No evidence of WT1 involvement in a Burkitt’s lymphoma in a patient with Denys–Drash syndrome

Annals of Oncology 9: 627-631. 1998. £ 1998 Khmer Academic Publishers. Printed in the Netherlands.

Original article No evidence of WTl involvement in a Burkitt's lymphoma in a patient with Denys-Drash syndrome D. Perotti,1 P. Mondini,2 R. Giardini,3 A. Ferrari,1 M. Massimino,1 F. Gambirasio,1 M. A. Pierotti,2 F. Fossati-Bellani1 & P. Radice2 Divisions of Paediatric Oncology, 'Experimental Oncology A, 3 Anatomical Pathology and Cytology, Istituto Naztonaleper lo Studio e la Cura dei Tumori, Milan, Italy

Results: A germline missense mutation affecting one of the zinc finger domains of the gene, and previously reported in Background: We previously reported the case of a patient other DDS cases, was observed. No alterations of the constituaffected with Denys-Drash syndrome (DDS), who developed tionally wild-type WTl allele and no expression of the gene disseminated EBV-related Burkitt's lymphoma (BL) after were observed in BL cells. A small group of BLs from other kidney transplantation. Here, we describe the molecular char- paediatric patients showed a variable expression of WTl. acterisation of the WTl gene in the constitutional and tumour Conclusions: Our findings indicate that WTl is unlikely to DNA of this patient. be involved in the onset of BL in our case. However, a possible Patients and methods: WTl exons 2 to 10 were sequenced in role of the gene in at least a subset of these lymphoproliferative constitutional and tumour DNAs. By Southern blotting the diseases may be suggested. latter was also investigated for the presence of gene rearrangements. Gene expression analysis in tumour cells was performed by reverse transcriptase-polymerase chain reaction (RT-PCR). Key words: Burkitt's lymphoma, Denys-Drash syndrome, WTl Summary

in patients affected by the WAGR (Wilms tumour, aniridia, genitourinary malformation and mental retarDenys-Drash syndrome (DDS) is a rare developmental dation) syndrome [16], in familial WTs [17] and in bilatdisorder of the genito-urinary system that comprises eral non-syndromic WTs [18, 19]. In addition, approxithe triad of congenital or infantile nephropathy, partial mately 5% of sporadic unilateral WTs have been found gonadal disgenesis, and Wilms tumour (WT), which is to carry somatic intragenic mutations of WTl [20]. usually bilateral and presents at a mean age of 18 months While in most of these tumours the WTl gene is com[1, 2]. Although the spectrum of DDS phenotypes may pletely inactivated by mutations affecting both alleles, in vary among patients, the invariable feature of the syn- a significant proportion of cases only heterozygous mudrome is the complex nephropathy that is characterized tations have been found, which suggests the occurrence by the early onset of proteinuria, which, in most cases, is of a dominant or dominant-negative effect [19, 21]. sufficient to cause nephrotic syndrome [3,4]. WTl has been found to be mutated also in some Molecular studies have revealed that DDS patients extra-renal tumours. These include acute myeloblastic, carry germline mutations of the WTl gene [5-7]. WTl promyelocytic and lymphoblastic leukemias [22, 23], encodes a zinc-finger transcription factor and was orig- multicystic peritoneal mesothelioma [24], and desmoinally isolated from within chromosome 11 pi3, a region plastic small round cell tumour [25]. involved in WTs [8, 9]. Two alternative splice sites and Several groups have reported that WTl is expressed RNA editing produce eight potential WTl mRNA iso- in the majority of human acute leukemias [26-29]. Inoue forms [10-12]. et al. [30] recently proposed that such phenomena play a WTl shows a very restricted expression in time and causative role in the development of these diseases, since location: it is present in the developing kidney, genital they were able to demonstrate that the level of WTl ridge, fetal gonads, spleen and mesothelium [13, 14]. In mRNA in hematological malignancies is at least tenaccord with these observations, WTl-nn\\ mice fail to fold that of CD34+ hematopoietic progenitor cells in develop kidneys and gonads [15]. Both the expression normal bone marrow and umbilical cord blood. This and knock-out data point to a developmental role played observation is in accord with the finding by Menssen by WTl in the terminal differentiation of kidneys and [31], who failed to find detectable levels of WTl mRNA gonads, which is consistent with the DDS phenotype. in peripheral CD34+ cells, but whose finding was not Germline mutations of WTl have also been reported confirmed by other groups [32, 33]. The involvement of Introduction

