- Email: [email protected]
Normalization of mucosal tumor necrosis factor-α: A new criterion for discontinuing infliximab therapy in ulcerative colitis
Cytokine 79 (2016) 90–95
Contents lists available at ScienceDirect
Cytokine journal homepage: www.journals.elsevier.com/cytokine
Normalization of mucosal tumor necrosis factor-a: A new criterion for discontinuing infliximab therapy in ulcerative colitis Trine Olsen ⇑, Renathe Rismo, Mona Dixon Gundersen, Eyvind J. Paulssen, Knut Johnsen, Jan-Magnus Kvamme, Rasmus Goll, Jon Florholmen Research group of Gastroenterology and Nutrition, Department of Clinical Medicine, UiT The Arctic University of Norway, Tromsø, Norway
a r t i c l e
i n f o
Article history: Received 7 July 2015 Received in revised form 24 November 2015 Accepted 29 December 2015 Available online 8 January 2016 Keywords: Biomarker IBD IL-17 Interferon-c Tumor necrosis factor-a
a b s t r a c t Background: Biological agents such as anti-tumor necrosis factor (TNF) induce remission in ulcerative colitis. There is however no consensus regarding the discontinuation of this treatment. Aim: The aim of this study is to assess whether clinical parameters and mucosal cytokine mRNAs in healed colonic mucosa can predict long-term remission in ulcerative colitis following discontinuation of infliximab (IFX) therapy. Methods: The prospective Tromsø Inflammatory Bowel Disease (IBD) Study is based on an intensified induction treatment algorithm with IFX to achieve disease remission. Following clinical and endoscopic remission, IFX treatment was discontinued, and follow-up until relapse was performed. Patients who achieved clinical and endoscopic remission following an induction course of IFX were included. Expression levels of TNF alpha (TNF), interferon gamma (IFNG), interleukin (IL) 6 (IL6), IL17A, IL23, and transforming growth factor beta (TGFB) were quantified by real-time PCR in mucosal biopsies obtained at colonoscopy. Remission was defined as Ulcerative Colitis Disease Activity Index (UCDAI) below 3, and an endoscopic sub-score of 0–1. Relapse was defined as UCDAI score >3 and endoscopic sub-score >1. Mucosal cytokine transcript levels from 20 non-IBD patients with a normal colonoscopy served as control group. Results: Of the 45 patients included, twenty patients (44%) had normalized levels of mucosal TNF expression at the time of mucosal healing, whereas 35 of 42 (83%) had normalized IL17A expression levels, and 31 of 36 (86%) had normalized IFNG expression levels. The median time to relapse was 8 months (range 4–12). Normalization of TNF gene expression predicted 20 months (1–39) relapse-free survival after withdrawal of IFX compared to 5 months (3–7) in the group with elevated TNF expression. Mucosal expression levels of IL17A, IL23, IFNG, TGFB, IL6 did not predict long-term remission (>12 months) Conclusion: Normalization of mucosal TNF predicts long-term remission after discontinuation of IFX. Ó 2016 Published by Elsevier Ltd.
1. Introduction The treatment efficacy of inflammatory bowel disease (IBD) has been highly improved after the introduction of anti-tumor necrosis factor (TNF) such as infliximab in ulcerative colitis (UC) [1] and Crohn’s disease (CD) [2], adalimumab in UC [3] and CD [4], golimumab in UC [5] and certolizumab in CD [6]. In cases where anti-TNF treatment does not induce a cure of the disease, most patients receive maintenance therapy for at least the first year after
⇑ Corresponding author. E-mail addresses: [email protected] (T. Olsen), [email protected] (R. Rismo), [email protected] (M.D. Gundersen), eyvind.j.paulssen@uit. no (E.J. Paulssen), [email protected] (K. Johnsen), jan.magnus. [email protected] (J.-M. Kvamme), [email protected] (R. Goll), jon.florholmen@unn. no (J. Florholmen). http://dx.doi.org/10.1016/j.cyto.2015.12.021 1043-4666/Ó 2016 Published by Elsevier Ltd.
