Non-lethal molecular diagnostic for acanthocephalosis in Colossoma macropomum

Journal Pre-proof Non-lethal molecular diagnostic for acanthocephalosis in Colossoma macropomum

Fernanda Pinheiro da Cunha, Arthur Cássio de Sousa Cardoso, Juan Antonio Ramirez Merlano, Bruna Félix da Silva Nornberg, Luis Fernando Marins, Gabriela Tomas Jerônimo, Daniela Volcan Almeida PII:

S0044-8486(19)32589-X

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734860

Reference:

AQUA 734860

To appear in:

aquaculture

Received date:

1 October 2019

Revised date:

4 December 2019

Accepted date:

13 December 2019

Please cite this article as: F.P. da Cunha, A.C. de Sousa Cardoso, J.A.R. Merlano, et al., Non-lethal molecular diagnostic for acanthocephalosis in Colossoma macropomum, aquaculture (2019), https://doi.org/10.1016/j.aquaculture.2019.734860

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Non-Lethal Molecular Diagnostic for Acanthocephalosis in Colossoma macropomum Fernanda Pinheiro da Cunha a, Arthur Cássio de Sousa Cardoso a,b, Juan Antonio Ramirez Merlanoa,d, Bruna Félix da Silva Nornberg b, Luis Fernando Marinsb, Gabriela Tomas Jerônimoc , Daniela Volcan Almeida a,b,* a

Aquaculture Postgraduate Program, Nilton Lins University and Amazon National

Research Institute of Amazon, Manaus, AM, Brazil b

Laboratory of Molecular Biology, Institute of Biological Sciences, Federal University

of Rio Grande - FURG, Rio Grande, RS, Brazil c

Federal University of Amazonas, Manaus, AM, Brazil

d

oo

f

Llanos University. Aquaculture Institute. Villavicencio, Colombia

* Author for correspondence: D.V. Almeida. Postgraduate Program in Physiological

pr

Sciences. Federal University of Rio Grande - FURG, Institute of Biological Sciences,

Pr

e-

Av. Itália, Km 8, 96201-900, Rio Grande, RS, Brazil. E-mail: [email protected]

Abstract The tambaqui C. macropomum is intensively produced in aquaculture and is

Neoechinorhynchus

buttnerae

infection.

The

conventional

diagnosis

of

rn

by

al

subject to numerous parasitosis, such as acanthocephalosis, a parasitosis caused

acanthocephalosis is performed through fish euthanasia, which brings economic loss

Jo u

for fish farmers and poor efficiency in managing disease prevention. Thus, in this study, was proposed the use of molecular tools to develop a nonlethal diagnosis method for acanthocephalosis. For this, a partial gene sequence of the 18S ribosomal RNA gene of N. buttnerae was isolated, and specific primers were designed for the detection of parasite DNA presence in the host’s blood by quantitative polymerase chain reaction (qPCR). Infected and uninfected fish were submitted to molecular diagnosis by qPCR, which showed 84% efficiency, 100% specificity and 50% sensitivity. The identification of false negatives led to histopathological analysis. These analyses confirmed the impairment of intestinal structures and the presence of inflammatory response, specific features of acanthocephalosis lesions. Also, gene expression analysis of RAG2 (Recombination Activating Gene) and MALT1 (Mucosa-associated Lymphoid Tissue Lymphoma Translocation) showed a decrease in parasitized fish, demonstrating that the host 1

Journal Pre-proof immune system was compromised. Thus, evidence that it is possible to diagnose non-lethally, by qPCR, the presence of the parasite N. buttnerae from blood samples taken from its host C. macropomum were generated. Experimental alternatives, however, should be improved to increase the sensitivity of the method. Keywords: Acanthocephalan, Amazon fish, histopathology assay, parasitosis, RT-

Jo u

rn

al

Pr

e-

pr

oo

f

qPCR, tambaqui.

2

Journal Pre-proof Introduction The tambaqui (Colossoma macropomum) is the main native fish species farmed in Brazil. It is an endemic fish from the Amazon rainforest and is the second largest freshwater fish in the world, weighing up to 30 kg. The aquaculture production of this fish is widely exploited due to its morphological features and for supporting physicochemical variations in water such as low oxygen concentration, high levels of ammonia, and variations in temperature and pH. Given these advantages, the farming of this species is being intensified. Factors such as nutrition and sanitary management, however, are still neglected, allowing for the occurrence

oo

f

of acanthocephalosis (Valladão et al., 2019).

