- Email: [email protected]
Non-replicative helicases at the replication fork
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/dnarepair
Non-replicative helicases at the replication fork Ryan C. Heller, Kenneth J. Marians ∗ Molecular Biology Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA
a r t i c l e
i n f o
a b s t r a c t
Article history:
Reactivation of stalled or collapsed replication forks is an essential process in bacteria.
Published on line 26 March 2007
Restart systems operate to restore the 5 → 3 replicative helicase, DnaB, to the laggingstrand template. However, other non-replicative 3 → 5 helicases play an important role
Keywords:
in the restart process as well. Here we examine the DNA-binding specificity of three of the
Non-replicative helicases
latter group, PriA, Rep, and UvrD. Only PriA and Rep display structure-specific fork bind-
Replication fork
ing. Interestingly, their specificity is opposite: PriA binds a leading-strand fork, presumably
DNA replication
reflecting its restart activity in directing loading of DnaB to the lagging-strand template. Rep binds a lagging-strand fork, presumably reflecting its role in partially displacing Okazaki fragments that originate near the fork junction. This activity is necessary for generating a single-stranded landing pad for DnaB. While UvrD shows little structure-specificity, there is a slight preference for lagging-strand forks, suggesting that there might be some redundancy between Rep and UvrD and possibly explaining the observed synthetic lethality that occurs when mutations in the genes encoding these two proteins are combined. © 2007 Elsevier B.V. All rights reserved.
1.
Introduction
The Escherichia coli replisome is a highly efficient machine capable of duplicating the genome with high rates of speed and high levels of processivity. Much of this ability is owed to the replicative helicase, DnaB, a hexameric-type helicase that encircles the lagging-strand template at the replication fork and translocates in the 5 → 3 direction [1] using the energy of ATP to separate the strands of the parental duplex. Though DnaB is sufficient to maintain DNA replication in vitro [2], a class of non-replicative, non-hexameric, 3 → 5 helicases is thought to aid in the maintenance of DNA replication through roadblocks in the form of bound proteins and DNA template lesions in vivo. The helicase activities of three of these proteins, PriA, Rep, and UvrD, are not essential alone, but evidence is accumulating that these proteins have important and overlapping functions in DNA replication. Along with several other components, PriA was purified based on its requirement in the reconstituted bacteriophage
∗
Corresponding author. Tel.: +1 212 639 5890; fax: +1 212 717 3627. E-mail address: [email protected] (K.J. Marians). 1568-7864/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.dnarep.2007.02.014
X174 replication reaction [3]. Lacking a direct role in cellular replication, PriA was later identified as a key factor in replisome assembly outside the origin of replication, a process that enables replication restart after fork stalling or breakage. After processing of the stalled fork or the broken chromosome, PriA utilizes its ability to recognize DNA in a structure-specific manner, binding to specific stalled forks and recombinationgenerated D-loop structures [4,5]. PriA then catalyzes the assembly of a multiprotein complex including PriB and DnaT, which together allow the loading of the replicative helicase DnaB from a DnaB–DnaC complex to single-stranded DNAbinding protein (SSB)-coated single-stranded DNA [6]. The loading of DnaB nucleates the assembly of a new replisome through protein-protein interactions with a component of the DNA polymerase III holoenzyme (Pol III HE) [7,8] and with the primase, DnaG [9]. Although PriA is a SF2 family member DNA helicase with 3 → 5 polarity [10,11], its unwinding activity is distinct from its ability to load DnaB for the replication restart process. Cells lacking PriA have a number of defects including
946
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
very low viability, slow growth, sensitivity to sources of DNA damage, and recombination defects [12–15], most of which are suppressed by providing a source of helicase-defective PriA in trans [12,15,16]. How the PriA helicase activity plays a role in maintaining genomic integrity has been a source of debate for some time. Rep helicase is a member of the SF1 superfamily, possessing intrinsic 3 → 5 helicase activity [17]. A monomer in solution, Rep was shown to dimerize upon binding DNA [18], and it has been suggested that oligomerization of Rep is required for its helicase activity [19,20]. The crystal structure of Rep bound to single-stranded DNA revealed a four subdomain architecture [21]. One of these subdomains (2B) is thought to be capable of changing orientation and was suggested to play a regulatory role in helicase activity [22]. Though Rep has been examined extensively as a model helicase for mechanistic studies, its biological role has remained elusive [23]. As with PriA, the origins of the study of Rep helicase came from its role in the replication of single-stranded DNA bacteriophages by the host machinery. In the X174 replication system, the single-stranded circular form of the phage is first converted to the duplex replicative form through the action of the multiprotein primosome and Pol III HE. After the phage encoded gene A protein introduces a nick into the duplex DNA, interaction with this protein enables Rep to utilize its 3 → 5 helicase activity to separate the strands of the duplex in a highly processive manner [24,25], allowing rolling-circle synthesis to generate a new copy of the phage DNA. Though Rep is a crucial component of a number of phage replisomes, Rep was nearly dispensable for chromosomal replication [26], and completely unnecessary for replication of oriC-containing plasmid DNA in vitro [2]. Without the X174 gene A protein, Rep displayed very low processivity, being nearly unable to unwind a fragment 343 nt in size from a partial duplex DNA structure [27], an attribute that makes Rep an unlikely candidate for supporting chromosomal replication. In contrast, the hexameric replicative helicase DnaB was demonstrated to be capable of unwinding >50 kbp of duplex DNA in a single event during a replication reaction [28]. Cells lacking Rep do not halt DNA synthesis as might be expected for a replicative helicase, although replication was shown to proceed at a reduced rate [26], and the average number of growing replication forks per cell was increased [29]. These subtle effects on DNA replication suggest that the biological role of Rep is related to the problems faced in replicating DNA in the cellular environment. One potential issue is the presence of protein–DNA complexes that are essential for promoting and regulating processes such as transcription, but may act as impediments to replication fork progression. For example, in the bacteriophage T4 replication system, a bound RNA polymerase molecule was shown to block or to slow replication, while addition of the T4 Dda helicase displaced the RNA polymerase molecule from the DNA and restored proper replication rate [30]. In E. coli, the Lac repressor protein is required for maintaining proper cellular metabolism, but severely inhibited the helicase activity of DnaB in vitro when bound to DNA [31]. Rep, on the other hand, was able to displace the bound protein and its helicase activity was unaffected, suggesting that Rep may function by aiding cellular replication in removing blocking
proteins ahead of the fork. In support of this idea, mutation of rep is lethal when combined with recB or recC mutations [32] and the amount of linear DNA increases when RecB and RecC are inactivated [33], suggesting that pauses and fork stalling leading to double-strand breaks are frequent in the rep mutant, and that these breaks are normally repaired by RecBCD. The UvrD helicase (also called helicase II) is a SF1 superfamily member, possessing approximately 40% amino acid similarity with the Rep protein. UvrD undergoes some oligomerization in solution, but the dimeric form was shown to be stabilized upon association with DNA [34]. The dimeric form is thought to be the active species for unwinding [35]. A heterodimer between Rep and UvrD was reported to form in vitro, with an energetic stability that was even higher than the Rep homodimer [36], though the biological function of such a heterodimer is unknown. Possessing intrinsic helicase activity with 3 → 5 polarity [37], UvrD was capable of initiating unwinding from regions of single-stranded DNA, and also from both nicks and blunt ends at higher enzyme concentrations [38]. Its ability to unwind duplex DNA from a discontinuity in the phosphodiester backbone underpins the role of UvrD in nucleotide excision repair (NER) and in methyl-directed mismatch repair. Sites of DNA damage are recognized by the NER proteins UvrA and UvrB, which recruit UvrC to catalyze dual incisions in the DNA at sites both 3 and 5 of the damaged region. UvrD then utilizes its helicase activity to release the excised oligomer containing the damage and to facilitate the dissociation of UvrC [39]. During the mismatch repair process, UvrD initiates unwinding at an incision that is made at an adjacent hemimethylated GATC sequence [40]. The displaced strand is then degraded by an exonuclease, thus eliminating the mispair and allowing repair synthesis to restore the duplex [40]. Consistent with its role in DNA repair, certain mutations in UvrD confer sensitivity to DNA damaging agents, and cells lacking UvrD display high levels of UV light sensitivity and exhibit a strong mutator phenotype [41]. In this study, in order to gain insight into their roles in DNA replication, the binding preferences of PriA, Rep, and UvrD were examined on a variety of partial duplex and forked structures in an effort to determine whether any of these proteins display fork structure-specific binding. In addition, the mechanism by which PriC was shown to stimulate the helicase activity of Rep [42] was examined further. Potential models for the activity of this class of 3 → 5 helicases at the replication fork are discussed.
2.