the induction period. Interestingly, after one year on anti-TNF maintenance treatment, 15–27% of patients on placebo still have a healed mucosa compared to 25–46% in the active group in UC [1,3,5,7], and from 0% to 18% in the placebo group compared to 10–44% in the active group in CD [6,8–10]. This implies that some patients are not in need of maintenance therapy during the first year after induction therapy. The main unresolved question is, who are they? A few studies describe the risk of relapse after withdrawal of anti-TNF agents in CD and UC patients. In two prospective studies of CD, 60% [11], and 46% [12] were still in remission after 1 year with concomitant immunosuppressive (IS) treatment. In two retrospective IBD studies the remission rate after discontinuation of anti-TNF was 35% after 7 years in CD [13], 61% in CD and 75% in UC after 1 year [14]; and finally, in an prospective observational study 55% of CD patients were in remission after 1 year [15] (for
91
T. Olsen et al. / Cytokine 79 (2016) 90–95
review, see [16]). So far there is no general agreement on when to discontinue ongoing anti-TNF therapy in IBD. As far as we know, one guideline from 2015 recommends withdrawal of anti-TNF therapy – the English NICE guideline recommends that withdrawal should be considered for patients who have been in stable clinical remission for 12 months [17]. The prospective Tromsø IBD study is based on a treatment algorithm with an intensified induction course of biological therapy (anti-TNF) to achieve endoscopic remission, followed by discontinuation of anti-TNF treatment. The study aim is to define criteria for discontinuing biological therapy. The first report was published in 2013 showing that normalized mucosal gene expression levels of TNF and IL17A predicted a longer time to relapse after discontinuing adalimumab in CD. The median time to relapse for elevated and normal mucosal TNF expression following cessation of adalimumab was 20 and 68 weeks, respectively [18]. In this study we report the results of the Tromsø IBD study design as described below for UC patients treated to disease remission and, and the search for biomarkers for discontinuation of IFX. 2. Methods 2.1. Patients The present study is based on a treatment algorithm with an intensified induction therapy to induce remission by biological therapy (anti-TNF), followed by withdrawal of biological therapy. The recruited subjects were patients with moderate to severe UC, treatment-dependent or resistant to steroid. Infliximab (IFX). 5 mg/kg (Remicade; Centocor Inc., Horsham, Pa., USA) was given as repeated infusions at 0, 2 and 6 week and then every 4 weeks until endoscopic remission. The UC diagnosis was based on established clinical, endoscopic and histological criteria [19]. Patients in disease remission (see below) following 2 or more infusions with IFX were included. Response to therapy was evaluated by clinical examination and colonoscopy 2–6 weeks after the last IFX infusion. Remission was defined as a reduction of the UCDAI score to less than 3 in addition to a reduction of the endoscopic sub-score to 0 or 1 [20]. Patients with severe co-morbidity were excluded. Following clinical and endoscopic remission, IFX therapy was discontinued and patients were followed-up with regular clinical evaluations. Relapse was defined using endoscopic and clinical disease activity indices (UCDAI-score >3 and endoscopic score >1) [21]. The patients were followed-up in a period of up to 104 months. Demographic data and co-medication are listed in Table 1. Biopsies from subjects with a normal colonoscopy and normal colonic histological examination served as controls. All participants were informed and gave written consent. The Regional Committee of Medical Ethics of North Norway and the Norwegian Social Science Data Services approved the study and the storage of biological material (ID: P REK NORD 14/2004). 2.2. Tissue samples Colonic mucosal biopsies at remission (2 biopsies from each patient) were sampled from the bowel region previously showing the most severe inflammation. Biopsy specimens for RNA extraction were immediately immersed in RNA later (Ambion Inc, Austin, USA) and stored at 4 °C overnight. 2.3. Cytokine gene expression Real-time PCR procedures have previously been described in detail [22,23] RNA was extracted from biopsies by the Trizol
Table 1 Demographic data in patients with inflammatory bowel disease treated with intensified induction therapy of infliximab until remission. Female/male (number) Age Duration of disease (years) Baseline CRP UCDAI before IFX (mean) UCDAI after IFX (mean) Endoscopic pre-score (mean) Endoscopic post-score (mean) Infusions of IFX (mean) Pre-calprotectin (lg/g) Post-calprotectin (lg/g) Medication at start 5ASAa Steroids Immunosuppressivea
16/29 36 (15–70) 5 (0–17) 5.5 (0–97) 10.1 (6–12) 1.6 (0–2) (P < 0.0005b) 2.7 (1–3) 0.7 (0–1) (P < 0.0005b) 3.8 (2–9) 2100 (210–2500) 65 (20–270) (P < 0.0005b) 43/45 (93%) 41/45 (85%) 38/45 (84%)
Values are median (range) if not other indicated. a Medication throughout induction period and after discontinuation of infliximab. b Pre- and post comparisons; Wilcoxon signed rank.