The acanthocephalan parasite Neoechinorhynchus buttnerae (Gólvan, 1956) is responsible for acanthocephalosis, infection that affects the tambaqui and triggers

pr

economic losses in fish production. Its presence in the aquaculture was first

e-

documented by Malta et al. (2001) in the Amazon but is now already found in three more states in northern Brazil (Jerônimo et al. 2017; Pereira and Morey 2018). The

Pr

parasite attaches in the host intestine reducing the nutrient uptake area (Matos et al., 2017), causing cachexia, and heterogenous population in the fish farms. This

al

negatively impacts the production yield (Jerônimo et al., 2017), since infected fish continue to feed, but the zootechnical performance is unsatisfactory (Silva-Gomes et

rn

al., 2017). The pathogenesis related to acanthocephalosis occurs mainly as a result

Jo u

of the deep penetration of the parasite proboscis (Taraschewski, 2000), causing damage to the intestinal wall of these animals. Intestinal endoparasites can release substances that are recognized by T lymphocytes present in mucosa-associated lymphoid tissue (MALT), which are located in areas prone to contact with antigens that enter the mucosa of the intestinal epithelium (Dezfuli et al., 2016). Changes in immune responses are an important factor in detecting the presence of parasitosis. The conventional diagnosis of acanthocephalosis is performed by fish euthanasia, in which the intestine is removed to determine the presence or absence of the parasite (Noga, 2010). This process can cause losses in aquaculture, especially in a fish hatchery, and does not allow the detection of the parasite in other substrates, such as the water from the fish ponds, for example. Molecular

biology

tools

assisted

in

advancing

the

knowledge

of

physiopathology and parasite-host relationship, allowing for improved methods of 3

Journal Pre-proof diagnosis e disease control in fish (Cunningham, 2002). Detection of biomolecules, such as DNA, can increase the sensitivity and specificity of conventional diagnosis, allowing for pathogen detection in asymptomatic fish, as well as detection at an early stage of the pathology, which increases treatment efficiency. Molecular techniques have already been used to diagnose different species of fish pathogens, such as myxozoa in Clarias batrachus (see Abidi et al., 2015), Aeromonas hydrophila in Oreochromis niloticus (see Sebastião et al., 2018), and the helminth Dawestrema in Arapaima gigas (see Serrano-Martínez et al., 2016). EkHuchim et al. (2012) detected the presence of monogenean Cichlidogyrus spp. in the

oo

f

mucosa of tilapia O. niloticus by PCR, and highlighted the feasibility of developing safer and less invasive methods for the detection of parasitic diseases. The transfer of genetic information between pathogen-host allows the use of molecular tools and

pr

is a strategy for detection of infection at an early stage, allowing more efficient

e-

prophylactic actions.

This study aiwed to use molecular tools as a strategy for a non-lethal

Pr

diagnosis of acanthocephalosis caused by N. buttnerae in C. macropomum.

rn

Sample collection

al

Material and methods

Jo u

All assays were performed with the approval of the Animal Use Ethics Committee (CEUA/UNINILTON 008/2018). A total of 120 of tambaqui fish were collected (average weight 125,97 g ± 68,91), with equal distribution between the infected group (n=60) and the control group (n=60). The infected fish were obtained from commercial fish farms with infection prevalence, and the control group fish were obtained from commercial fish farms with no infection occurrence. The fish farms are located in the State of Amazonas, Brazil (2° 44' 0,55" S 59°47'14,95" O e 2°40' 23,61" S 59° 28' 41,23" O). All fish were previously anesthetized with eugenol (20 mg L -1) for blood collection by caudal puncture with EDTA-containing syringes (for molecular analysis). Subsequently, the weight (g) and size (cm) of these fish were recorded for condition factor analysis.

4

Journal Pre-proof Parasitological analysis After blood sample and biometric data collection, the fish were euthanized with eugenol (200 mg

L-1

) to remove the intestines that were immediately fixed in

10% buffered formalin, and subsequently hydrated in 70% ethanol for parasitological analysis. The intestines were excise and parasite counting was performed using a stereomicroscope. The parasite prevalence index and mean intensity were calculated as described by Bush et al. (1997). Histopathological analysis

oo

f

Ten intestinal samples of each group were previously fixated in 10% buffered formalin, then dehydrated in ethanol solution in ascending concentrations (70, 95 and 100%), followed by diaphanization in a xylol / ethanol (1:1) bath, followed by two

pr

xylene baths, and embedded in paraplast at 60°C. The 5 μm thick sections were

e-

stained with hematoxylin-eosin (HE).