628 WTl in human hematological neoplasias is also suggested by the observation that the latter may occur as second primary tumours in WT patients [34], and are more numerous in relatives of WT children than in the general population [35]. In addition, WTl was shown to be down-regulated during myelomonocytic differentiation of HL60 cells [36], and erythroid and megakaryocytic differentiation of K562 cells [37], suggesting a role of the gene in early hematopoiesis. We previously reported the case of a six-year-old boy affected with DDS, who developed disseminated Burkitt's lymphoma (BL) 38 months after a kidney transplantation due to progressive renal failure [38]. Here we report the molecular characterization of WTl in this patient, with the aim of investigating the possible involvement of the gene in the development of the lymphoma. Patients and methods Case report The patient was a six-year-old boy with the features of DDS, who presented ah extradural mass 38 months after renal transplantation for progressive renal failure. No histological evidence of nephroblastoma or nephroblastomatosis was observed in the removed kidneys. The histological diagnosis of the extradural mass was of BL. This was treated according to established chemotherapy protocols, which yielded complete remission. The clinical and pathological features of DDS presentation and of the BL were previously reported [38],

Tumour samples Tumour tissues were sectioned and frozen in liquid nitrogen immediately after surgery, and stored at - 8 0 °C. Frozen specimens were histologically checked, and those found to be homogeneously constituted solely of tumour cells were used for nucleic acid extraction.

DNA analysis Polymerase chain reaction (PCR) amplifications of WTl exons was performed using primers previously described (for exons 2, 5,6 [21]; for exons 3, 4 [39]; for exons 7-10 [40]). The amplification products were

T

C G

A

Figure 1. Constitutional missense mutation at 1177 codon 396. Sequence analysis of exon 9 shows the G to A transition.

column purified (QIAquick PCR purification kit, Quiagen) and sequenced in both directions by the chain-termination method, using the AmpliCycle® sequencing kit (Perkin Elmer) and a 33 P-dATP. Sequencing reactions were electrophoresed on 6% denaturing polyacrylamide gels at 45W for three to four hours. Gels were dried and exposed to autoradiography. DNA extraction from peripheral blood leukocytes (PBL) and tumour tissue as well as Southern blot analysis was performed as previously described [41]. Following EcoRl digestion, the DNA obtained from tumour tissue and PBL was hybridized with the 1.8 Kb-EcoRI fragment derived from the WTl cDNA clone WT33 [8]. Wmfl, filial, Taql, Maell and ApaLl restriction fragment length polymorphisms (RFLPs) at the WTl locus were analysed by PCRmediated DNA amplification, followed by enzymatic digestion, as described [42-44], The microsatellite marker associated with the WTl locus [42] was amplified by PCR and analysed on ethidium bromidestained non-denaturing 6% polyacrylamide gel, as previously described [45].