method (Invitrogen, Paisley, UK). Total RNA concentration was measured at 260 nm with U-1500 UV/Vis spectrophotometer (Hitachi Instruments Inc, San Jose, CA, USA). Reverse transcription of total RNA was performed by iScript (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Levels of mRNA for TNF, IL-17, IL-23, IFN-c, TGF-b, IL-6 and beta-actin (ACTB) (house-keeping gene) were determined in duplicates by real-time quantitative RT-PCR using TaqMan chemistry (Applied Biosystems, Foster City, CA, USA) and a standardized threshold value. Except for the IFNG assay, all assays were in-house; primer sequences are listed in Table 2. Stability of ACTB as housekeeping gene in the present context has been ascertained earlier [23,24]. The CT values were analyzed according to the delta-delta-CT method [25]. 2.4. Statistics UCDAI scores defined outcome and relapse. Post-treatment remission was strictly defined as UCDAI less than 3 with endoscopic sub score of 0 or 1. Cytokine transcript levels were analyzed as ‘‘normalization/not normalization” as defined by the 97.5th percentile of the normal controls. Time to relapse was analyzed using Kaplan–Meier survival analysis, and different potential predictors were tested. Factors showing a Log-Rank P < 0.10 were then analyzed in a multiple regression by Cox proportional hazard analysis. The resulting model was then reduced until all remaining predictors were significant. However, due to the small sample size, the number of covariates we were able to include in the model was limited. P-values below 0.05 were considered significant. All statistical analyses were performed in IBM SPSS Statistics 22. 3. Results 3.1. Study population Forty-five patients in endoscopic and clinical remission after IFX induction treatment were included. After discontinuation of IFX therapy patients were followed up with regular clinical evaluations. IBD co-medication at start of the IFX induction treatment is shown in Table 1, where the 5ASA and immunosuppressive agents (azathioprine or methotrexate) were continued during the induction period and after discontinuation of IFX. The steroids were stopped in all patients during the initial induction period of IFX. Other demographic and clinical data are presented in Table 1.
92
T. Olsen et al. / Cytokine 79 (2016) 90–95
Table 2 Primer sequences. Gene-bank ID
Forward primer sequence 50 –30 Reverse primer
TNF
CACGCTCTTCTGCCTGCTG CCAGAGGGAAGAGTTCCCCAGGGAC GATGATCTGACTGCCTGGGC FAM – BHQ TGATTGGAAGAAACAACGATGACT TGGTGTCACTGCTACTGCTGCTGAGC ATTGTGATTCCTGCCTTCACTATG FAM – BHQ CCCAAGGACTCAGGGACAAC TCAGTTCTGCTTGCAAAGGATCCACCAG TCCTAGCAGCTTCTCATAAAAAATCA FAM – BHQ CCAGGAGCCCAGCTATGAAC CCTTCTCCACAAGCGCCTTCGGT CCCAGGGAGAAGGCAACTG FAM – TAMRA CTGCTGAGGCTCAAGTTAAAAGTG CAGCACGTGGAGCTGTACCAGAAATACAGC TGAGGTATCGCCAGGAATTGT FAM – BHQ Assay design from Applied Biosystems Ref No. Hs00174143_m1
IL17A IL23 IL6 TGFB1 IFNG
Probe sequence 50 –30 Conjugation
Reference sequence NM_000594.3 NM_002190.2 NM_016584.2 NM_000600.3 NM_000660.3
Primer sequences were designed in primer express.