Histochemical analysis was performed with Histokit EasyPath® following the

Pr

manufacturer’s protocol. The slides were diaphanized with xylol, then Alcian blue pH 2,5 was added. Subsequently, periodic acid, Schiff reagent and Carazzi’s

with

distilled

al

hematoxylin were added, and all procedures were combined with a washing step water. Samples

were

dehydrated

with ethanol in ascending

rn

concentrations and the slide assembly was performed with ERV-MOUNT medium.

digital camera.

Jo u

The images were captured with Olympus® BH-2 microscopy with attached

Molecular analysis

Partial isolation of 18S rRNA gene from Neoechinorhynchus buttnerae Isolation of the 18S ribosomal gene from the parasite Neoechinorhynchus buttenerae was performed using the RACE 3’ technique. First, primers 1 and 2 were designed (Table 1) based on 11 sequences available at GenBank from species of the genus Neoechinorhynchus. Primers were designed in the consensus region using the software Primer3. Total RNA was prepared with Trizol reagent (Invitrogen, Brazil) and purified with RNAse free DNAse I (Invitrogen, Brazil), following the manufacturer’s protocol. For cDNA synthesis, 2 μg of total RNA was reverse-transcribed using a High Capacity cDNA Reverse Transcription Kit (Invitrogen, Brazil). The cDNA obtained 5

Journal Pre-proof was used as a template for gene amplification using primers 1 and 2 (Table 1). The PCR conditions were: initial denaturation at 94˚C for 2 minutes, followed by 35 denaturation cycles at 94 ˚C for 1 minute, 55 ˚C for 1 minute, 72 ˚C for 1 minute, and final extension at 72 ˚C for 10 minutes. After the verification of DNA amplification in 1% agarose gel electrophoresis, the PCR product was purified (PureLink™ PCR Purification Kit®, Invitrogen) and sequenced by the Sanger method with the AB 3500 platform (Applied Biosystems). From the sequencing result, specific primers were design and the partial isolation of the 18S ribosomal gene was performed. The combination of primer 1

f

(Table 1) and the “Universal Amplification primer” UAP2 was used, and the PCR

oo

condition were: initial denaturation at 94˚C for 2 minutes, followed by 35 denaturation cycles at 94 ˚C for 1 minute, ligation at 55 ˚C for 1 minute, extension at 72 ˚C for 1

pr

minute, followed by a final extension at 72 ˚C for 10 minutes. After verification of

e-

DNA amplification by 1% agarose gel electrophoresis, the PCR product was purified (PureLink™ PCR Purification Kit®, Invitrogen) and sequenced by the Sanger method

Pr

using the AB 3500 platform (Applied Biosystems).

al

Detection of parasite DNA in fish blood by qPCR DNA extraction from the C. macropomum blood and the carapace of C.

rn

macropomum was performed following the protocol by Sambrook et al., (1989). First,

Jo u

all extracted DNA were qualitatively analyzed by 1% agarose gel electrophoresis and quantified using the spectrophotometer BioDrop Duo®. The samples that presented a 260:280nm ~2.0 ratio were analyzed for the expression of the tambaqui 18S gene by qPCR, with the primer pair 5 and 6 (Table 1). Only the samples that presented amplification until cycle 30 were selected to detect the presence of parasite DNA. For diagnosis purposes, combinatorial assays were performed with specific primers designed based on the result of the 18S rRNA partial gene isolation. The primers with the best efficiency were primers 3 and 4 (Table 1). All primers used in this study had their efficiency analyzed with a cDNA serial dilution curve. Only primers that showed efficiency above 95% were used in this study. All the qPCR reactions were performed following the protocol suggested for the GoTaq® qPCR Master Mix kit (Promega Corporation. Madison, USA). The qPCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes followed by 50 denaturation