Results and discussion
2.1. PriA helicase has multiple roles in ensuring fork progression Insight into the role of PriA helicase activity in maintaining fork progression has come from both genetic and biochemical sources. Using oligonucleotides to model the fork in bacteriophage Mu strand-transfer intermediates, it was found that PriA helicase activity was capable of removing nascent DNA at the lagging-strand arm of the fork in order to expose sufficient single-stranded DNA for DnaB loading and replisome assem-
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
bly [43], possibly explaining the requirement for PriA in Mu replication. Stalled forks with this structure may be generated during chromosomal replication by a polymerase uncoupling event in which collision of the replisome with leading strandspecific lesions and continued unwinding of the parental duplex produces large gaps in the nascent leading strand DNA and a nascent lagging strand that has progressed past the blocked leading strand. Evidence for polymerase uncoupling comes from studies of the replication of damage-containing plasmids both in vitro and in vivo [44,45]. If the 5 -end of the nascent lagging strand DNA is too close to the fork junction and is obstructing DnaB loading, PriA could act to unwind a sufficient length of this DNA to allow for transfer of DnaB to the lagging-strand template of the stalled fork. In support of this hypothesis, PriA was shown to unwind the nascent lagging strand of model oligonucleotide replication forks, both in the absence and presence of SSB [42,43,46,47]. The presence of SSB was reported to suppress unwinding of the parental duplex region of these forks [47], a potentially destabilizing event. SSB was further shown to stimulate unwinding of the nascent lagging-strand DNA by PriA at fork structures via physical interaction between the two proteins [48], but was inhibitory toward unwinding of a minimal partial duplex structure [49]. Thus, unwinding by PriA under physiological conditions in the presence of SSB occurs above basal levels and is a fork-specific reaction in which activity is directed toward the nascent lagging strand. An analysis of the binding preferences of PriA for stalled fork structures was assessed using electrophoretic mobility shift assay (Fig. 1). For each structure, a progression of single-stranded tail sizes was tested in order to gauge the minimum length required for binding and to accurately determine binding preference, which should be independent of tail size. The analysis revealed two distinct mechanisms of binding for PriA. With little tail-size dependence, both forks carrying nascent leading strand oligonucleotides with 5 single-stranded tails (lead forks) and those carrying nascent lagging strand oligonucleotides with 3 single-stranded tails (lag forks) were recognized with approximately equal affinity (Fig. 1). Binding to the lag forks likely represent a mode of binding in which the single strand-double strand junction of 3 extensions is recognized, as displayed by the high affinity binding of PriA to partial duplex structures with 3 -extensions (3 -Ext). In contrast, binding to partial duplex structures with 5 -extensions (5 -Ext) was approximately 5–10-fold lower, indicating that the lead fork branched structure was recognized specifically. This conclusion is in agreement with conclusions from a previous report [5], which also demonstrated two modes of PriA binding: one to 3 extensions that is likely a manifestation of the 3 → 5 helicase activity of the enzyme and one that is a structure-specific binding of PriA to 3-strand branched structures containing a 5 -tail. The mode of structure-specific binding to lead fork structures by PriA likely reflects its ability to target these structures for DnaB loading and replication restart. High affinity binding to these structures was subsequently shown to require an interaction between the 3 -OH of the nascent leading strand at the fork junction and a domain of PriA in the N-terminal region called the 3 -terminus binding pocket [50]. Eliminating this interaction by expressing PriA binding pocket mutants in
947
Fig. 1 – PriA DNA-binding preferences. Binding reaction mixtures containing DNA structures with the indicated tail lengths and 8 nM PriA for the Ext structures, and 2 nM PriA for the fork structures where noted, were incubated and analyzed as described under Section 3. The position and identity of the structure is indicated to the right of each gel. An autoradiograph of the gels is shown in (A) and the quantitation of the data is shown in (B).
a priA null mutant did not alter the phenotype significantly for most mutants, suggesting that this mode of binding is critical for replication restart [50]. Furthermore, eliminating this mode of binding by introducing gaps between the 3 -terminus of the nascent leading strand and the fork junction was shown to reduce DnaB loading and replication restart activity on model fork structures [51]. The ability of PriA to recognize lag forks containing a 3 -tail via a distinct mode of binding provides a foundation to the observed ability of PriA to unwind nascent lagging strand DNA at model stalled forks lacking a nascent leading strand. These structures may arise from a polymerase uncoupling event and may require processing with a helicase such as PriA before restart can take place. Certain mutations in PriA that suppress the UV sensitivity defects of cells lacking RecG [52], a protein thought to catalyze the reversal of stalled forks [53], also eliminate its ability to unwind nascent lagging-strand DNA of forks lacking a nascent leading strand [46], suggesting that
948
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
these forks can normally be targeted by PriA in vivo. Furthermore, PriC was shown to efficiently target model forks with this structure for restart, but only after nascent lagging strand unwinding by PriA [42]. Indeed, PriA and PriC were shown to act together in a common genetic pathway by analysis of the restart components, and further investigation revealed that the helicase activity of PriA specifically was thought to be key for allowing restart to occur by this pathway [54,55].
2.2. Rep helicase interacts with PriC and fork structures Aside from its potential role in removing bound proteins from DNA to facilitate fork progression, recent evidence suggests that Rep may also play a role in repairing stalled forks with PriC. A distinct restart pathway that is independent of PriA was identified, based on genetic analysis, involving both the PriC and Rep proteins [54]. With the finding that PriC was capable of catalyzing the reloading of DnaB on forks with nascent leading-strand gaps independently of Rep [51], it was hypothesized that Rep could act to unwind nascent lagging strand DNA that blocks the reloading process in a manner analogous to that proposed for PriA [42]. Indeed, Rep unwinds primarily the nascent lagging strand of model stalled fork structures, and PriC was shown to stimulate the helicase activity of Rep both in the absence and presence of SSB [42], suggesting that Rep is targeted to those stalled forks that are recognized by PriC. The stimulation of Rep helicase activity by PriC was further analyzed using a template in which a 55 nt oligonucleotide was annealed to single-stranded X174 DNA, creating a forked structure due to a 5 nonhomologous segment of 25 nt on the oligonucleotide. Using this template, unwinding of the oligonucleotide by Rep was stimulated over 18-fold (Fig. 2A), confirming a previous report of stimulation [40]. That a higher concentration of PriC is required to detect stimulation in this assay is likely because this template contains excess singlestranded DNA, to which PriC can bind with relatively low affinity (data not shown). There are still several unanswered question regarding the mechanism of the observed stimulation. For example, it remains unclear whether PriC interacts directly with Rep and/or the DNA, and whether loading efficiency or the processivity is affected by PriC. To further probe the nature of the interaction, it was determined whether the activity stimulation reflects increased processivity of Rep, enabling it to more easily unwind a longer segment of DNA. To this end, the annealed oligonucleotide was elongated by the Klenow fragment of E. coli polymerase I to create an array of templates in which the size of the annealed oligonucleotide ranged from 55 to approximately 350 nt (Fig. 2B, lane 12). In the presence of Rep alone, overall unwinding levels were poor and the pattern of products revealed an inability to unwind the larger oligonucleotides even at high concentration, consistent with a low processivity enzyme (lanes 2–5). Though PriC has no detectible helicase activity on its own (lanes 9–11), the addition of PriC stimulated overall helicase activity on this template array by Rep (lanes 6–8). However, the pattern of unwinding products in which a larger proportion of smaller oligonucleotides were unwound did not change, indicating that PriC had no detectible effect
Fig. 2 – PriC stimulates Rep helicase activity, but not processivity. (A) Helicase assay reaction mixtures containing primed X174 helicase template, 5 nM Rep where noted and the indicated concentration of PriC were incubated and analyzed as described under Section 3. The position of the substrate and product are indicated to the right of the gel. An autoradiograph of the gel is shown in the left panel and the quantitation of the data is shown on the right. (B) Helicase assay reaction mixtures containing helicase template with elongated oligonucleotide and the indicated concentrations of Rep and PriC were incubated and analyzed as described under Section 3. In lane 12, template was heated at 100 ◦ C for 5 min before loading. An autoradiograph of the gel is shown in (B) and the quantitation of the data is shown in (C).
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
on the processivity of Rep. The increase in Rep unwinding activity at forked structures suggested that PriC may act as a cellular analog of the X174 gene A protein, which enables Rep to unwind the duplex DNA at the phage replication fork in a processive manner, but the lack of processivity increase by PriC suggests fundamental differences between the two interactions. In this mode of action, PriC may increase the local concentration of Rep at stalled forks, where its limited processivity may be sufficient to allow the more processive DnaB to complete chromosomal replication. Replication of the X174 chromosome, on the other hand, begins from a nicked duplex, which lacks structural features necessary for DnaB loading by either the PriA or PriC systems, and so the gene A protein may have evolved instead to impart Rep with the necessary processivity for replication. An analysis of the binding preferences for Rep showed two modes of binding to DNA structures as with PriA, but the polarity was opposite (Fig. 3). Even though the partial duplex structure with the 3 single-stranded tail (3 -Ext) was recog-
949
nized very poorly, binding to the lag fork, which possesses a 3 single-stranded tail, occurred at relatively high affinity. This striking difference in binding preference indicates that the lag fork structure is recognized specifically. The other mode of binding occurred by virtue of recognition of the single strand-double strand junction of 5 extensions, also the opposite polarity as that observed for PriA. This mode enabled recognition of both the 5 -Ext and the lead fork structure, and appears to have an optimal tail length of 10–16 nucleotides. The physical basis for this optimal binding length is not clear. The two binding modes enable Rep to recognize replication forks with different positions of nascent DNA, suggesting that the helicase activity may be used for multiple biological roles. Specific recognition of the lag fork is consistent with the ability of Rep to unwind nascent lagging-strand DNA as a prelude to DnaB loading, and is also consistent with the interaction between Rep and PriC, which operates at stalled forks lacking nascent leading strand DNA. Unfortunately, since PriA also recognizes this fork and also unwinds nascent lagging strand DNA, it is difficult to determine under which circumstances Rep or PriA would target this type of stalled fork. Overlapping function is possible though, as cells lacking Rep and PriA helicase activites display synthetic growth, viability, and morphology defects [56]. The other mode of binding, with which Rep can bind to forks without nascent lagging-strand DNA likely reflects a function that is different than the function of PriA at these forks, since Rep has not been demonstrated to play a direct role in DnaB loading. It is possible that Rep uses this mode of binding along with its ability to displace bound proteins to clear a blocking protein from the path of the replisome at a stalled or slowed replication fork. Its limited processivity would enable Rep to disengage shortly afterward, allowing processive replication to resume.
2.3. UvrD—a promiscuous helicase with roles in repair and replication
Fig. 3 – Rep DNA-binding preferences. Binding reaction mixtures containing DNA structures with the indicated tail lengths and 8 nM Rep for the Ext structures, and 2 nM Rep for the fork structures where noted, were incubated and analyzed as described under Section 3. The position and identity of the structure is indicated to the right of each gel. An autoradiograph of the gels is shown in (A) and the quantitation of the data is shown in (B).