3.2. Time to relapse and survival analyses The median time to relapse was 8 months (4–12). None of the factors age, smoking, duration of disease, faecal calprotectin at discontinuation, or immunosuppressive co-medication were predictors of relapse (data not shown). We performed subgroup analyses according to mucosal cytokine gene expression at the time of IFX discontinuation. Cut-off for normalization of cytokine gene expression in UC patients was defined by the upper bound of the 95% CI for mean CT value of each cytokine measured in samples from control patients. Of 45 patients, 20 had normalized TNF expression levels at the time of mucosal healing, whereas 31/36, 16/20, 35/42, 36/43 and 17/24 had normalized IFNG, IL-6, IL-17, IL23 and TGFB expression levels, respectively (for some subjects not all cytokine gene expressions were measurable due to lack of cDNA resulting in several missing values) We then performed Kaplan Meier survival analysis for the 45 patients in subcategories as defined by normalization/not normalization of the cytokine gene expression. This is presented in Figs. 1–3 for TNF, IL-17 and IFNG. Normalization of TNF gene expression predicted 20 months (1–39) relapse free survival after discontinuation of IFX The corresponding value was 5 months (3–7) in the group with a higher than normal TNF-a expression at the time of endoscopic remission. In similar way, relapse free survival periods for IL-17 and IFG are shown in Figs. 2 and 3, respectively. Sex was also a near significant predictor (Log Rank P = 0.14; Breslow P = 0.04) in favor of longer relapse free survival period for women. To explore this further, a Cox regression model was constructed adding TNF and sex as predictors. Both variables were significant, and the result is shown in Fig. 4 (see Table 3). Mucosal expressions of IFNG, IL-6, IL-17, IL-23 and TGFB did not predict long term remission (defined as median remission >12 months) (data not shown). 4. Discussion In the present study we have demonstrated that normalization of mucosal gene expression levels of TNF predicts sustained remission following discontinuation of IFX therapy in patients with UC treated to endoscopic remission. The median relapse-free survival time for the group with normalized mucosal TNF was 20 months versus 5 months for the group with increased TNF. This indicates an additional criterion for when to discontinue anti-TNF treatment in patients with UC. Anti TNF- therapy has been a great step forward in the treatment of IBD. Still there are several unresolved questions concerning the details in the management of IBD patients, including
Fig. 1. Kaplan–Meier plot of relapse-free survival according to normalization or not of mucosal gene transcript of TNF after discontinuation of infliximab in patients with ulcerative colitis in remission. The median survival time for the group with normalized TNF was 20 months (1–39) versus 5 months (3–7) for the group with increased TNF.
whether or not to discontinue anti-TNF therapy, and if so when? According to the English NICE guidelines discontinuation of antiTNF treatment should be considered for patients who have been in stable clinical remission for 12 months [17]. In the few studies reported [11–15], discontinuing anti-TNF in CD resulted in disease remission for 6–12 months. In the current study, and a previous reported study in CD from our group [18], anti-TNF was stopped after achieving disease remission with an endoscopic sub score of 0–1. A healed mucosa represents a new treatment goal in the management of IBD [26], and is associated with an improved long term prognosis both for UC [27,28] and CD [29,30]. In our study no time period of remission was required before anti-TNF therapy was discontinued/stopped. The medium time to relapse was 8 months (95% CI 4–12), in the same range as reported in other studies [11–16]. In these studies clinical risk factors for relapse included sex (male), increased CRP [12] and long-term duration of disease [14]. In our study we also found an association with sex; being female was independently associated with a long-term remission
T. Olsen et al. / Cytokine 79 (2016) 90–95
Fig. 2. Kaplan–Meier plot of relapse-free survival according to normalization or not of mucosal gene transcript of IL17A after discontinuation of infliximab in patients with ulcerative colitis in remission. The median survival time for the group with normalized IL17A was 10 months (6–14) versus 5 months (3–7) for the group with increased IL17A.
Fig. 3. Kaplan–Meier plot of relapse-free survival according to normalization or not of mucosal gene transcript of IFNG after discontinuation of infliximab in patients with ulcerative colitis in remission. The median survival time for the group with normalized IFNG was 9 months (4–14) versus 5 months (1–5) for the group with increased IFNG.
period. Unfortunately, biopsies for histological examination were not taken regularly at remission. This is due to the fact that there is no agreement on the definition of mucosal healing on the histological level [31] but this should be validated in future studies (for
93
Fig. 4. Cox regression plot of relapse-free survival according to normalization or not of mucosal gene transcript of TNF after discontinuation of infliximab in patients with ulcerative colitis in remission. The plot is stratified according to mucosal TNF transcript, corrected for the effects of sex (model P = 0.010). Sex shoved a HR of 2.3 (1.1–4.7) indicating increased risk of relapse for men (P = 0.025). Age was not a significant predictor and was removed from the model.