6

Journal Pre-proof cycles of 95°C for 15 seconds and ligation at 45 °C for 15 seconds. The ABI 7500 System platform was used (Applied Biosystems, Brazil). As a positive control, N. buttnerae DNA was used, and as negative control the DNA extracted from the acanthocephalan-free tambaqui fin was used. RT-qPCR assays for the expression of MALT and RAG2 genes For the analysis of expression of the Mucosa-Associated Lymphoid Tissue (MALT) gene and the Recombination Activation Gene 2 (RAG2), primers were designed based on the GenBank sequences with Access Numbers KT336203.1 and

oo

f

HQ420873.1, respectively (MALT primers 7 and 8 and RAG2 primers 9 and 10, Table 1). The cDNAs (n=10) were obtained as described previously and used as a template for gene amplification following the GoTaq® qPCR Master Mix protocol

pr

(Promega Corporation. Madison, USA). The conditions were: 50°C for 2 minutes,

e-

95°C for 2 minutes, followed by 50 denaturation cycles of 95°C for 15 seconds and ligation at 55 °C for 15 seconds. The qPCR was conducted in the ABI 7500 System

Pr

platform (Applied Biosystems, Brazil). Duplicates of each sample were used, and the target gene expression was normalized by the tambaqui housekeeping gene 18S

rn

Statistical analysis

al

(primer 5 and 6, Table 1).

Jo u

The gene expression data were compared by the Student T Test and the normal distribution was verified by the Shapiro-Wilk test. The relative gene expression results were calculated by the 2-(ΔΔCt) method described by Pfaffl (2011). Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), efficiency and Receiver Operating Characteristic Curve (ROC) results were obtain using the conventional diagnostic as the gold standard. The conventional and molecular diagnosis were compared by the chi-square test, with a confidence interval of 5%. Weight and length data were used to calculate the relative condition factor (Kn). Standard length (Ls) in cm and total weight (Wt) in g of each fish were adjusted to a weight-length curve by the formula: Wt = a.Lsb. With the coefficients a and b of the equation, the estimated weight values (We) were calculated with the relative condition factor (Kn) corresponding to a quotient between the observed and expected weight to each correspondent length (Kn = Wt/We).

7

Journal Pre-proof Table 1- Primer sequences for the parasite Neoechinorhynchus buttnerae and the Amazonian fish Colossoma macropomum used in this work. Primer

Sequence

Species

1

18S – For1

CTGGTTCCTGCCAGTAA

Neoechinorhynchus buttnerae

2

18S – Rev1

GAAGCTCACGCAATGCTGTA

Neoechinorhynchus buttnerae

3

18S – For2

GAGGGACAAGTGTCGTGAGG

Neoechinorhynchus buttnerae

4

18S – Rev2

TTCCCTGTTCCTTTCGGAGC

Neoechinorhynchus buttnerae

5

18S – For3

CGGCGGCGTTACAACAAAG

Colossoma macropomum

6

18S – Rev3

GCTTTGCAACCATACTCCCC

Colossoma macropomum

7

MALT - Forward

CTC TGG CCC GAC GGT TC

8

MALT - Reverse CAGGATTGTCACCTTTGCTCAG

9

RAG2 - Forward

CTGCGTGCCATCTCATTCTC

Colossoma macropomum

10 RAG2 - Reverse

TACCTTCGGGACTCACAATG

Colossoma macropomum

e-

pr

oo

f

N.

Colossoma macropomum

Pr

Results

Colossoma macropomum

Parasitic analysis

al

The conventional diagnosis was performed in the 120 fish collected (60 of the infected group and 60 of the control group). In the infected group, the prevalence

rn

was of 100% and the mean intensity 290,0 (± 88,8), while in the uninfected group the

Jo u

prevalence and the intensity were zero. A total of 17398 parasites were found in the intestines of the 60 infected fish analyzed. Parasitic analysis confirmed that the groups were suitable for subsequent molecular diagnosis analysis. Condition factor Regarding the condition factor, no significant difference was found between the infected group (Kn=1,054 ±0,087) and the control group (Kn=1,036 ±0,062). The intensity of parasite per host was not correlated with the condition factor (r=0.1014, p=0.1342) of specimens affected by acanthocephalosis (Figure 1). Molecular analysis Isolation of 18S rRNA gene from Neoechinorhynchus buttnerae

8

Journal Pre-proof The gene sequence obtained from the 18S rRNA gene from N. buttnerae presented 820 bp with high similarity (82% to 100%) to the sequences of the same gene from the genus Neoechinorhynchus. The sequence was deposited at GenBank (Access n. MK659800.1). Detection of parasite DNA in fish blood by qPCR Detection of parasite DNA in the host’s blood was performed by qPCR with specific primers design based on the 820 bp partial sequence. A total of 38 fish were used, distributed between the naturally infected group (n=18) and uninfected group

f

(n=20). Those who presented Ct (cycle threshold) amplification equal to or less than

oo

35 where considered positive. The qPCR (Table 2) expressed 50% of positive values for the group infected by the parasite, and 50% of false negatives. For the uninfected

pr

group, the qPCR expressed 100% of negative results, thus not presenting false

e-

positives.