In addition to its role in DNA repair, several lines of evidence suggest that UvrD may also play an indirect role in maintaining DNA replication. For example, UvrD, but not Rep, is required for the rolling circle replication of a Staphylococcus aureus plasmid in E. coli, likely acting as the replicative helicase [57]. UvrD also co-purifies with preparations of the DNA polymerase III holoenzyme [58], suggesting an interaction that would place UvrD at the replication fork. In addition, certain alleles of uvrD are constitutively induced for the SOS response [59], a common phenotype in cells with replication defects. Null uvrD mutants are lethal when combined with mutations in polA [60], which encodes for polymerase I and is involved in Okazaki fragment maturation, and is also lethal when combined with a rep mutation [41], suggesting some overlapping function in ensuring replication progression. It was proposed that UvrD acts at blocked replication forks by removing RecA or a structure generated by RecA in order to counter a futile reaction [61], a notion supported by the ability of UvrD to directly remove RecA nucleoprotein filaments in vitro [62], and by the elevated recombination levels in the uvrD mutant [41]. Cognizant of its role in DNA replication and potential functional overlap with the highly homologous Rep helicase, the binding preferences of UvrD to model fork and partial duplex
950
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
in DNA replication. Interestingly, it was recently reported that initial rates of unwinding by UvrD on a similar fork containing only a lagging strand were higher than nicked, partial duplex, and fork structures containing a leading strand [63], consistent with our finding of increased affinity on the lag fork structure. In addition, the primary product of the unwinding reaction resulted from the unwinding of the lagging-strand duplex, a reaction that was activated by the absence of a leading strand at the branch point [63]. Unwinding of nascent lagging strand DNA at a stalled replication fork could enable UvrD to provide single-stranded DNA on the lagging-strand arm to allow DnaB loading and replication restart in a manner analogous to that proposed for Rep and PriA. A redundancy between UvrD and the Rep-PriC restart pathway would help explain the uvrD rep synthetic lethality [41] and provide additional explanation for the indirect role of UvrD in DNA replication progression.
3.
Materials and methods
3.1.
DNAs and proteins
The PriA and PriC proteins were overexpressed in E. coli and purified as described previously. Rep helicase was prepared as described previously [64]. The UvrD protein was kindly provided by Steve Matson. The following oligonucleotides were used to prepare the structures in the binding assays:
Fig. 4 – UvrD DNA-binding preferences. Binding reaction mixtures containing DNA structures with the indicated tail lengths and 8 nM UvrD for the Ext structures, and 2 nM UvrD for the fork structures where noted, were incubated and analyzed as described under Section 3. The position and identity of the structure is indicated to the right of each gel. An autoradiograph of the gels is shown in (A) and the quantitation of the data is shown in (B).
structures were assessed (Fig. 4). The two shifted bands that are observed in those lanes where binding occurs likely represent different oligomers of UvrD bound to the DNA structure. Unexpectedly, the binding preferences to partial duplex structures more closely resembled those of PriA than those of Rep. UvrD bound to both the 5 -Ext and the 3 -Ext structures, with a preference for the 3 -Ext structure of approximately three-fold, similar to but somewhat less than the 5–10-fold difference shown for PriA. Unlike PriA or Rep however, no structurespecific fork binding was observed. The binding preferences for the fork structures essentially paralleled those observed for the partial duplex structures, with an approximately 3–5fold preference for the lag fork (possessing a 3 extension) over the lead fork (possessing a 5 extension). Although the fork structure per se is not recognized specifically, the clear binding preference of UvrD for the lag fork suggests that this structure may be related to its biological role
(1) 5 -GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAG GGCTGAGCACGCCGACGAACATTC-3 ; (2) 5 -GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAG GGCT-3 ; (3) 5 -CTCGCGCCGCAGACTCATTTAGCCCTTATCCGTATTGCGGTCTCGAGTCGCCATGGA CGGTCGACCTGTAGAAGGCTTGC-3 ; (4) 5 -AGCCCTTATCCGTATTGCGGTCTCGAGTCGCCATGGACGGTCGACCTGTAGAAGGCT TGC-3 ; (5) 5 -GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAG GGCTGAGCACGCCGACGAACATTCACCACGCCAGACCACGTA-3 ; (6) 5 -GACTATCTACGTCCGAGGCTCGCGCCGCAGACTCATTTAGCCCTTATCCGTATTGCG GTCTCGAGTCGCCATGGACGGTCGACCTGTAGAAGGCTTGC-3 ; (7) 5 -TACGTGGTCTGGCGTGGTGAATGTTCGTCGGCGTGCTC3 ; (8) 5 -AAATGAGTCTGCGGCGCGAGCCTCGGACGTAGATAGTC3 . The 5 -Ext structure with the 20 nt tail was constructed with oligonucleotides 2 and 3. Structures with shorter tail lengths were made by shortening oligonucleotide 3 from the 5 end. The 3 -Ext structure with the 20 nt tail was constructed with oligonucleotides 1 and 4. Structures with shorter tail lengths were made by shortening oligonucleotide 1 from the 3 end. The lead fork structure with the 20 nt tail was constructed with oligonucleotides 3, 5, and 7. Structures with shorter tail lengths were made by shortening oligonucleotide 3 from the 5 end. The lag fork structure
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
with the 20 nt tail was constructed with oligonucleotides 1, 6, and 8. Structures with shorter tail lengths were made by shortening oligonucleotide 1 from the 3 end. Oligonucleotides 2, 4, 5, or 6, were 5 -end labeled, annealed, and the structures were purified as described previously [51]. The primed X174 helicase template was prepared and labeled as described previously [11], except that an oligonucleotide with the sequence 5 -TGCAGACCATAGCACAGATGCTTCTAGCGATAAAACTCTGCAGGTTGGATACGCC-3 was used instead of the X-Pst1 oligonucleotide. To elongate the oligonucleotide, a series of reaction mixtures (50 l) containing 50 mM HEPESKOH (pH 8.0), 50 mM NaCl, 10 mM MgOAc2 , 10 mM DTT, 100 g/ml bovine serum albumin, 100 M dNTPs, 100 fmol of 3 -end-labeled primer-template, and 12.5 U of the Klenow fragment were incubated at 24 ◦ C for 5–65 s at 10 s intervals. Reactions were combined, phenol extracted, and spin dialyzed using Microspin G-25 columns (GE Healthcare). The oligonucleotide was elongated to a range of 55 to approximately 350 nt as determined by denaturing polyacrylamide gel electrophoresis with labeled size standards.
3.2.
Binding assay
Reaction mixtures (10 l) containing 50 mM Tris-HCl (pH 8.0), 3 mM MgCl2 , 1 mM DTT, 1 mg/ml bovine serum albumin, 0.2% Triton X-100, 6% glycerol, 1 nM DNA structure, and the indicated concentration of PriA, Rep, or UvrD were incubated at 30 ◦ C for 10 min, and then 8 l were loaded directly to 10 cm × 13 cm × 0.12 cm 7% polyacrylamide (80:1, acrylamide:bisacrylamide) gels. Gels were pre-run at 13 mA for 30 min at 4 ◦ C using 6.7 mM Tris-HCl (pH 8.0 at 4 ◦ C), 3.3 mM NaOAc, 2.0 mM MgOAc2 , 0.1 mM EDTA as the electrophoresis buffer, with constant recirculation. Electrophoresis was at 20 mA for 2.5 h with constant buffer recirculation. The gels were dried, exposed to phosphorimager screens, and autoradiographed. Quantitation was by use of a Fuji phosphorimager.
3.3.
Helicase assay
Reaction mixtures (10 l) containing 50 mM HEPES-KOH (pH 8.0), 10 mM MgOAc2 , 5 mM ATP, 40 g/ml bovine serum albumin, 2 mM DTT, 1 nM primed X174 helicase template, and the indicated concentration of Rep and PriC were incubated at 37 ◦ C for 10 min. Unwinding was terminated by the addition of EDTA, SDS, and proteinase K to 20 mM, 0.5%, and 0.2 mg/ml, respectively, followed by incubation at 37 ◦ C for 30 min. The samples were analyzed using 10 cm × 13 cm × 0.12 cm 10% or 8% (for testing processivity) polyacrylamide (29:1, acrylamide:bisacrylamide) gels. Electrophoresis was at 25 mA for 2 h using 100 mM Tris–borate (pH 8.3), 2 mM EDTA as the buffer. Gels were fixed by soaking in 10% methanol, 7% HOAc, 5% glycerol, dried, exposed to a phosphorimager screen, and then autoradiographed. Quantitation was by use of a Fuji phophorimager.
Acknowledgement These studies were supported by NIH grant GM34557.