Expression analysis Total RNA was purified from tumour tissues and cell lines by extraction with a 14-M solution of guanidine salts and urea and phenol purification, followed by ethanol precipitation. RNA preparations were checked by agarose gel electrophoresis and analysed by reverse transcription-PCR (RT-PCR). One ug of RNA was used for random primed cDNA synthesis with the GeneAmp RNA PCR Core kit (Perkin Elmer). Amplification of the WTl zinc finger domain from cDNA was performed by two rounds of PCR. The first round was performed with a forward primer (ATGTGCGACGTGTGCCTGGA) located outside the zinc finger motif on exon 7 and a reverse primer (GCTGCCTGGGACACTGAACGG) located in exon 10, 17 bp 5' of the stop codon [31]. For the second round, two nested primers (GACGTGTGCCTGGAGTAGCCCC and GTCCCCGAGGGAGACCCC) were employed. One ul of cDNA synthesis reaction was added to 19 ul of PCR mix containing 0.2 uM of the first set of primers, 200 uM of each dNTP, 1.5 mM MgCl 2 , and one unit of Taq DNA polymerase (Perkin Elmer). PCR was performed as follows: one cycle at 95 °C for two min, followed by 35 cycles at 95 °C for 30 s, 55 °C for 60 s, 72 °C for 90 s, and a final cycle at 72 °C for 10 min. One ul of a 1:10 dilution of the first amplification reaction was added to 19 ul of PCR mix containing the nested primers. Amplification was performed as follows: one cycle at 95 C for two min, followed by 35 cycles at 95 =C for 30 s, 60 °C for one min, 72 C for one min, and a final cycle at 72 C for 10 min. Amplification products were electrophoresed on a 2% agarose gel and stained with ethidium bromide. The integrity of cDNA preparations was verified through amplification of the P-actin gene. For each sample, two independent sets of RT-PCR were performed, each time repeating both the cDNA synthesis and the amplification reaction.

Results Direct sequencing of exons 2 to 10 of the WTl gene from PBL and BL DNAs of the DDS patient disclosed the presence of a constitutional heterozygous point mutation leading to a G to A transition at position 1186 in exon 9 (Figure 1). This base change caused an amino-acid change from aspartate to asparagine at codon 396. No additional nucleotide changes were observed in either constitutional or tumour DNAs. Southern blot analysis of £coRI-digested germline and tumour DNAs probed with a WTl cDNA fragment evidenced normal patterns of hybridization in both (data not shown).

629 ysis and Southern blotting failed to reveal any additional nucleotide change or gene rearrangement affecting the WTl gene in BL cells. In addition, we were unable to 1 2 3 4 5 6 c M 1 2 3 4 5 6 c verify whether the constitutionally wild-type allele was lost in BL DNA, since the patient was homozygous at all six PKry-associated polymorphic loci tested. However, the banding patterns of sequence analyses suggested that the mutation was heterozygous in both germline and tumour DNA. It has been suggested that the products of some WTl mutated alleles may mediate tumourigenesis by binding the wild-type WTl protein and inhibiting its transcriptional properties [50], or by competing for a still unidentified nuclear factor [51]. However, such a dominant negative activity cannot be invoked in the present case, Figure 2. PCR amplifications of WTl (panel A) and P-actin (panel B) since it was found that the tumour did not express the cDNA. Lanes \-4, four different BL cases; lane 5, BL from the DDS WTl gene. This finding also rules out other proposed patient; lane 6, K562 cell line, that was used as positive control for WTl expression; C, no RNA: M, molecular weight marker, X174 W77-mediated mechanisms leading to DDS phenotype DNA/fa
B

630 Acknowledgements This work was partially supported by grants from the Italian Association for Cancer Research (A.I.R.C.) and Associazione B. Garavaglia. The authors thank Mrs. Donata Penso for technical assistance, Mr. M. Azzini for preparing the figures and Mrs. A. Grassi and Miss C. Mazzadi for secretarial assistance.