Pr

Table 2 – Comparison between the conventional and the molecular diagnosis for detection of parasite Neoechinorhynchus buttnerae presence in the fish

Method

al

Colossoma macropomum.

Infected group

False Negative (%) 0 50

rn

Positive (%) 100 50

Jo u

Conventional Molecular

Non-infected group False Positive (%) 0 0

Negative (%) 100 100

qPCR assays to detect infected fish compared to conventional diagnosis The data obtained by the conventional diagnosis (gold standard) and the molecular diagnosis for both groups were compared (Table 3). The parameter data for the sensitivity diagnosis were 95%CI: 26,0-64,0, for specificity were 95%CI: 83,0100,0, Predictive Positive and Negative Values and Area Under the Curve (AUC) were of 95%CI: 0,583- 0,876. There was no significant difference between the specificity and efficiency parameters (p<0,05) among the conventional and the molecular diagnosis.

9

Journal Pre-proof Table 3- Comparison between performance parameters of molecular diagnosis and conventional diagnosis (Gold Standard) performed to detect the presence of the parasite Neoechinorhynchus buttnerae in Colossoma macropomum fish.

Diagnosis Method Molecular (% )

Sensitivity

100

50

Specificity

100

PPV

100

NPV

100

Efficiency

100

AUC

1

e-

pr

oo

f

Conventional (% )

Pr

Parameter

100 100 69 84 0,750

Histopathological analysis

al

PPV: Positive Predictive Value; NPV: Negative Predictive Value; AUC: Area Under the Curve

rn

Histological analysis of the intestines from the infected group (Figure 2) showed alterations and damage to the intestinal wall due to the presence in large

Jo u

quantity of parasites. The most frequent data were: villus compression (Figure 2B and 2C), desquamation and abrasion of the epithelium (Figure 2B), and presence of inflammatory response observed through edema (Figure 2D). These damages were not observed in the intestines of non-parasitized fish (Figure 2A). Histochemical analysis shows that the intestines of the infected group (Figure 3) have compressed villi and an increased number of globet cell as an inflammatory response (Figure 3B). The same was not found in the control group (Figure 3A). RAG2 and MALT gene expression The results from the Recombination Activating Gene (RAG2) analysis showed a 45% decrease in expression in the infected group when compared with the control group, while the Mucosa-associated Lymphoid Tissue Lymphoma Translocation

10

Journal Pre-proof (MALT1) gene showed an 80% decrease in expression in the infected group when compared with the control group (Figure 4). Discussion Parasitism is a naturally occurring relationship between different organisms, however, environmental changes may cause an imbalance and favor parasite proliferation, as with acanthocephalosis. Currently, several efforts to prevent and control N. buttnerae in the Amazonian fish C. macropomum have been carried out by researchers and fish farmers. However, there is great difficulty in controlling the

oo

f

disease, since the presence of the parasite is directly related to the availability of the intermediate host present in the aquatic environment (Lourenço et al. 2018). Once all life forms of the parasite are present in the environment, the infection becomes a

pr

recurrent problem.

e-

One of the strategies to combat parasitosis is diagnosis improvement, since the parasitism does not present clinical signs that differentiate it from other diseases.