951
references
[1] J.H. Lebowitz, R. McMacken, The Escherichia coli dnaB replication protein is a DNA helicase, J. Biol. Chem. 261 (1986) 4738–4748. [2] J.M. Kaguni, A. Kornberg, Replication initiated at the origin (oriC) of the E. coli chromosome reconstituted with purified enzymes, Cell 38 (1984) 183–190. [3] J. Shlomai, A. Kornberg, A prepriming DNA replication enzyme of Escherichia coli. I. Purification of protein n . a sequence-specific, DNA-dependent ATPase, J. Biol. Chem. 255 (1980) 6789–6793. [4] P. Mcglynn, A.A. Al-Deib, J. Liu, K.J. Marians, R.G. Lloyd, The DNA replication protein PriA and the recombination protein RecG bind D-loops, J. Mol. Biol. 270 (1997) 212–221. [5] P. Nurse, J. Liu, K.J. Marians, Two modes of PriA binding to DNA, J. Biol. Chem. 274 (1999) 25026–25032. [6] J. Liu, K.J. Marians, PriA-directed assembly of a primosome on D loop DNA, J. Biol. Chem. 274 (1999) 25033–25041. [7] S. Kim, H.G. Dallmann, C.S. Mchenry, K.J. Marians, Coupling of a replicative polymerase and helicase: a -DnaB interaction mediates rapid replication fork movement, Cell 84 (1996) 643–650. [8] A. Yuzhakov, J. Turner, M. O’Donnell, Replisome assembly reveals the basis for asymmetric function in leading and lagging strand replication, Cell 86 (1996) 877–886. [9] K. Tougu, H. Peng, K.J. Marians, Identification of a domain of Escherichia coli primase required for functional interaction with the DnaB helicase at the replication fork, J. Biol. Chem. 269 (1994) 4675–4682. [10] R.S. Lasken, A. Kornberg, The primosomal protein n of Escherichia coli is a DNA helicase, J. Biol. Chem. 263 (1988) 5512–5518. [11] M.S. Lee, K.J. Marians, Escherichia coli replication factor Y, a component of the primosome, can act as a DNA helicase, Proc. Natl. Acad. Sci. U.S.A. 84 (1987) 8345–8349. [12] T. Kogoma, G.W. Cadwell, K.G. Barnard, T. Asai, The DNA replication priming protein, PriA, is required for homologous recombination and double-strand break repair, J. Bacteriol. 178 (1996) 1258–1264. [13] E.H. Lee, A. Kornberg, Replication deficiencies in priA mutants of Escherichia coli lacking the primosomal replication n protein, Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 3029–3032. [14] P. Nurse, K.H. Zavitz, K.J. Marians, Inactivation of the Escherichia coli priA DNA replication protein induces the SOS response, J. Bacteriol. 173 (1991) 6686–6693. [15] S.J. Sandler, H.S. Samra, A.J. Clark, Differential suppression of priA2. kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC, Genetics 143 (1996) 5–13. [16] K.H. Zavitz, K.J. Marians, ATPase-deficient mutants of the Escherichia coli DNA replication protein PriA are capable of catalyzing the assembly of active primosomes, J. Biol. Chem. 267 (1992) 6933–6940. [17] G.T. Yarranton, M.L. Gefter, Enzyme-catalyzed DNA unwinding: studies on Escherichia coli rep protein, Proc. Natl. Acad. Sci. U.S.A. 76 (1979) 1658–1662. [18] K.L. Chao, T.M. Lohman, DNA-induced dimerization of the Escherichia coli Rep helicase, J. Mol. Biol. 221 (1991) 1165–1181. [19] W. Cheng, J. Hsieh, K.M. Brendza, T.M. Lohman, E. coli Rep oligomers are required to initiate DNA unwinding in vitro, J. Mol. Biol. 310 (2001) 327–350. [20] T. Ha, I. Rasnik, W. Cheng, H.P. Babcock, G.H. Gauss, T.M. Lohman, S. Chu, Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase, Nature 419 (2002) 638–641. [21] S. Korolev, J. Hsieh, G.H. Gauss, T.M. Lohman, G. Waksman, Major domain swiveling revealed by the crystal structures of
952
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33] [34]
[35]
[36]
[37]
[38]
[39] [40]
[41]
[42]
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
complexes of E. coli Rep helicase bound to single-stranded DNA and ADP, Cell 90 (1997) 635–647. K.M. Brendza, W. Cheng, C.J. Fischer, M.A. Chesnik, A. Niedziela-Majka, T.M. Lohman, Autoinhibition of Escherichia coli Rep monomer helicase activity by its 2B subdomain, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 10076–10081. T.M. Lohman, K.P. Bjornson, Mechanisms of helicase-catalyzed DNA unwinding, Annu. Rev. Biochem. 65 (1996) 169–214. J.F. Scott, S. Eisenberg, L.L. Bertsch, A. Kornberg, A mechanism of duplex DNA replication revealed by enzymatic studies of phage X174: catalytic strand separation in advance of replication, Proc. Natl. Acad. Sci. U.S.A. 74 (1977) 193–197. N. Arai, A. Kornberg, Rep protein as a helicase in an active, isolatable replication fork of duplex X174 DNA, J. Biol. Chem. 256 (1981) 5294–5298. H.E. Lane, D.T. Denhardt, The rep mutation. IV. Slower movement of replication forks in Escherichia coli rep strains, J. Mol. Biol. 97 (1975) 99–112. J.E. Yancey-Wrona, E.R. Wood, J.W. George, K.R. Smith, S.W. Matson, Escherichia coli Rep protein and helicase IV. Distributive single-stranded DNA-dependent ATPases that catalyze a limited unwinding reaction in vitro, Eur. J. Biochem. 207 (1992) 479–485. M. Mok, K.J. Marians, The Escherichia coli preprimosome and DNA B helicase can form replication forks that move at the same rate, J. Biol. Chem. 262 (1987) 16644–16654. J. Colasanti, D.T. Denhardt, The Escherichia coli rep mutation. X. Consequences of increased and decreased Rep protein levels, Mol. Gen. Genet. 209 (1987) 382–390. P. Bedinger, M. Hochstrasser, C.V. Jongeneel, B.M. Alberts, Properties of the T4 bacteriophage DNA replication apparatus: the T4 dda DNA helicase is required to pass a bound RNA polymerase molecule, Cell 34 (1983) 115–123. J.E. Yancey-Wrona, S.W. Matson, Bound Lac repressor protein differentially inhibits the unwinding reactions catalyzed by DNA helicases, Nucl. Acids Res. 20 (1992) 6713–6721. M. Uzest, S.D. Ehrlich, B. Michel, Lethality of rep recB and rep recC double mutants of Escherichia coili, Mol. Microbiol. 17 (1995) 1177–1188. B. Michel, S.D. Ehrlich, M. Uzest, DNA double-strand breaks caused by replication arrest, EMBO J. 16 (1997) 430–438. G.T. Runyon, I. Wong, T.M. Lohman, Overexpression, purification, DNA binding, and dimerization of the Escherichia coli uvrD gene product (helicase II), Biochemistry 32 (1993) 602–612. N.K. Maluf, C.J. Fischer, T.M. Lohman, A Dimer of Escherichia coli UvrD is the active form of the helicase in vitro, J. Mol. Biol. 325 (2003) 913–935. I. Wong, M. Amaratunga, T.M. Lohman, Heterodimer formation between Escherichia coli Rep and UvrD proteins, J. Biol. Chem. 268 (1993) 20386–20391. S.W. Matson, Escherichia coli helicase II (urvD gene product) translocates unidirectionally in a 3 to 5 direction, J. Biol. Chem. 261 (1986) 10169–10175. G.T. Runyon, D.G. Bear, T.M. Lohman, Escherichia coli helicase II (UvrD) protein initiates DNA unwinding at nicks and blunt ends, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 6383–6387. J.T. Reardon, A. Sancar, Nucleotide excision repair, Prog. Nucl. Acid Res. Mol. Biol. 79 (2005) 183–235. R.R. Iyer, A. Pluciennik, V. Burdett, P.L. Modrich, DNA mismatch repair: functions and mechanisms, Chem. Rev. 106 (2006) 302–323. B.K. Washburn, S.R. Kushner, Construction and analysis of deletions in the structural gene (uvrD) for DNA helicase II of Escherichia coli, J. Bacteriol. 173 (1991) 2569–2575. R.C. Heller, K.J. Marians, Unwinding of the nascent lagging strand by Rep and PriA enables the direct restart of stalled
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58] [59] [60]
[61] [62]
[63] [64]
replication forks, J. Biol. Chem. 280 (2005) 34143– 34151. J.M. Jones, H. Nakai, Duplex opening by primosome protein PriA for replisome assembly on a recombination intermediate, J. Mol. Biol. 289 (1999) 503–516. K. Higuchi, T. Katayama, S. Iwai, M. Hidaka, T. Horiuchi, H. Maki, Fate of DNA replication fork encountering a single DNA lesion during oriC plasmid DNA replication in vitro, Genes Cells 8 (2003) 437–449. V. Pages, R.P. Fuchs, Uncoupling of leading- and lagging-strand DNA replication during lesion bypass in vivo, Science 300 (2003) 1300–1303. A.V. Gregg, P. Mcglynn, R.P. Jaktaji, R.G. Lloyd, Direct rescue of stalled DNA replication forks via the combined action of PriA and RecG helicase activities, Mol. Cell 9 (2002) 241–251. J.M. Jones, H. Nakai, Escherichia coli PriA helicase: fork binding orients the helicase to unwind the lagging strand side of arrested replication forks, J. Mol. Biol. 312 (2001) 935–947. C.J. Cadman, P. Mcglynn, PriA helicase and SSB interact physically and functionally, Nucl. Acids Res. 32 (2004) 6378–6387. H.W. Chen, S.H. North, H. Nakai, Properties of the PriA helicase domain and its role in binding PriA to specific DNA structures, J. Biol. Chem. 279 (2004) 38503–38512. T. Mizukoshi, T. Tanaka, K. Arai, D. Kohda, H. Masai, A critical role of the 3 terminus of nascent DNA chains in recognition of stalled replication forks, J. Biol. Chem. 278 (2003) 42234–42239. R.C. Heller, K.J. Marians, The disposition of nascent strands at stalled replication forks dictates the pathway of replisome loading during restart, Mol. Cell 17 (2005) 733–743. A.A. Al-Deib, A.A. Mahdi, R.G. Lloyd, Modulation of recombination and DNA repair by the RecG and PriA helicases of Escherichia coli K-12, J. Bacteriol. 178 (1996) 6782–6789. P. Mcglynn, R.G. Lloyd, Genome stability and the processing of damaged replication forks by RecG, Trends Genet. 18 (2002) 413–419. S.J. Sandler, Multiple genetic pathways for restarting DNA replication forks in Escherichia coli K-12, Genetics 155 (2000) 487–497. S.J. Sandler, J.D. Mccool, T.T. Do, R.U. Johansen, PriA mutations that affect PriA-PriC function during replication restart, Mol. Microbiol. 41 (2001) 697–704. A.A. Mahdi, C. Buckman, L. Harris, R.G. Lloyd, Rep and PriA helicase activities prevent RecA from provoking unnecessary recombination during replication fork repair, Genes Dev. 20 (2006) 2135–2147. C. Bruand, S.D. Ehrlich, UvrD-dependent replication of rolling-circle plasmids in Escherichia coli, Mol. Microbiol. 35 (2000) 204–210. R.S. Lahue, K.G. Au, P. Modrich, DNA mismatch correction in a defined system, Science 245 (1989) 160–164. N. Ossanna, D.W. Mount, Mutations in uvrD induce the SOS response in Escherichia coli, J. Bacteriol. 171 (1989) 303–307. G.F. Moolenaar, C. Moorman, N. Goosen, Role of the Escherichia coli nucleotide excision repair proteins in DNA replication, J. Bacteriol. 182 (2000) 5706–5714. M.J. Flores, N. Sanchez, B. Michel, A fork-clearing role for UvrD, Mol. Microbiol. 57 (2005) 1664–1675. X. Veaute, S. Delmas, M. Selva, J. Jeusset, E. Le Cam, I. Matic, F. Fabre, M.A. Petit, UvrD helicase, unlike Rep helicase, dismantles RecA nucleoprotein filaments in Escherichia coli, EMBO J. 24 (2005) 180–189. C.J. Cadman, S.W. Matson, P. Mcglynn, Unwinding of forked DNA Structures by UvrD, J. Mol. Biol. 362 (2006) 18–25. K.J. Marians, X174-type primosomal proteins: purification and assay, Meth. Enzymol. 262 (1995) 507–521.