review, see [32]). Of special interest was the finding that normalization of mucosal gene transcript of TNF was a predictor of long term remission. When mucosal gene transcript of TNF was normalized, the median time to relapse was 20 months versus 5 months in the group with elevated mucosal TNF transcripts. Similar results were reported in another study from our group in CD patients where the median time to relapse was 17 months and 5 months, for normalized and elevated mucosal TNF transcripts, respectively [18]. Based on previous reports, [11–15] an endoscopic normalized mucosa should be one of the criteria included in defining stop-criteria for biologic agents in IBD. This study in UC, and the previous reported study in CD from our group [18], we propose an additional criterion: normalization of mucosal TNF expression. In this study IFNG and IL17A were also significant predictors in the Kaplan–Meier analysis; however the median time to relapse was less than 12 months for patients with normalization of these mediators. We did not find any significant prediction for normalization of the mucosal transcripts for IL-6, IL-23 and TGFB, all main mediators of the inflammatory process in IBD [33]. This may be explained by a lack of power, due to small number of observations. The results are in keeping with our hypothesis that the down regulation of some of the main inflammatory pathways in IBD predict long term disease remission, and should be included as a new treatment goal. The concept of immunological remission was introduced in 2012.1 Various immune molecules in blood have been used, and normalization of these parameters has been described as ‘‘biochemical healing” [34]. A further transomic approach including genomics, proteomics and metabolomics factors to define a set of fingerprints for long-term remission after discontinuing biologics in IBD should be performed, and is ongoing in our group [35]. Therefore, the concept of immunological mucosal healing could be the new treatment goal in IBD, and as natural follow-up of the English NICE recommendations [17].
1
Florholmen J, Nordic Meeting in Gastroenterology, June 2012, Reykjavik, Iceland.
94
T. Olsen et al. / Cytokine 79 (2016) 90–95
Table 3 Mucosal gene expression relative to normal controls. Cytokine gene
Relapse within 12 months
TNF
Yes No Yes No Yes No Yes No Yes No Yes No
IL17 IL23 IFN TGF IL6
Pre treatment
Post treatment
P (ANOVA)
Estimate
P (ANOVA)
Estimate
<0.0005
2.7 (1.6–4.6)⁄ 4.5 (2.2–9.2)⁄ 37.0 (13.5–101.3)⁄ 74.2 (20.2–273)⁄ 4.3 (1.5–12.1)⁄ 3.7 (1.0–14.1) 7.0 (2.1–23.0)⁄ 7.1 (1.6–31.0)⁄ 1.8 (1.2–2.7)⁄ 3.2 (1.9–5.4)⁄ 58.0 (13.3–253.0)⁄ 23.6 (4.1–136.6)⁄
0.021
1.7 1.2 4.1 2.9 2.4 2.5 3.3 0.9 1.2 1.4 4.3 2.7
<0.0005 0.001 <0.0005 <0.0005 <0.0005
0.002 0.004 0.013 0.226 0.100
(1.1–2.7)⁄ (0.6–2.5) (1.6–10.6)⁄ (0.7–12.3) (1.2–4.7)⁄ (0.9–6.6) (1.2–9.0)⁄ (0.2–4.9) (0.8–1.8) (0.8–2.5) (0.8–22.9) (0.3–20.8)
Factor difference in mRNA levels compared to normal controls. Values are mean difference (95% CI of mean). Asterisk denotes significant difference from normal controls (oneway ANOVA; Bonferroni corrected posthoc comparison)
5. Conclusion Normalization of mucosal TNF transcript may be an important criterion in the evaluation of when to discontinue treatment with IFX in UC. Declaration of interest None. Acknowledgements We thank Marian Remijn, Line Wilsgaard and Ingrid Christiansen for expert technical assistance. This Project was supported by the Northern Norway Regional Health Authorities. References [1] P. Rutgeerts, W.J. Sandborn, B.G. Feagan, W. Reinisch, A. Olson, J. Johanns, et al., Infliximab for induction and maintenance therapy for ulcerative colitis, N. Engl. J. Med. 353 (2005) 2462–2476, http://dx.doi.org/10.1056/ NEJMoa050516. [2] S.R. Targan, S.B. Hanauer, S.J. van Deventer, L. Mayer, D.H. Present, T. Braakman, et al., A short-term study of chimeric monoclonal antibody cA2 to tumor necrosis factor alpha for Crohn’s disease. Crohn’s disease cA2 study group, N. Engl. J. Med. 337 (1997) 1029–1035, http://dx.doi.org/10.1056/ NEJM199710093371502. [3] W.J. Sandborn, G. van Assche, W. Reinisch, J.