Pr

In the study, a non-lethal diagnostic strategy for acanthocephalosis is proposed. An evaluation to determine if morphological parameters could distinguish infected from

al

uninfected fish was performed, as this would assist in the development of non-lethal parameters associated with the parasitosis. For this, was used the condition factor,

rn

which did not show a negative correlation between infected and uninfected groups,

Jo u

although the mean intensity found in this study was higher than that found by other authors (Malta et al., 2001; Jerônimo et al., 2017; Rocha et al., 2018). Similar results were found by Rocha et al. (2018), where tambaquis infected by Monogenea, Branchiura and Acanthocephala showed no negative correlation based on the condition factor, reinforcing the lack of an alternative non-lethal diagnostic. Molecular tools become an option for diagnosis of several fish diseases (Cunningham, 2002). For the performance of diagnosis by PCR, was first isolated a partial sequence from the 18S ribosomal RNA gene, which is a conserved gene widely used for the development of molecular diagnostics (Rampazzo et al.; 2017, Altay et al., 2019; Javanian et al., 2019; Lee et al, 2019). The 820 bp fragment obtained in this study expanded the possibilities for using molecular tools in diagnostic strategies, such as PCR. The species-specific primer design allowed for the performance of PCR analysis in a precise and efficient manner, as a non-lethal assay to detect the parasite DNA in the host. 11

Journal Pre-proof The molecular method proved to be a 100% specific tool, with no detection of false positives, but with 50% sensitivity, allowing the detection of false negatives probably caused by a low yield of parasite DNA. Even though the molecular method was less sensitive compared to the traditional method, where fish are euthanized, there was no significant difference between the efficiency of both methods. It is important to note that the molecular method showed an efficiency of 84%. The first concern with the identification of false negatives was if the fish considered non-parasitized were, in fact, without the presence of the parasite. Therefore, was performed a histopathological analysis of the intestines of both

oo

f

groups and confirmed that only the infected group presented damage caused by the presence of acanthocephalan, such as: compression, desquamation and abrasion of the villus, presence of inflammatory response proven by the presence of goblet cells

pr

and edema in the inner muscular layer of the intestine. Jerônimo et al. (2017) and

e-

Aguiar et al. (2018) showed evidence of the same alterations in C. macropomum affected by N. buttnerae, with a mean intensity of 293 and 267 parasites per fish,

Pr

respectively. The absence of histopathological changes in the uninfected group proves that the fish were indeed free of acanthocephalan. The pathogenesis

al

promoted by the penetration of N. buttnerae proboscis into the tambaqui intestine suggests that there is an exchange of genetic material between parasite and host,

rn

further enhancing the viability of detecting parasite DNA in the fish’s blood.

Jo u

Another result that reinforces the diagnosis is the low expression of RAG (Recombination Activating Gene) AND MALT1 (Mucosa-associated Lymphoid Tissue Lymphoma Translocation) genes in the infected group, since these genes are responsible for organizing defense receptor genes, B and T lymphocytes. It is evident that the high level of infection by N. buttnerae weakens the host immune system, suggesting that the parasite can immunosuppress the host’s immune system,

reducing

lymphocyte

proliferation

capacity, phagocytosis

activity of

macrophages, or even inducing leukocyte apoptosis (Sitjà-Bobadilla, 2018). Studies suggest that Plasmodium, Trypanosoma and Pneumocystis, for example, use antigenic variation to avoid host immune system defense (Wyse et al., 2013). In conclusion, the acanthocephalosis promoted by N. buttnerae is a parasitosis that can be considered asymptomatic in juvenile tambaqui, although it damages the intestinal wall of the fish, reducing their immune response. In order to avoid euthanasia performed by the conventional diagnosis, we evidence here that it 12

Journal Pre-proof is possible to perform a non-lethal diagnosis to detect the presence of N. buttnerae parasite in the blood of the host C. macropomum by qPCR. However, experimental

Jo u

rn

al

Pr

e-

pr

oo

f

alternatives should be improved to increase the sensitivity of the method.

13

Journal Pre-proof References Abidi, R., Fariya, N., & Chauhan, U. K. (2015). Development and standardization of PCR technique to detect myxozoan parasites and its use in identification of two exotic Myxobolus species from Indian catfish Clarias batrachus (linn.). International Journal of Fisheries and Aquatic Studies, 2(4), 374–377. Aguiar, L. S., Oliveira, M. I. B., Matos, L. V., Gomes, A. L. S., Costa, J. I., & Silva, G. S. (2018). Distribution of the acanthocephalan Neoechinorhynchus buttnerae and semiquantitative analysis of histopathological damage in the intestine of tambaqui (Colossoma macropomum). Parasitology Research, 117(6), 1689–1698.

oo

f

Altay, K., Aydin, M. F., Aytmirzakizi, A., Jumakanova, Z., Cunusova, A., & Dumanli, N. (2019). Molecular survey of hepatozoonosis in natural infected dogs: Fi rst detection and molecular characterisation of Hepatozoon canis in Kyrgyzstan. Kafkas

pr

Universitesi Veteriner Fakultesi Dergisi, 25(1), 77–81.

e-

Bush, A. o., Lafferty, K. D., Lotz, J. M., & Shostak, A. W. (1997). Parasitology meets ecology on its own terms: Margolis et al revisited. The Journal of Parasitology, 575–

Cunningham,

C.