References 1. Denys P, Malvaux P, Van Den Berghe H et al. Association d'un syndrome anatomo-pathologique de pseudohermaphrodisme masculin, d'une tumeur de Wilms, d'une nephropathie parenchymateuse et d'un mosaicisme XX/XY. Arch Fr Pediatr 1967; 24: 729-39. 2. Drash A, Sherman F, Hartmann VVH, Blizzard RM. A syndrome of pseudohermaphroditism, Wilms' tumor, hypertension, and degenerative renal disease. J Pediatr 1970; 76: 585-93. 3. Habib R, Loiret C. Gubler MC et al. The nephropathy associated with male pseudohermaphroditism and Wilms tumour (Drash syndrome). A distinctive glomerular lesion-report of 10 cases. Clin Nephrol 1985; 24: 269-78. 4. Jadresic L, Leake J, Gordon I et al. Clinicopathologic review of twelve children with nephropathy, Wilms tumour, and genital abnormalities (Drash syndrome) J Pediatr 1990; 117: 717-25 5. Pelletier J, Bruening W, Kashtan CE et al. Germline mutations in the Wilms' tumor suppressor gene are associated with abnormal urogenital development in Denys-Drash syndrome. Cell 1991; 67437-47. 6. Baird PN, Santos A, Groves N et al. Constitutional mutations in the WT1 gene in patients with Denys-Drash syndrome. Hum Mol Genet 1992; 1:301-5. 7. Coppes MJ, Liefers GJ, Higuchi M et al. Inherited WT1 mutation in Denys-Drash syndrome. Cancer Res 1992; 52: 6125-8. 8. Call KM, GlaserT, Ito CYet al. Isolation and characterization of a zinc finger polypeptide gene at the human chromosome II Wilms' tumor locus. Cell 1990; 60: 509-20. 9. Gessler M, Poustka A, Cavenee W et al. Homozygous deletion in Wilms tumours of a zinc-finger gene identified by chromosome jumping. Nature 1990; 343: 774-8. 10. Haber DA, Sohn RL, Buckler AJ et al. Alternative splicing and genomic structure of the Wilms tumor gene WT1. Proc Natl Acad Sci USA 1991; 88: 9618-22. 11. Brenner B, Wildhardt G, Schneider S, Royer-Pokora B. RNA polymerase chain reaction detects different levels of four alternatively spliced WT1 transcripts in Wilms' tumors. Oncogene 1992; 7: 1431-3. 12. Sharma PM, Bowmann M, Madden SL et al. RNA editing in the Wilms' tumor susceptibility gene WT1. Genes Dev 1994; 8: 720-31. 13. Pritchard-Jones K, Fleming S, Davidson D et al. The candidate Wilms" tumour gene is involved in genitourinary development. Nature 1990; 346: 194-7. 14. Armstrong JF, Pritchard-Jones K, Bickmore WA et al. The expression of the Wilms' tumour gene, WT1. in the developing mammalian embryo. Mech Dev 1992; 40: 85-97. 15. Kreidberg JA, Sariola H. Loring JM et al. WT1 is required for early kidney development. Cell 1993; 74: 679-91. 16. Pelletier J. Bruening W, Li FP et al. WT1 mutations contribute to abnormal genital system development and hereditary Wilms' tumour. Nature 1991: 353: 431-4. 17. Kaplinsky C, Ghahremani M, Frishberg Yet al. Familial Wilms' tumor associated with a WT1 zinc finger mutation. Genomics 1996:38:451-3. 18. Huff V. Haber D, Call KM et al. Evidence for WT1 as a Wilms' tumor (\VT) gene: intragenic germinal deletion in bilateral WT. Am J Hum Genet 1991:48: 977 1003.