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/dnarepair
Non-replicative helicases at the replication fork Ryan C. Heller, Kenneth J. Marians ∗ Molecular Biology Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA
a r t i c l e
i n f o
a b s t r a c t
Article history:
Reactivation of stalled or collapsed replication forks is an essential process in bacteria.
Published on line 26 March 2007
Restart systems operate to restore the 5 → 3 replicative helicase, DnaB, to the laggingstrand template. However, other non-replicative 3 → 5 helicases play an important role
Keywords:
in the restart process as well. Here we examine the DNA-binding specificity of three of the
Non-replicative helicases
latter group, PriA, Rep, and UvrD. Only PriA and Rep display structure-specific fork bind-
Replication fork
ing. Interestingly, their specificity is opposite: PriA binds a leading-strand fork, presumably
DNA replication
reflecting its restart activity in directing loading of DnaB to the lagging-strand template. Rep binds a lagging-strand fork, presumably reflecting its role in partially displacing Okazaki fragments that originate near the fork junction. This activity is necessary for generating a single-stranded landing pad for DnaB. While UvrD shows little structure-specificity, there is a slight preference for lagging-strand forks, suggesting that there might be some redundancy between Rep and UvrD and possibly explaining the observed synthetic lethality that occurs when mutations in the genes encoding these two proteins are combined. © 2007 Elsevier B.V. All rights reserved.
1.
Introduction
The Escherichia coli replisome is a highly efficient machine capable of duplicating the genome with high rates of speed and high levels of processivity. Much of this ability is owed to the replicative helicase, DnaB, a hexameric-type helicase that encircles the lagging-strand template at the replication fork and translocates in the 5 → 3 direction [1] using the energy of ATP to separate the strands of the parental duplex. Though DnaB is sufficient to maintain DNA replication in vitro [2], a class of non-replicative, non-hexameric, 3 → 5 helicases is thought to aid in the maintenance of DNA replication through roadblocks in the form of bound proteins and DNA template lesions in vivo. The helicase activities of three of these proteins, PriA, Rep, and UvrD, are not essential alone, but evidence is accumulating that these proteins have important and overlapping functions in DNA replication. Along with several other components, PriA was purified based on its requirement in the reconstituted bacteriophage
∗
Corresponding author. Tel.: +1 212 639 5890; fax: +1 212 717 3627. E-mail address: [email protected] (K.J. Marians). 1568-7864/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.dnarep.2007.02.014
X174 replication reaction [3]. Lacking a direct role in cellular replication, PriA was later identified as a key factor in replisome assembly outside the origin of replication, a process that enables replication restart after fork stalling or breakage. After processing of the stalled fork or the broken chromosome, PriA utilizes its ability to recognize DNA in a structure-specific manner, binding to specific stalled forks and recombinationgenerated D-loop structures [4,5]. PriA then catalyzes the assembly of a multiprotein complex including PriB and DnaT, which together allow the loading of the replicative helicase DnaB from a DnaB–DnaC complex to single-stranded DNAbinding protein (SSB)-coated single-stranded DNA [6]. The loading of DnaB nucleates the assembly of a new replisome through protein-protein interactions with a component of the DNA polymerase III holoenzyme (Pol III HE) [7,8] and with the primase, DnaG [9]. Although PriA is a SF2 family member DNA helicase with 3 → 5 polarity [10,11], its unwinding activity is distinct from its ability to load DnaB for the replication restart process. Cells lacking PriA have a number of defects including
946
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
very low viability, slow growth, sensitivity to sources of DNA damage, and recombination defects [12–15], most of which are suppressed by providing a source of helicase-defective PriA in trans [12,15,16]. How the PriA helicase activity plays a role in maintaining genomic integrity has been a source of debate for some time. Rep helicase is a member of the SF1 superfamily, possessing intrinsic 3 → 5 helicase activity [17]. A monomer in solution, Rep was shown to dimerize upon binding DNA [18], and it has been suggested that oligomerization of Rep is required for its helicase activity [19,20]. The crystal structure of Rep bound to single-stranded DNA revealed a four subdomain architecture [21]. One of these subdomains (2B) is thought to be capable of changing orientation and was suggested to play a regulatory role in helicase activity [22]. Though Rep has been examined extensively as a model helicase for mechanistic studies, its biological role has remained elusive [23]. As with PriA, the origins of the study of Rep helicase came from its role in the replication of single-stranded DNA bacteriophages by the host machinery. In the X174 replication system, the single-stranded circular form of the phage is first converted to the duplex replicative form through the action of the multiprotein primosome and Pol III HE. After the phage encoded gene A protein introduces a nick into the duplex DNA, interaction with this protein enables Rep to utilize its 3 → 5 helicase activity to separate the strands of the duplex in a highly processive manner [24,25], allowing rolling-circle synthesis to generate a new copy of the phage DNA. Though Rep is a crucial component of a number of phage replisomes, Rep was nearly dispensable for chromosomal replication [26], and completely unnecessary for replication of oriC-containing plasmid DNA in vitro [2]. Without the X174 gene A protein, Rep displayed very low processivity, being nearly unable to unwind a fragment 343 nt in size from a partial duplex DNA structure [27], an attribute that makes Rep an unlikely candidate for supporting chromosomal replication. In contrast, the hexameric replicative helicase DnaB was demonstrated to be capable of unwinding >50 kbp of duplex DNA in a single event during a replication reaction [28]. Cells lacking Rep do not halt DNA synthesis as might be expected for a replicative helicase, although replication was shown to proceed at a reduced rate [26], and the average number of growing replication forks per cell was increased [29]. These subtle effects on DNA replication suggest that the biological role of Rep is related to the problems faced in replicating DNA in the cellular environment. One potential issue is the presence of protein–DNA complexes that are essential for promoting and regulating processes such as transcription, but may act as impediments to replication fork progression. For example, in the bacteriophage T4 replication system, a bound RNA polymerase molecule was shown to block or to slow replication, while addition of the T4 Dda helicase displaced the RNA polymerase molecule from the DNA and restored proper replication rate [30]. In E. coli, the Lac repressor protein is required for maintaining proper cellular metabolism, but severely inhibited the helicase activity of DnaB in vitro when bound to DNA [31]. Rep, on the other hand, was able to displace the bound protein and its helicase activity was unaffected, suggesting that Rep may function by aiding cellular replication in removing blocking
proteins ahead of the fork. In support of this idea, mutation of rep is lethal when combined with recB or recC mutations [32] and the amount of linear DNA increases when RecB and RecC are inactivated [33], suggesting that pauses and fork stalling leading to double-strand breaks are frequent in the rep mutant, and that these breaks are normally repaired by RecBCD. The UvrD helicase (also called helicase II) is a SF1 superfamily member, possessing approximately 40% amino acid similarity with the Rep protein. UvrD undergoes some oligomerization in solution, but the dimeric form was shown to be stabilized upon association with DNA [34]. The dimeric form is thought to be the active species for unwinding [35]. A heterodimer between Rep and UvrD was reported to form in vitro, with an energetic stability that was even higher than the Rep homodimer [36], though the biological function of such a heterodimer is unknown. Possessing intrinsic helicase activity with 3 → 5 polarity [37], UvrD was capable of initiating unwinding from regions of single-stranded DNA, and also from both nicks and blunt ends at higher enzyme concentrations [38]. Its ability to unwind duplex DNA from a discontinuity in the phosphodiester backbone underpins the role of UvrD in nucleotide excision repair (NER) and in methyl-directed mismatch repair. Sites of DNA damage are recognized by the NER proteins UvrA and UvrB, which recruit UvrC to catalyze dual incisions in the DNA at sites both 3 and 5 of the damaged region. UvrD then utilizes its helicase activity to release the excised oligomer containing the damage and to facilitate the dissociation of UvrC [39]. During the mismatch repair process, UvrD initiates unwinding at an incision that is made at an adjacent hemimethylated GATC sequence [40]. The displaced strand is then degraded by an exonuclease, thus eliminating the mispair and allowing repair synthesis to restore the duplex [40]. Consistent with its role in DNA repair, certain mutations in UvrD confer sensitivity to DNA damaging agents, and cells lacking UvrD display high levels of UV light sensitivity and exhibit a strong mutator phenotype [41]. In this study, in order to gain insight into their roles in DNA replication, the binding preferences of PriA, Rep, and UvrD were examined on a variety of partial duplex and forked structures in an effort to determine whether any of these proteins display fork structure-specific binding. In addition, the mechanism by which PriC was shown to stimulate the helicase activity of Rep [42] was examined further. Potential models for the activity of this class of 3 → 5 helicases at the replication fork are discussed.
2.