O.

Pr

583. (2002).

Molecular

diagnosis

of

fish

and

shellfish

al

diseases: present status and potential use in disease control. Aquaculture, 206, 19– 55.

rn

Dezfuli B.S., Bosi G., DePasquale J.A., Manera M., Giari. L. (2016) Fish innate

Jo u

immunity against intestinal helminths. Fish & Shellfish Immunology 50, 274-287. Ek-Huchim, J. P., Jimenez-garcia, I., Pérez-vega, J. A., & Rodríguez-canul, R. (2012). Non-lethal detection of DNA from Cichlidogyrus spp. (Monogenea, Ancyrocephalinae) in gill mucus of the Nile tilapia Oreochromis niloticus. Diseases of Aquatic Organisms Dis Aquat Org, 98, 155–162. Javanian, M., Gorgani-Firouzjaee, T., & Kalantrai, N. (2019). Comparison of ELISA and PCR of the 18S rRNA gene for detection of human strongyloidiasis using serum sample. Infectious Diseases, 51(5):360-367. Jerônimo, G. T., Pádua, S. B. de, Belo, M. A. de A., Chagas, E. C., Taboga, S. R., Maciel,

P.

O.,

&

Martins,

M.

L.

(2017).

Neoechinorhynchus

buttnerae

(Acanthocephala) infection in farmed Colossoma macropomum: A pathological approach. Aquaculture, 469, 124–127. Lee, S. H., Moumouni, P. F. A., Galon, E. M., Vudriko, P., Liu, M., Benedicto, B., Xuan, X. (2019). Differential diagnosis and molecular characterization of Theileria 14

Journal Pre-proof spp. in sika deer (Cervus nippon) in Hokkaido, Japan. Parasitology International, 70, 23–26. Lourenço, F. S., Morey, G. A. M., Malta, J. C. O. (2018). The development of Neoechinorhynchus buttnerae (Eoacanthocephala: Neoechinorhynchidae) in its intermediate host Cypridopsis vidua in Brazil. Acta Parasitologica, 63(2) Malta, J. C. O., Gomes, A. L. S., Andrade, S. M. S., & Varella, A. M. B. (2001). Infestações maciças por acantocéfalos, Neoechinorhynchus buttnerae Golvan, 1956, (Eoacanthocephala: Neoechinorhynchidae) em tambaquis jovens, Colossoma macropomum (cuvier, 1818) cultivados na Amazônia central. Acta Amazonica, 31(1),

oo

f

133–143.

Matos, L. V., Oliveira, M. I. B., Gomes, A. L. S., & da Silva, G. S. (2017). Morphological and histochemical changes associated with massive infection by buttnerae

(Acanthocephala:

Neoechinorhynchidae) in the

pr

Neoechinorhynchus

e-

farmed freshwater fish Colossoma macropomum Cuvier, 1818 from the Amazon State, Brazil. Parasitology Research, 116(3), 1029–1037.

Pr

Noga, E. J. (2010). Fish Disease: Diagnosis and Treatment, Second Edition. In Wiley-Blackwell.

al

Pereira, J. N., & Morey, g. A. M. (2018). First record of Neoechinorhynchus buttnerae (Eoacantocephala, Neochinorhynchidae) in Colossoma macropomum

rn

(Characidae) in a fish farm in Roraima, Brazil. Acta Amazonica, 48(1), 42–45.

Jo u

Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic acids research, London, v. 29, n. 9, p. 2003–2007. Rampazzo, R. de C. P., Solcà, M. da S., Santos, L. C. S., Pereira, L. de N., Guedes, J. C. O., Veras, P. S. T., Costa, A. D. T. (2017). A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs. Veterinary Parasitology, 100–107. Rocha, M. J. S., Jerônimo, G. T., da Costa, O. T. F., Malta, J. C. de O., Martins, M. L., Maciel, P. O., & Chagas, E. C. (2018). Changes in hematological and biochemical parameters of tambaqui (Colossoma macropomum) parasitized by metazoan species. Revista Brasileira de Parasitologia Veterinaria, 27(4), 488–494. Sebastião, F. A., Lemos, E. G. de M., & Pilarski, F. (2018). Development of an absolute quantitative real-time PCR (qPCR) for the diagnosis of Aeromonas hydrophila infections in fish. Acta Scientific Microbiology, 1(4), 23–29.

