 1997; received in revised form 24 February 1998; accepted 13 March 1998
Abstract We screened 703 Australian subjects for an intronic polymorphism in the presenilin-1 (PS-1) gene. PS-1 intronic allele 1 homozygosity was not associated with individuals with early- or late-onset sporadic Alzheimer’s disease (EOAD or LOAD). Carriers for the PS-1 intronic allele 1 were also not associated with significantly increased risk for AD regardless of gender. Our results for the Australian population are consistent with those of recent reports for other populations and do not support the conclusion that the PS-1 intronic polymorphism is associated with AD. 1998 Elsevier Science Ireland Ltd.
Keywords: Alzheimer’s disease; Presenilin-1; Intronic polymorphism; Genetics; Chromosome
Mutations in the presenilin-1 (PS-1) gene account for about 50% of all early-onset autosomal dominant cases of familial Alzheimer’s disease (EOAD) [9]. Wragg et al. [11] have reported data suggesting involvement of PS-1 in the more common late-onset sporadic AD, demonstrating association between the 1/1 intronic genotype of PS-1 and sporadic late onset AD in Caucasian Americans. However, no such association was present in African-Americans [11] nor in a French population [7], suggesting that the association may vary among different ethnic groups. Independent studies from the United Kingdom [3] and Japan [1] have also described increased frequencies for homozygosity of the PS-1 intronic type 1 allele in late onset sporadic AD. * Corresponding author. Tel.: +61 8 93466703; fax: +61 8 93466666; e-mail address: [email protected] 1 These authors contributed equally to this work.
However, Scott et al. [8] studying 316 AD cases and 254 controls from the United States, did not observe any significant difference in the genotype homozygous for allele 1 between the two groups. In the current study, we report the PS-1 intronic genotypes of a sample of 703 individuals from an Australian caucasian population consisting of controls and EO and LO sporadic AD patients. With approval from our institute’s ethics committee, we studied 51 sporadic EOAD patients (43% female, mean age 60 years, range 34–73 years) and 210 late-onset sporadic AD patients (61% female, mean age 80 years, range 65–95 years). All patients fulfilled NINCDS-ADRDA [6] criteria for probable AD at time of venipuncture. The 442 control subjects (50% female, mean age 75 years, range 51–93 years) were Australian volunteers with no apparent cognitive deficits. DNA for PS-1 genotyping was extracted from white
0304-3940/98/$19.00 1998 Elsevier Science Ireland Ltd. All rights reserved PII S0304- 3940(98) 00248- 1
179
K. Taddei et al. / Neuroscience Letters 246 (1998) 178–180
Fig. 1. Acrylamide gel showing PS-1 polymorphism genotypes. Gel shows the 200 and 182 basepair (bp) band pattern for PS-1 polymorphism to distinguish between 1/1 and 2/2 homozygotes and 1/2 heterozygotes.
blood cells using a standard protocol. In order to identify the intronic polymorphism situated 3′ of exon 8 of the PS-1 gene, PCR was performed as described by Wragg et al. [11], using the oligonucleotide primers, 5′ CACCCATTTACAAGTTTAGC 3′, and reverse (‘mismatched’) primer 5′ CACTGATTACTAATTCAGGATC 3′. Amplified DNA was then subjected to restriction enzyme digestion with BamHI to cleave fragments of 182 (allele 2) and/or 200 (allele 1) base pairs (Fig. 1). APOE genotyping was performed as described by Hixson and Vernier [2]. For the majority of subjects, the APOE genotype was known from previous studies [5]. The genotype and allele frequency for the intronic polymorphism of PS-1 are presented for control and groups which are segregated according to gender (Table 1). Distributions of alleles and genotypes were compared using x2 tests. Logistic regression was employed to test the effect of gender, APOE e4 genotype, PS-1 genotype/alleles and interaction between the variables. Two-tailed tests of significance were used throughout the analyses. Calculations were carried out using EXCELv7a for Windows and SPSSv7 for Windows.
As reported previously by several groups including our own, a significantly increased incidence of the APOE e4 allele was observed in AD patients as compared to controls (P , 0.0001). The increased risk with one e4 allele was greater than 2-fold (OR = 2.216) which is very similar to the OR value reported by Wragg et al. [11] for an American Caucasian population. A slightly higher increase in risk was calculated in males (OR = 2.5) when compared to females (OR = 1.9). In this study the presence of two e4 alleles increased the risk of developing AD more than 8-fold (OR = 8.7). There were substantial differences between males and females in the odds ratios for e4 homozygotes (females 5.6 and males 16.5). However, the total number of males and females homozygous for APOE e4 was low. The genotype distribution of the PS-1 alleles in the total sample was not significantly different from a distribution assuming Hardy–Weinberg equilibrium (x2 test, P = 0.092). No differences were detected in the genotype distributions when all AD cases (EOAD and LOAD combined) and controls were compared (P = 0.378). Comparing separately EOAD and LOAD cases with age-matched controls also produced non-significant results (P = 0.652 and P = 0.628, respectively). Neither the PS-1 1/1 (P = 0.214) nor the 2/2 (P = 0.845) genotype was associated with an increased risk for AD. Likewise, the PS-1 allele genotype shared no obvious effect on gender or on age of onset. In order to test for interaction between the PS-1 alleles and APOE e4 alleles, we stratified the total sample by the presence and absence of an e4 allele. Again no differences were detected between the distribution of PS-1 alleles of all AD cases versus age-matched controls (presence of an e4 allele P = 0.9 and absence of an e4 allele P = 0.234). The results were not significantly different when comparing separately LOAD and EOAD cases with age-matched controls (for LOAD cases, in the presence of an e4 allele P = 0.346 and in its absence P = 0.213; for EOAD cases, in the presence of an e4 allele P = 0.340 and in its absence P = 0.708). Results from logistic regression were also consistent with these conclusions. Thus, results for the Australian population are in agreement with recent reports for
Table 1 PS-1 intronic genotype and allele frequency distributions in Australian patients with probable Alzheimer’s disease Genotype frequency
Control female Control male EOAD female EOAD male LOAD female LOAD male Combined AD female Combined AD male Early onset, ,65 years.