19. Little MH, Prosser J, Condie A et al. Zinc finger mutations within the WT1 gene in wilms' tumor patients. Proc Natl Acad Sci USA 1992,89:4791-5. 20. Little M, Wells C A clinical overview of WT1 gene mutations. Hum Mutat 1997; 9: 209-25. 21. Varanasi R. Bardeesy N, Ghahremani M et al. Fine structure analysis of the WT1 gene in sporadic Wilms tumors. Proc Natl Acad Sci USA 1994; 91: 3554-8. 22 Pritchard-Jones K, Renshaw J. King-Underwood L. The Wilms tumour (WT1) gene is mutated in a secondary leukaemia in a WAGR patient. Hum Mol Genet 1994; 3: 1633-7. 23. King-Underwood L, Renshaw J. Pritchard-Jones K. Mutations in the Wilms' tumor gene WT1 in leukemias. Blood 1996; 87: 2171-9. 24. Park S, Schalling M, Bernard A et al. The Wilms tumour gene WT1 is expressed in murine mesoderm-denved tissues and mutated in a human mesothelioma. Nature Genet 1993; 4: 415-20. 25. Ladanyi M, Gerald W. Fusion of the EWS and WT1 genes in the desmoplastic small round cell tumor. Cancer Res 1994; 54: 2837-40. 26. Miwa H, Beran M, Saunders GF. Expression of the Wilms' tumor gene (WTI) in human leukemias. Leukemia 1992; 6: 405-9. 27. Miyagi T, Ahuja H, Kubota Tet al. Expression of the candidate Wilm's tumor gene, WTI, in human leukemia cells. Leukemia 1993; 7: 970-7. 28. Brieger J, Weidmann E, Fenchel K et al. The expression of the Wilms' tumor gene in acute myelocytic leukemias as a possible marker for leukemic blast cells. Leukemia 1994; 8. 2138-43. 29. Inoue K, Sugiyama H, Ogawa H et al. WTI as a new prognostic factor and a new marker for the detection of minimal residual disease in acute leukemia. Blood 1994; 84: 3071-9 30. Inoue K, Ogawa H, Sonoda Y et al. Aberrant overexpression of the Wilms tumor gene (WTI) in human leukemia Blood 1997; 89: 1405-12. 31. Menssen HD, Renkl HJ, Rodeck U et al. Presence of Wilms' tumor gene (wtl) transcripts and the WTI nuclear protein in the majority of human acute leukemias. Leukemia 1995; 9: 1060-7. 32. Fraizer GC, Patmasiriwat P, Zhang X, Saunders GF. Expression of the tumor suppressor gene WTI in both human and mouse bone marrow. Blood 1995; 86: 4704-6. 33. Maurer U, Weidmann E, KarakasTet al. Wilms tumor gene (wtl) mRNA is equally expressed in blast cells from acute myeloid leukemia and normal CD34+ progenitors Blood 1997; 90: 4230-2. 34. Moss TJ, Strauss LC, Das L, Feig SA Secondary leukemia following successful treatment of Wilms' tumor. Am J Pediatr Hematol Oncol 1989, II: 158-61. 35. Hartley AL, Birch JM, Harris M et al. Leukemia, lymphoma, and related disorders in families of children diagnosed with Wilms' tumor. Cancer Genet Cytogenet 1994; 77: 129-33. 36. Sekiya M, Adachi M, Hinoda Yet al. Downregulation of Wilms' tumor gene (wtl) during myelomonocytic differentiation in HL60 cells. Blood 1994: 83: 1876-82. 37. Phelan SA, Lindberg C, Call KM. Wilms' tumor gene. WTI, mRNA is down-regulated during induction of erythroid and megakaryocytic differentiation of K562 cells. Cell Growth Differ 1994; 5: 677-86. 38 Ferrari A. Perotti D, Giardini R et al. Disseminated Burkitt's lymphoma after kidney transplantation: A case report in a boy with Drash syndrome J Pediatr Hematol Oncol 1997: 19: 151-5. 39. Nordenskjold A. Friedman E. Sandstedt B et al. Constitutional and somatic mutations in the WTI gene in Wilms' tumor patients. IntJ Cancer 1995; 63: 516-22. 40. Baird PN. Groves N. Haber DA et al. Identification of mutations in the WTI gene in tumours from patients with the WAGR syndrome. Oncogene 1992; 7: 2141-9. 41. Radice P. Pierotti MA. Lacerenza S et al. Loss of heterozygosity in human germinal tumors. Cytogenet Cell Genet 1989; 52: 72-6. 42. Haber DA, Buckler AJ. GlaserTet al. An internal deletion within an 11 pi 3 zinc finger gene contributes to the development of Wilms' tumor. Cell 1990: 61: 1257-69. 43. Hoban PR, Kelsey AM. Hinfl polymorphism within the 3' un-

631

44. 45.