Results and discussion
2.1. PriA helicase has multiple roles in ensuring fork progression Insight into the role of PriA helicase activity in maintaining fork progression has come from both genetic and biochemical sources. Using oligonucleotides to model the fork in bacteriophage Mu strand-transfer intermediates, it was found that PriA helicase activity was capable of removing nascent DNA at the lagging-strand arm of the fork in order to expose sufficient single-stranded DNA for DnaB loading and replisome assem-
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
bly [43], possibly explaining the requirement for PriA in Mu replication. Stalled forks with this structure may be generated during chromosomal replication by a polymerase uncoupling event in which collision of the replisome with leading strandspecific lesions and continued unwinding of the parental duplex produces large gaps in the nascent leading strand DNA and a nascent lagging strand that has progressed past the blocked leading strand. Evidence for polymerase uncoupling comes from studies of the replication of damage-containing plasmids both in vitro and in vivo [44,45]. If the 5 -end of the nascent lagging strand DNA is too close to the fork junction and is obstructing DnaB loading, PriA could act to unwind a sufficient length of this DNA to allow for transfer of DnaB to the lagging-strand template of the stalled fork. In support of this hypothesis, PriA was shown to unwind the nascent lagging strand of model oligonucleotide replication forks, both in the absence and presence of SSB [42,43,46,47]. The presence of SSB was reported to suppress unwinding of the parental duplex region of these forks [47], a potentially destabilizing event. SSB was further shown to stimulate unwinding of the nascent lagging-strand DNA by PriA at fork structures via physical interaction between the two proteins [48], but was inhibitory toward unwinding of a minimal partial duplex structure [49]. Thus, unwinding by PriA under physiological conditions in the presence of SSB occurs above basal levels and is a fork-specific reaction in which activity is directed toward the nascent lagging strand. An analysis of the binding preferences of PriA for stalled fork structures was assessed using electrophoretic mobility shift assay (Fig. 1). For each structure, a progression of single-stranded tail sizes was tested in order to gauge the minimum length required for binding and to accurately determine binding preference, which should be independent of tail size. The analysis revealed two distinct mechanisms of binding for PriA. With little tail-size dependence, both forks carrying nascent leading strand oligonucleotides with 5 single-stranded tails (lead forks) and those carrying nascent lagging strand oligonucleotides with 3 single-stranded tails (lag forks) were recognized with approximately equal affinity (Fig. 1). Binding to the lag forks likely represent a mode of binding in which the single strand-double strand junction of 3 extensions is recognized, as displayed by the high affinity binding of PriA to partial duplex structures with 3 -extensions (3 -Ext). In contrast, binding to partial duplex structures with 5 -extensions (5 -Ext) was approximately 5–10-fold lower, indicating that the lead fork branched structure was recognized specifically. This conclusion is in agreement with conclusions from a previous report [5], which also demonstrated two modes of PriA binding: one to 3 extensions that is likely a manifestation of the 3 → 5 helicase activity of the enzyme and one that is a structure-specific binding of PriA to 3-strand branched structures containing a 5 -tail. The mode of structure-specific binding to lead fork structures by PriA likely reflects its ability to target these structures for DnaB loading and replication restart. High affinity binding to these structures was subsequently shown to require an interaction between the 3 -OH of the nascent leading strand at the fork junction and a domain of PriA in the N-terminal region called the 3 -terminus binding pocket [50]. Eliminating this interaction by expressing PriA binding pocket mutants in
947
Fig. 1 – PriA DNA-binding preferences. Binding reaction mixtures containing DNA structures with the indicated tail lengths and 8 nM PriA for the Ext structures, and 2 nM PriA for the fork structures where noted, were incubated and analyzed as described under Section 3. The position and identity of the structure is indicated to the right of each gel. An autoradiograph of the gels is shown in (A) and the quantitation of the data is shown in (B).
a priA null mutant did not alter the phenotype significantly for most mutants, suggesting that this mode of binding is critical for replication restart [50]. Furthermore, eliminating this mode of binding by introducing gaps between the 3 -terminus of the nascent leading strand and the fork junction was shown to reduce DnaB loading and replication restart activity on model fork structures [51]. The ability of PriA to recognize lag forks containing a 3 -tail via a distinct mode of binding provides a foundation to the observed ability of PriA to unwind nascent lagging strand DNA at model stalled forks lacking a nascent leading strand. These structures may arise from a polymerase uncoupling event and may require processing with a helicase such as PriA before restart can take place. Certain mutations in PriA that suppress the UV sensitivity defects of cells lacking RecG [52], a protein thought to catalyze the reversal of stalled forks [53], also eliminate its ability to unwind nascent lagging-strand DNA of forks lacking a nascent leading strand [46], suggesting that
948
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
these forks can normally be targeted by PriA in vivo. Furthermore, PriC was shown to efficiently target model forks with this structure for restart, but only after nascent lagging strand unwinding by PriA [42]. Indeed, PriA and PriC were shown to act together in a common genetic pathway by analysis of the restart components, and further investigation revealed that the helicase activity of PriA specifically was thought to be key for allowing restart to occur by this pathway [54,55].
2.2. Rep helicase interacts with PriC and fork structures Aside from its potential role in removing bound proteins from DNA to facilitate fork progression, recent evidence suggests that Rep may also play a role in repairing stalled forks with PriC. A distinct restart pathway that is independent of PriA was identified, based on genetic analysis, involving both the PriC and Rep proteins [54]. With the finding that PriC was capable of catalyzing the reloading of DnaB on forks with nascent leading-strand gaps independently of Rep [51], it was hypothesized that Rep could act to unwind nascent lagging strand DNA that blocks the reloading process in a manner analogous to that proposed for PriA [42]. Indeed, Rep unwinds primarily the nascent lagging strand of model stalled fork structures, and PriC was shown to stimulate the helicase activity of Rep both in the absence and presence of SSB [42], suggesting that Rep is targeted to those stalled forks that are recognized by PriC. The stimulation of Rep helicase activity by PriC was further analyzed using a template in which a 55 nt oligonucleotide was annealed to single-stranded X174 DNA, creating a forked structure due to a 5 nonhomologous segment of 25 nt on the oligonucleotide. Using this template, unwinding of the oligonucleotide by Rep was stimulated over 18-fold (Fig. 2A), confirming a previous report of stimulation [40]. That a higher concentration of PriC is required to detect stimulation in this assay is likely because this template contains excess singlestranded DNA, to which PriC can bind with relatively low affinity (data not shown). There are still several unanswered question regarding the mechanism of the observed stimulation. For example, it remains unclear whether PriC interacts directly with Rep and/or the DNA, and whether loading efficiency or the processivity is affected by PriC. To further probe the nature of the interaction, it was determined whether the activity stimulation reflects increased processivity of Rep, enabling it to more easily unwind a longer segment of DNA. To this end, the annealed oligonucleotide was elongated by the Klenow fragment of E. coli polymerase I to create an array of templates in which the size of the annealed oligonucleotide ranged from 55 to approximately 350 nt (Fig. 2B, lane 12). In the presence of Rep alone, overall unwinding levels were poor and the pattern of products revealed an inability to unwind the larger oligonucleotides even at high concentration, consistent with a low processivity enzyme (lanes 2–5). Though PriC has no detectible helicase activity on its own (lanes 9–11), the addition of PriC stimulated overall helicase activity on this template array by Rep (lanes 6–8). However, the pattern of unwinding products in which a larger proportion of smaller oligonucleotides were unwound did not change, indicating that PriC had no detectible effect
Fig. 2 – PriC stimulates Rep helicase activity, but not processivity. (A) Helicase assay reaction mixtures containing primed X174 helicase template, 5 nM Rep where noted and the indicated concentration of PriC were incubated and analyzed as described under Section 3. The position of the substrate and product are indicated to the right of the gel. An autoradiograph of the gel is shown in the left panel and the quantitation of the data is shown on the right. (B) Helicase assay reaction mixtures containing helicase template with elongated oligonucleotide and the indicated concentrations of Rep and PriC were incubated and analyzed as described under Section 3. In lane 12, template was heated at 100 ◦ C for 5 min before loading. An autoradiograph of the gel is shown in (B) and the quantitation of the data is shown in (C).
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
on the processivity of Rep. The increase in Rep unwinding activity at forked structures suggested that PriC may act as a cellular analog of the X174 gene A protein, which enables Rep to unwind the duplex DNA at the phage replication fork in a processive manner, but the lack of processivity increase by PriC suggests fundamental differences between the two interactions. In this mode of action, PriC may increase the local concentration of Rep at stalled forks, where its limited processivity may be sufficient to allow the more processive DnaB to complete chromosomal replication. Replication of the X174 chromosome, on the other hand, begins from a nicked duplex, which lacks structural features necessary for DnaB loading by either the PriA or PriC systems, and so the gene A protein may have evolved instead to impart Rep with the necessary processivity for replication. An analysis of the binding preferences for Rep showed two modes of binding to DNA structures as with PriA, but the polarity was opposite (Fig. 3). Even though the partial duplex structure with the 3 single-stranded tail (3 -Ext) was recog-
949
nized very poorly, binding to the lag fork, which possesses a 3 single-stranded tail, occurred at relatively high affinity. This striking difference in binding preference indicates that the lag fork structure is recognized specifically. The other mode of binding occurred by virtue of recognition of the single strand-double strand junction of 5 extensions, also the opposite polarity as that observed for PriA. This mode enabled recognition of both the 5 -Ext and the lead fork structure, and appears to have an optimal tail length of 10–16 nucleotides. The physical basis for this optimal binding length is not clear. The two binding modes enable Rep to recognize replication forks with different positions of nascent DNA, suggesting that the helicase activity may be used for multiple biological roles. Specific recognition of the lag fork is consistent with the ability of Rep to unwind nascent lagging-strand DNA as a prelude to DnaB loading, and is also consistent with the interaction between Rep and PriC, which operates at stalled forks lacking nascent leading strand DNA. Unfortunately, since PriA also recognizes this fork and also unwinds nascent lagging strand DNA, it is difficult to determine under which circumstances Rep or PriA would target this type of stalled fork. Overlapping function is possible though, as cells lacking Rep and PriA helicase activites display synthetic growth, viability, and morphology defects [56]. The other mode of binding, with which Rep can bind to forks without nascent lagging-strand DNA likely reflects a function that is different than the function of PriA at these forks, since Rep has not been demonstrated to play a direct role in DnaB loading. It is possible that Rep uses this mode of binding along with its ability to displace bound proteins to clear a blocking protein from the path of the replisome at a stalled or slowed replication fork. Its limited processivity would enable Rep to disengage shortly afterward, allowing processive replication to resume.
2.3. UvrD—a promiscuous helicase with roles in repair and replication
Fig. 3 – Rep DNA-binding preferences. Binding reaction mixtures containing DNA structures with the indicated tail lengths and 8 nM Rep for the Ext structures, and 2 nM Rep for the fork structures where noted, were incubated and analyzed as described under Section 3. The position and identity of the structure is indicated to the right of each gel. An autoradiograph of the gels is shown in (A) and the quantitation of the data is shown in (B).