15

Journal Pre-proof Serrano-Martínez, E.; Tantaleán V. M.; Quispe, H. M.; Casas, V. G.; Londoñe. P. (2016). Development of a PCR assay for the identification of the parasite Dawestrema (Trematoda: Monogenea) in Arapaima gigas fish. Revista de Investigaciones Veterinarias Del Peru, 27(3): 581–588. Silva-Gomes, A. L., Coelho-filho, J. G., Viana-Silva, W., Braga-Oliveira, M. I., Bernardino, G., & Gosta, J. I. (2017). The impact of Neoechinorhynchus buttnerae (Golvan, 1956) (Eoacanthocephala: Neochinorhynchidae) outbreaks on productive and economic performance of the tambaqui Colossoma macropomum (Cuvier, 1818), reared in ponds. Latin American Journal of Aquatic Research, 45(2), 496–

oo

f

500.

Sitjà-Bobadilla, A. (2008). Living off a fish: A trade-off between parasites and the immune system. Fish & Shellfish Immunology, 25, 358–372. H.

(2000).

Host-parasite

interactions

pr

Taraschewski,

in

Acanthocephala:

a

e-

morphological approach. Advances in Parasitology, 46, 1-179. Valladão, G. M. R., Gallani, S. U., Jerônimo, G.T., Seixas, A. T., Challenges in the of

acanthocephalosis

in

aquaculture:

Pr

control

special

emphasis

on

Neoechinorhynchus buttnerae. Reviews in Aquaculture, v. 1, p. 1-13, 2019.

al

Wyse, B. A., Oshidari, R., Jeffery, D. C. B., & Yankulov, K. Y. (2013). Parasite

Jo u

Chromatin, 6, 1–10.

rn

epigenetics and immune evasion: lessons from budding yeast. Epigenetics &

Acknowledgments

This work was supported by Brazilian CNPq (National Council for Scientific and Technological Development) (Proc. Number 432071/2018-0 and 402434/2016-1). L.F. Marins is a research fellow from CNPq/Brazil (Proc. Number 305928/2015-5). Special thanks to Professor Dr. Luis Alberto Romano and Dra. Virginia Pedrosa for helping with the histological analysis.

16

Journal Pre-proof Captions

Figure 1. Correlation of the relative condition factor (Kn) with the mean intensity (number of parasites per fish) of Neoechinorhynchus buttnerae in Colossoma macropomum (n=120).

Figure 2. Histopathology of the intestinal tissue of Colossoma macropomum and alterations due to Neoechinorhynchus buttnerae presence. A – Intestine without parasite adherence; B – Presence of parasites (arrows), obstruction and abrasion of

oo

f

epithelium (triangle) and peeling of villus (asterisk); C – Loss of epithelium width, (L: lumen); D- Parasite (dotted arrow), edema of the muscular layer (arrows).

pr

Figure 3. Histochemical staining of the Colossoma macropomum intestine with

e-

Alcian Blue 2.5 (AB). A. Fish not infected by Neoechinorhynchus buttnerae. B. Infected fish, with a positive histochemical reaction and high intensity with AB

Pr

(arrow).

al

Figure 4. Expression of the immune system genes RAG2 (Recombination Activating Gene) AND MALT1 (Mucosa-associated Lymphoid Tissue Lymphoma Translocation)

rn

in Colossoma macropomum infected by the parasite Neoechinorhynchus buttnerae.

Jo u

The data (n=10), expressed in average ± standard error, were normalized by the gene expression of the housekeeping gene 18S. Highlights   

A partial gene sequence of the 18S ribosomal gene from the parasite N. buttnerae was isolated. DNA detection of the parasite N. buttnerae in the blood of tambaqui C. macropomum was possible. Acanthocephalosis reduced gene expression from MALT1 and RAG2 immune system.

17

Figure 1

Figure 2

Figure 3

Figure 4