46.

47.

48.

49.

50.

51.

52.

53.

54

translated region of the candidate Wilms tumour gene. Nucleic Acids Res 1994; 19: 1164. Tadokoro K, Oki N, Sakai A et al. PCR detection of nine polymorphisms in the WT1 gene. Hum Mol Genet 1993: 2: 2205-6. Watkins C, Warne D, Kelsell D et al. The use of PCR and ethidium bromide staining to detect length variation in short repeat units. Technique - A Journal of Methods in Cell and Molecular Biology 1991: 3 (4): 175-8. Little MH, Williamson KA. Mannens M et al. Evidence that WT1 mutations in Denys-Drash syndrome patients may act in a dominant-negative fashion. Hum Mol Genet 1993; 2: 259-64. Nordenskjold A, Friedman E, Anvret M. WT1 mutations in patients with Denys-Drash syndrome: A novel mutation in exon 8 and paternal allele origin. Hum Genet 1994; 93: 115-20. Little M. Holmes G, Bickmore Wet al. DNA binding capacity of the WT1 protein is abolished by Denys-Drash syndrome WT1 point mutations. Hum Mol Genet 1995; 4: 351-8. Borel F, Barilla KC, Hamilton TB et al. Effects of Denys-Drash syndrome point mutations on the DNA binding activity of the Wilms' tumor suppressor protein WT1. Biochemistry 1996; 35: 12070-6. Reddy JC, Morris JC, Wang J et al. WT1 -mediated transcnptional activation is inhibited by dominant negative mutant proteins. J Biol Chem 1995; 270: 10878-84. Wang ZY, Qiu QQ, Gurneri M et al. WT1, the Wilms' tumor suppressor gene product, represses transcription through an interactive nuclear protein. Oncogene 1995; 10: 1243-7. Bruening W, Bardeesy N, Silverman BL et al. Germline intronic and exonic mutations in the Wilms' tumour gene (WT1) affecting urogenital development. Nature Genet 1992; 1: 144-8. Konig A, Jakubiczka S, Wieacker P et al. Further evidence that imbalance of WT1 isoforms may be involved in Denys-Drash syndrome. Hum Mol Genet 1993; 2: 1967-8. Haber DA, Park S, Maheswaran S et al. WTl-mediated growth

55.

56.

57.

58.

59. 60.

suppression of Wilms tumor cells expressing a WT1 splicing variant. Science 1993; 262: 2057-9. Hanto DW. Frizzera G, Purtilo DT et al. Clinical spectrum of lymphoproliferative disorders in renal transplant recipients and evidence for the role of Epstein-Barr virus. Cancer Res 1981; 41: 4253-61. Ho M, Jaffe R. Miller G et al. The frequency of Epstein-Barr virus infection and associated lymphoproliferative syndrome after transplantation and its manifestations in children. Transplantation 1988; 45: 719-27. Knowles DM, Cesarman E. Chadburn A et al. Correlative morphologic and molecular genetic analysis demonstrates three distinct categories of posttransplantation lymphoproliferative disorders. Blood 1995; 85: 552-65. Hewitt SM. Hamada S, McDonnell TJ et al. Regulation of the proto-oncogenes bcl-2 and c-myc by the Wilms' tumor suppressor gene WT1. Cancer Res 1995; 55: 5386-9. Evans GI,Wyllie AH, Gilber CS et al. Induction of apoptosis in fibroblasts by c-myc protein. Cell 1992; 69: 119-28. Pelicci PG, Knowles DM 2d, Magrath I, Dalla-Favera R. Chromosomal breakpoints and structural alterations of the c-myc locus differ in endemic and sporadic forms of Burkitt's lymphoma. Proc Natl Acad Sci USA 1986; 83: 2984-8.

Received 27 October 1997; accepted 2 February 1998. Correspondence to: Paolo Radice, PhD Division of Experimental Oncology A Istituto NazionaleTumori via Venezian 1 20133 Milan Italy E-mail, [email protected]