In addition to its role in DNA repair, several lines of evidence suggest that UvrD may also play an indirect role in maintaining DNA replication. For example, UvrD, but not Rep, is required for the rolling circle replication of a Staphylococcus aureus plasmid in E. coli, likely acting as the replicative helicase [57]. UvrD also co-purifies with preparations of the DNA polymerase III holoenzyme [58], suggesting an interaction that would place UvrD at the replication fork. In addition, certain alleles of uvrD are constitutively induced for the SOS response [59], a common phenotype in cells with replication defects. Null uvrD mutants are lethal when combined with mutations in polA [60], which encodes for polymerase I and is involved in Okazaki fragment maturation, and is also lethal when combined with a rep mutation [41], suggesting some overlapping function in ensuring replication progression. It was proposed that UvrD acts at blocked replication forks by removing RecA or a structure generated by RecA in order to counter a futile reaction [61], a notion supported by the ability of UvrD to directly remove RecA nucleoprotein filaments in vitro [62], and by the elevated recombination levels in the uvrD mutant [41]. Cognizant of its role in DNA replication and potential functional overlap with the highly homologous Rep helicase, the binding preferences of UvrD to model fork and partial duplex
950
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
in DNA replication. Interestingly, it was recently reported that initial rates of unwinding by UvrD on a similar fork containing only a lagging strand were higher than nicked, partial duplex, and fork structures containing a leading strand [63], consistent with our finding of increased affinity on the lag fork structure. In addition, the primary product of the unwinding reaction resulted from the unwinding of the lagging-strand duplex, a reaction that was activated by the absence of a leading strand at the branch point [63]. Unwinding of nascent lagging strand DNA at a stalled replication fork could enable UvrD to provide single-stranded DNA on the lagging-strand arm to allow DnaB loading and replication restart in a manner analogous to that proposed for Rep and PriA. A redundancy between UvrD and the Rep-PriC restart pathway would help explain the uvrD rep synthetic lethality [41] and provide additional explanation for the indirect role of UvrD in DNA replication progression.
3.
Materials and methods
3.1.
DNAs and proteins
The PriA and PriC proteins were overexpressed in E. coli and purified as described previously. Rep helicase was prepared as described previously [64]. The UvrD protein was kindly provided by Steve Matson. The following oligonucleotides were used to prepare the structures in the binding assays:
Fig. 4 – UvrD DNA-binding preferences. Binding reaction mixtures containing DNA structures with the indicated tail lengths and 8 nM UvrD for the Ext structures, and 2 nM UvrD for the fork structures where noted, were incubated and analyzed as described under Section 3. The position and identity of the structure is indicated to the right of each gel. An autoradiograph of the gels is shown in (A) and the quantitation of the data is shown in (B).
structures were assessed (Fig. 4). The two shifted bands that are observed in those lanes where binding occurs likely represent different oligomers of UvrD bound to the DNA structure. Unexpectedly, the binding preferences to partial duplex structures more closely resembled those of PriA than those of Rep. UvrD bound to both the 5 -Ext and the 3 -Ext structures, with a preference for the 3 -Ext structure of approximately three-fold, similar to but somewhat less than the 5–10-fold difference shown for PriA. Unlike PriA or Rep however, no structurespecific fork binding was observed. The binding preferences for the fork structures essentially paralleled those observed for the partial duplex structures, with an approximately 3–5fold preference for the lag fork (possessing a 3 extension) over the lead fork (possessing a 5 extension). Although the fork structure per se is not recognized specifically, the clear binding preference of UvrD for the lag fork suggests that this structure may be related to its biological role
(1) 5 -GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAG GGCTGAGCACGCCGACGAACATTC-3 ; (2) 5 -GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAG GGCT-3 ; (3) 5 -CTCGCGCCGCAGACTCATTTAGCCCTTATCCGTATTGCGGTCTCGAGTCGCCATGGA CGGTCGACCTGTAGAAGGCTTGC-3 ; (4) 5 -AGCCCTTATCCGTATTGCGGTCTCGAGTCGCCATGGACGGTCGACCTGTAGAAGGCT TGC-3 ; (5) 5 -GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAG GGCTGAGCACGCCGACGAACATTCACCACGCCAGACCACGTA-3 ; (6) 5 -GACTATCTACGTCCGAGGCTCGCGCCGCAGACTCATTTAGCCCTTATCCGTATTGCG GTCTCGAGTCGCCATGGACGGTCGACCTGTAGAAGGCTTGC-3 ; (7) 5 -TACGTGGTCTGGCGTGGTGAATGTTCGTCGGCGTGCTC3 ; (8) 5 -AAATGAGTCTGCGGCGCGAGCCTCGGACGTAGATAGTC3 . The 5 -Ext structure with the 20 nt tail was constructed with oligonucleotides 2 and 3. Structures with shorter tail lengths were made by shortening oligonucleotide 3 from the 5 end. The 3 -Ext structure with the 20 nt tail was constructed with oligonucleotides 1 and 4. Structures with shorter tail lengths were made by shortening oligonucleotide 1 from the 3 end. The lead fork structure with the 20 nt tail was constructed with oligonucleotides 3, 5, and 7. Structures with shorter tail lengths were made by shortening oligonucleotide 3 from the 5 end. The lag fork structure
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
with the 20 nt tail was constructed with oligonucleotides 1, 6, and 8. Structures with shorter tail lengths were made by shortening oligonucleotide 1 from the 3 end. Oligonucleotides 2, 4, 5, or 6, were 5 -end labeled, annealed, and the structures were purified as described previously [51]. The primed X174 helicase template was prepared and labeled as described previously [11], except that an oligonucleotide with the sequence 5 -TGCAGACCATAGCACAGATGCTTCTAGCGATAAAACTCTGCAGGTTGGATACGCC-3 was used instead of the X-Pst1 oligonucleotide. To elongate the oligonucleotide, a series of reaction mixtures (50 l) containing 50 mM HEPESKOH (pH 8.0), 50 mM NaCl, 10 mM MgOAc2 , 10 mM DTT, 100 g/ml bovine serum albumin, 100 M dNTPs, 100 fmol of 3 -end-labeled primer-template, and 12.5 U of the Klenow fragment were incubated at 24 ◦ C for 5–65 s at 10 s intervals. Reactions were combined, phenol extracted, and spin dialyzed using Microspin G-25 columns (GE Healthcare). The oligonucleotide was elongated to a range of 55 to approximately 350 nt as determined by denaturing polyacrylamide gel electrophoresis with labeled size standards.
3.2.
Binding assay
Reaction mixtures (10 l) containing 50 mM Tris-HCl (pH 8.0), 3 mM MgCl2 , 1 mM DTT, 1 mg/ml bovine serum albumin, 0.2% Triton X-100, 6% glycerol, 1 nM DNA structure, and the indicated concentration of PriA, Rep, or UvrD were incubated at 30 ◦ C for 10 min, and then 8 l were loaded directly to 10 cm × 13 cm × 0.12 cm 7% polyacrylamide (80:1, acrylamide:bisacrylamide) gels. Gels were pre-run at 13 mA for 30 min at 4 ◦ C using 6.7 mM Tris-HCl (pH 8.0 at 4 ◦ C), 3.3 mM NaOAc, 2.0 mM MgOAc2 , 0.1 mM EDTA as the electrophoresis buffer, with constant recirculation. Electrophoresis was at 20 mA for 2.5 h with constant buffer recirculation. The gels were dried, exposed to phosphorimager screens, and autoradiographed. Quantitation was by use of a Fuji phosphorimager.
3.3.
Helicase assay
Reaction mixtures (10 l) containing 50 mM HEPES-KOH (pH 8.0), 10 mM MgOAc2 , 5 mM ATP, 40 g/ml bovine serum albumin, 2 mM DTT, 1 nM primed X174 helicase template, and the indicated concentration of Rep and PriC were incubated at 37 ◦ C for 10 min. Unwinding was terminated by the addition of EDTA, SDS, and proteinase K to 20 mM, 0.5%, and 0.2 mg/ml, respectively, followed by incubation at 37 ◦ C for 30 min. The samples were analyzed using 10 cm × 13 cm × 0.12 cm 10% or 8% (for testing processivity) polyacrylamide (29:1, acrylamide:bisacrylamide) gels. Electrophoresis was at 25 mA for 2 h using 100 mM Tris–borate (pH 8.3), 2 mM EDTA as the buffer. Gels were fixed by soaking in 10% methanol, 7% HOAc, 5% glycerol, dried, exposed to a phosphorimager screen, and then autoradiographed. Quantitation was by use of a Fuji phophorimager.
Acknowledgement These studies were supported by NIH grant GM34557.