Allele frequency
1/1
1/2
2/2
1/1 + 1/2
1
2
75 (0.34) 64 (0.29) 8 (0.36) 7 (0.24) 53 (0.41) 26 (0.32) 61 (0.40) 33 (0.30)
111 (0.51) 125 (0.56) 13 (0.59) 15 (0.52) 57 (0.44) 41 (0.51) 70 (0.47) 56 (0.51)
33 (0.15) 34 (0.15) 1 (0.05) 7 (0.24) 19 (0.15) 14 (0.17) 20 (0.13) 21 (0.19)
186 (0.84) 189 (0.85) 21 (0.95) 22 (0.76) 110 (0.85) 67 (0.83) 122 (0.87) 89 (0.81)
261 (0.60) 253 (0.57) 29 (0.66) 29 (0.50) 163 (0.63) 93 (0.57) 192 (0.64) 122 (0.55)
177 (0.40) 193 (0.43) 15 (0.34) 29 (0.50) 95 (0.37) 69 (0.43) 110 (0.36) 98 (0.45)
180
K. Taddei et al. / Neuroscience Letters 246 (1998) 178–180
other populations indicating that an intronic polymorphism in the PS-1 gene apparently does not modify risk for sporadic EOAD or LOAD [4,8,10,12]. The excellent technical assistance of Athena Paton and Georgia Martins is most appreciated for the collection and processing of blood samples. The authors thank Jenny Millar for typing this manuscript. Special thanks go to all Alzheimer’s disease patients, normal aged controls and their families for participation in this study. Supported by grants from Sir James McCusker, the Department of Veteran Affairs (R.N.M.), the USPHS (A.G. 11508 to S.G.) and the C.S. Starr Foundation (S.G). [1] Higuchi, S., Muramatsu, T., Matsushita, S., Arai, H. and Sasaki, H., Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1186. [2] Hixson, J.E. and Vernier, D.T., Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI, J. Lipid Res., 31 (1990) 545–548. [3] Kehoe, P., Williams, J., Lovestone, S., Wilcock, G., Owen, M.J., Holmans, P., Liddell, M., Holmes, C., Powall, J. and Neal, J., Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1185. [4] Lendon, C.L., Myers, A., Cumming, A., Goate, A.M. and St. Clair, D., A polymorphism in the presenilin 1 gene does not modify risk for Alzheimer’s disease in a cohort with sporadic early onset AD, Neurosci. Lett., 228 (1997) 212–214. [5] Martins, R.N., Clarnette, R., Fisher, C., Broe, G.A., Brooks, W.S., Montgomery, P. and Gandy, S.E., ApoE genotypes in Australia: roles in early and late onset Alzheimer’s disease and Down’s syndrome, NeuroReport, 6 (1995) 1513–1516.
[6] McKhann, G., Drachman, D., Folstein, M., Katzman, R., Price, D. and Stadlan, E.M., Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s disease, Neurology, 34 (1984) 939–944. [7] Perez-Tur, J., Wavrant-De Vrieze, F., Lambert, J.C., ChartierHarlin, M.C. and the Alzheimer’s Study group, Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1560. [8] Scott, W.K., Roses, A.D., Haines, J.L. and Pericak-Vance, M.A., Presenilin-1 polymorphism and Alzheimer’s disease, Lancet, 347 (1996) 1561–1561. [9] Sherrington, R., Rogaev, E., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., Tsuda, T., Mar, L., Foncin, J.F., Bruni, A.C., Montesi, M.P., Sorbi, S., Rainero, I., Pinessi, L., Nee, L., Chumakov, I., Pollen, D., Brookes, A., Sanseau, P., Polinsky, R.J., Wasco, W., Da Silva, H.A.R., Haines, J.L., Pericak-Vance, M.A., Tanzi, R.E., Roses, A.D., Fraser, P.E., Rommens, J.M. and St. GeorgeHyslop, P.H., Cloning of a gene bearing mis-sense mutations in early-onset familial Alzheimer’s disease, Nature, 375 (1995) 754–760. [10] Singleton, A.B., Gibson, A.M., Atkinson, A.L., Daly, A. and Morris, C.M., Presenilin polymorphisms in Alzheimer’s disease, Lancet, 350 (1997) 958–959. [11] Wragg, M., Hutton, M., Talbot, C. and the Alzheimer’s Disease Collaborative Group, Genetic association between intronic polymorphism in presenilin-1 gene and late-onset Alzheimer’s disease, Lancet, 347 (1996) 509–512. [12] Xingang, C., Stanton, J., Fallin, D., Hoyne, J., Duara, R., Gold, M., Sevush, S., Scibelli, P., Crawford, F. and Mullan, M., No association between the intronic presenilin-1 polymorphism and Alzheimer’s disease in clinic and population-based samples, Am. J. Med. Genet. (Neuropsychiatric Genet.), 74 (1997) 202–203.