951
references
[1] J.H. Lebowitz, R. McMacken, The Escherichia coli dnaB replication protein is a DNA helicase, J. Biol. Chem. 261 (1986) 4738–4748. [2] J.M. Kaguni, A. Kornberg, Replication initiated at the origin (oriC) of the E. coli chromosome reconstituted with purified enzymes, Cell 38 (1984) 183–190. [3] J. Shlomai, A. Kornberg, A prepriming DNA replication enzyme of Escherichia coli. I. Purification of protein n . a sequence-specific, DNA-dependent ATPase, J. Biol. Chem. 255 (1980) 6789–6793. [4] P. Mcglynn, A.A. Al-Deib, J. Liu, K.J. Marians, R.G. Lloyd, The DNA replication protein PriA and the recombination protein RecG bind D-loops, J. Mol. Biol. 270 (1997) 212–221. [5] P. Nurse, J. Liu, K.J. Marians, Two modes of PriA binding to DNA, J. Biol. Chem. 274 (1999) 25026–25032. [6] J. Liu, K.J. Marians, PriA-directed assembly of a primosome on D loop DNA, J. Biol. Chem. 274 (1999) 25033–25041. [7] S. Kim, H.G. Dallmann, C.S. Mchenry, K.J. Marians, Coupling of a replicative polymerase and helicase: a -DnaB interaction mediates rapid replication fork movement, Cell 84 (1996) 643–650. [8] A. Yuzhakov, J. Turner, M. O’Donnell, Replisome assembly reveals the basis for asymmetric function in leading and lagging strand replication, Cell 86 (1996) 877–886. [9] K. Tougu, H. Peng, K.J. Marians, Identification of a domain of Escherichia coli primase required for functional interaction with the DnaB helicase at the replication fork, J. Biol. Chem. 269 (1994) 4675–4682. [10] R.S. Lasken, A. Kornberg, The primosomal protein n of Escherichia coli is a DNA helicase, J. Biol. Chem. 263 (1988) 5512–5518. [11] M.S. Lee, K.J. Marians, Escherichia coli replication factor Y, a component of the primosome, can act as a DNA helicase, Proc. Natl. Acad. Sci. U.S.A. 84 (1987) 8345–8349. [12] T. Kogoma, G.W. Cadwell, K.G. Barnard, T. Asai, The DNA replication priming protein, PriA, is required for homologous recombination and double-strand break repair, J. Bacteriol. 178 (1996) 1258–1264. [13] E.H. Lee, A. Kornberg, Replication deficiencies in priA mutants of Escherichia coli lacking the primosomal replication n protein, Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 3029–3032. [14] P. Nurse, K.H. Zavitz, K.J. Marians, Inactivation of the Escherichia coli priA DNA replication protein induces the SOS response, J. Bacteriol. 173 (1991) 6686–6693. [15] S.J. Sandler, H.S. Samra, A.J. Clark, Differential suppression of priA2. kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC, Genetics 143 (1996) 5–13. [16] K.H. Zavitz, K.J. Marians, ATPase-deficient mutants of the Escherichia coli DNA replication protein PriA are capable of catalyzing the assembly of active primosomes, J. Biol. Chem. 267 (1992) 6933–6940. [17] G.T. Yarranton, M.L. Gefter, Enzyme-catalyzed DNA unwinding: studies on Escherichia coli rep protein, Proc. Natl. Acad. Sci. U.S.A. 76 (1979) 1658–1662. [18] K.L. Chao, T.M. Lohman, DNA-induced dimerization of the Escherichia coli Rep helicase, J. Mol. Biol. 221 (1991) 1165–1181. [19] W. Cheng, J. Hsieh, K.M. Brendza, T.M. Lohman, E. coli Rep oligomers are required to initiate DNA unwinding in vitro, J. Mol. Biol. 310 (2001) 327–350. [20] T. Ha, I. Rasnik, W. Cheng, H.P. Babcock, G.H. Gauss, T.M. Lohman, S. Chu, Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase, Nature 419 (2002) 638–641. [21] S. Korolev, J. Hsieh, G.H. Gauss, T.M. Lohman, G. Waksman, Major domain swiveling revealed by the crystal structures of
952
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33] [34]
[35]
[36]
[37]
[38]
[39] [40]
[41]
[42]
d n a r e p a i r 6 ( 2 0 0 7 ) 945–952
complexes of E. coli Rep helicase bound to single-stranded DNA and ADP, Cell 90 (1997) 635–647. K.M. Brendza, W. Cheng, C.J. Fischer, M.A. Chesnik, A. Niedziela-Majka, T.M. Lohman, Autoinhibition of Escherichia coli Rep monomer helicase activity by its 2B subdomain, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 10076–10081. T.M. Lohman, K.P. Bjornson, Mechanisms of helicase-catalyzed DNA unwinding, Annu. Rev. Biochem. 65 (1996) 169–214. J.F. Scott, S. Eisenberg, L.L. Bertsch, A. Kornberg, A mechanism of duplex DNA replication revealed by enzymatic studies of phage X174: catalytic strand separation in advance of replication, Proc. Natl. Acad. Sci. U.S.A. 74 (1977) 193–197. N. Arai, A. Kornberg, Rep protein as a helicase in an active, isolatable replication fork of duplex X174 DNA, J. Biol. Chem. 256 (1981) 5294–5298. H.E. Lane, D.T. Denhardt, The rep mutation. IV. Slower movement of replication forks in Escherichia coli rep strains, J. Mol. Biol. 97 (1975) 99–112. J.E. Yancey-Wrona, E.R. Wood, J.W. George, K.R. Smith, S.W. Matson, Escherichia coli Rep protein and helicase IV. Distributive single-stranded DNA-dependent ATPases that catalyze a limited unwinding reaction in vitro, Eur. J. Biochem. 207 (1992) 479–485. M. Mok, K.J. Marians, The Escherichia coli preprimosome and DNA B helicase can form replication forks that move at the same rate, J. Biol. Chem. 262 (1987) 16644–16654. J. Colasanti, D.T. Denhardt, The Escherichia coli rep mutation. X. Consequences of increased and decreased Rep protein levels, Mol. Gen. Genet. 209 (1987) 382–390. P. Bedinger, M. Hochstrasser, C.V. Jongeneel, B.M. Alberts, Properties of the T4 bacteriophage DNA replication apparatus: the T4 dda DNA helicase is required to pass a bound RNA polymerase molecule, Cell 34 (1983) 115–123. J.E. Yancey-Wrona, S.W. Matson, Bound Lac repressor protein differentially inhibits the unwinding reactions catalyzed by DNA helicases, Nucl. Acids Res. 20 (1992) 6713–6721. M. Uzest, S.D. Ehrlich, B. Michel, Lethality of rep recB and rep recC double mutants of Escherichia coili, Mol. Microbiol. 17 (1995) 1177–1188. B. Michel, S.D. Ehrlich, M. Uzest, DNA double-strand breaks caused by replication arrest, EMBO J. 16 (1997) 430–438. G.T. Runyon, I. Wong, T.M. Lohman, Overexpression, purification, DNA binding, and dimerization of the Escherichia coli uvrD gene product (helicase II), Biochemistry 32 (1993) 602–612. N.K. Maluf, C.J. Fischer, T.M. Lohman, A Dimer of Escherichia coli UvrD is the active form of the helicase in vitro, J. Mol. Biol. 325 (2003) 913–935. I. Wong, M. Amaratunga, T.M. Lohman, Heterodimer formation between Escherichia coli Rep and UvrD proteins, J. Biol. Chem. 268 (1993) 20386–20391. S.W. Matson, Escherichia coli helicase II (urvD gene product) translocates unidirectionally in a 3 to 5 direction, J. Biol. Chem. 261 (1986) 10169–10175. G.T. Runyon, D.G. Bear, T.M. Lohman, Escherichia coli helicase II (UvrD) protein initiates DNA unwinding at nicks and blunt ends, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 6383–6387. J.T. Reardon, A. Sancar, Nucleotide excision repair, Prog. Nucl. Acid Res. Mol. Biol. 79 (2005) 183–235. R.R. Iyer, A. Pluciennik, V. Burdett, P.L. Modrich, DNA mismatch repair: functions and mechanisms, Chem. Rev. 106 (2006) 302–323. B.K. Washburn, S.R. Kushner, Construction and analysis of deletions in the structural gene (uvrD) for DNA helicase II of Escherichia coli, J. Bacteriol. 173 (1991) 2569–2575. R.C. Heller, K.J. Marians, Unwinding of the nascent lagging strand by Rep and PriA enables the direct restart of stalled
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58] [59] [60]
[61] [62]
[63] [64]
replication forks, J. Biol. Chem. 280 (2005) 34143– 34151. J.M. Jones, H. Nakai, Duplex opening by primosome protein PriA for replisome assembly on a recombination intermediate, J. Mol. Biol. 289 (1999) 503–516. K. Higuchi, T. Katayama, S. Iwai, M. Hidaka, T. Horiuchi, H. Maki, Fate of DNA replication fork encountering a single DNA lesion during oriC plasmid DNA replication in vitro, Genes Cells 8 (2003) 437–449. V. Pages, R.P. Fuchs, Uncoupling of leading- and lagging-strand DNA replication during lesion bypass in vivo, Science 300 (2003) 1300–1303. A.V. Gregg, P. Mcglynn, R.P. Jaktaji, R.G. Lloyd, Direct rescue of stalled DNA replication forks via the combined action of PriA and RecG helicase activities, Mol. Cell 9 (2002) 241–251. J.M. Jones, H. Nakai, Escherichia coli PriA helicase: fork binding orients the helicase to unwind the lagging strand side of arrested replication forks, J. Mol. Biol. 312 (2001) 935–947. C.J. Cadman, P. Mcglynn, PriA helicase and SSB interact physically and functionally, Nucl. Acids Res. 32 (2004) 6378–6387. H.W. Chen, S.H. North, H. Nakai, Properties of the PriA helicase domain and its role in binding PriA to specific DNA structures, J. Biol. Chem. 279 (2004) 38503–38512. T. Mizukoshi, T. Tanaka, K. Arai, D. Kohda, H. Masai, A critical role of the 3 terminus of nascent DNA chains in recognition of stalled replication forks, J. Biol. Chem. 278 (2003) 42234–42239. R.C. Heller, K.J. Marians, The disposition of nascent strands at stalled replication forks dictates the pathway of replisome loading during restart, Mol. Cell 17 (2005) 733–743. A.A. Al-Deib, A.A. Mahdi, R.G. Lloyd, Modulation of recombination and DNA repair by the RecG and PriA helicases of Escherichia coli K-12, J. Bacteriol. 178 (1996) 6782–6789. P. Mcglynn, R.G. Lloyd, Genome stability and the processing of damaged replication forks by RecG, Trends Genet. 18 (2002) 413–419. S.J. Sandler, Multiple genetic pathways for restarting DNA replication forks in Escherichia coli K-12, Genetics 155 (2000) 487–497. S.J. Sandler, J.D. Mccool, T.T. Do, R.U. Johansen, PriA mutations that affect PriA-PriC function during replication restart, Mol. Microbiol. 41 (2001) 697–704. A.A. Mahdi, C. Buckman, L. Harris, R.G. Lloyd, Rep and PriA helicase activities prevent RecA from provoking unnecessary recombination during replication fork repair, Genes Dev. 20 (2006) 2135–2147. C. Bruand, S.D. Ehrlich, UvrD-dependent replication of rolling-circle plasmids in Escherichia coli, Mol. Microbiol. 35 (2000) 204–210. R.S. Lahue, K.G. Au, P. Modrich, DNA mismatch correction in a defined system, Science 245 (1989) 160–164. N. Ossanna, D.W. Mount, Mutations in uvrD induce the SOS response in Escherichia coli, J. Bacteriol. 171 (1989) 303–307. G.F. Moolenaar, C. Moorman, N. Goosen, Role of the Escherichia coli nucleotide excision repair proteins in DNA replication, J. Bacteriol. 182 (2000) 5706–5714. M.J. Flores, N. Sanchez, B. Michel, A fork-clearing role for UvrD, Mol. Microbiol. 57 (2005) 1664–1675. X. Veaute, S. Delmas, M. Selva, J. Jeusset, E. Le Cam, I. Matic, F. Fabre, M.A. Petit, UvrD helicase, unlike Rep helicase, dismantles RecA nucleoprotein filaments in Escherichia coli, EMBO J. 24 (2005) 180–189. C.J. Cadman, S.W. Matson, P. Mcglynn, Unwinding of forked DNA Structures by UvrD, J. Mol. Biol. 362 (2006) 18–25. K.J. Marians, X174-type primosomal proteins: purification and assay, Meth. Enzymol. 262 (1995) 507–521.