-F. Colombel, G. D’Haens, D.C. Wolf, et al., Adalimumab induces and maintains clinical remission in patients with moderate-to-severe ulcerative colitis, Gastroenterology 142 (2012) 257– 265, http://dx.doi.org/10.1053/j.gastro.2011.10.032. e1-3. [4] J. Colombel, W.J. Sandborn, P. Rutgeerts, R. Enns, S.B. Hanauer, R. Panaccione, et al., Adalimumab for maintenance of clinical response and remission in patients with Crohn’s disease: the CHARM trial, Gastroenterology 132 (2007) 52–65, http://dx.doi.org/10.1053/j.gastro.2006.11.041. [5] W.J. Sandborn, B.G. Feagan, C. Marano, H. Zhang, R. Strauss, J. Johanns, et al., Subcutaneous golimumab maintains clinical response in patients with moderate-to-severe ulcerative colitis, Gastroenterology 146 (2014) 96–109, http://dx.doi.org/10.1053/j.gastro.2013.06.010. e1. [6] X. Hébuterne, M. Lémann, Y. Bouhnik, O. Dewit, J.-L. Dupas, M. Mross, et al., Endoscopic improvement of mucosal lesions in patients with moderate to severe ileocolonic Crohn’s disease following treatment with certolizumab pegol, Gut 62 (2013) 201–208, http://dx.doi.org/10.1136/gutjnl-2012-302262. [7] B.G. Feagan, P. Rutgeerts, B.E. Sands, S. Hanauer, J.-F. Colombel, W.J. Sandborn, et al., Vedolizumab as induction and maintenance therapy for ulcerative colitis, N. Engl. J. Med. 369 (2013) 699–710, http://dx.doi.org/10.1056/ NEJMoa1215734. [8] P. Rutgeerts, B.G. Feagan, G.R. Lichtenstein, L.F. Mayer, S. Schreiber, J.F. Colombel, et al., Comparison of scheduled and episodic treatment strategies of infliximab in Crohn’s disease, Gastroenterology 126 (2004) 402–413. [9] J.F. Colombel, W.J. Sandborn, W. Reinisch, G.J. Mantzaris, A. Kornbluth, D. Rachmilewitz, et al., Infliximab, azathioprine, or combination therapy for Crohn’s disease, N. Engl. J. Med. 362 (2010) 1383–1395, http://dx.doi.org/ 10.1056/NEJMoa0904492.
[10] P. Rutgeerts, G. Van Assche, W.J. Sandborn, D.C. Wolf, K. Geboes, J.-F. Colombel, et al., Adalimumab induces and maintains mucosal healing in patients with Crohn’s disease: data from the EXTEND trial, Gastroenterology 142 (2012) 1102–1111, http://dx.doi.org/10.1053/j.gastro.2012.01.035. e2. [11] M. Lémann, J.-Y. Mary, B. Duclos, M. Veyrac, J.-L. Dupas, J.C. Delchier, et al., Infliximab plus azathioprine for steroid-dependent Crohn’s disease patients: a randomized placebo-controlled trial, Gastroenterology 130 (2006) 1054–1061, http://dx.doi.org/10.1053/j.gastro.2006.02.014. [12] E. Louis, J.-Y. Mary, G. Vernier-Massouille, J.-C. Grimaud, Y. Bouhnik, D. Laharie, et al., Maintenance of remission among patients with Crohn’s disease on antimetabolite therapy after infliximab therapy is stopped, Gastroenterology 142 (2012) 63–70, http://dx.doi.org/10.1053/j.gastro.2011.09.034. e5; quiz e31. [13] A.W.G. Waugh, S. Garg, K. Matic, L. Gramlich, C. Wong, D.C. Sadowski, et al., Maintenance of clinical benefit in Crohn’s disease patients after discontinuation of infliximab: long-term follow-up of a single centre cohort, Aliment. Pharmacol. Ther. 32 (2010) 1129–1134, http://dx.doi.org/10.1111/ j.1365-2036.2010.04446.x. [14] C. Steenholdt, A. Molazahi, M.A. Ainsworth, J. Brynskov, O. Østergaard Thomsen, J.B. Seidelin, Outcome after discontinuation of infliximab in patients with inflammatory bowel disease in clinical remission: an observational Danish single center study, Scand. J. Gastroenterol. 47 (2012) 518–527, http://dx.doi.org/10.3109/00365521.2012.660541. [15] T. Molnár, P.L. Lakatos, K. Farkas, F. Nagy, Z. Szepes, P. Miheller, et al., Predictors of relapse in patients with Crohn’s disease in remission after 1 year of biological therapy, Aliment. Pharmacol. Ther. 37 (2013) 225–233, http://dx. doi.org/10.1111/apt.12160. [16] B. Pariente, D. Laharie, Review article: why, when and how to de-escalate therapy in inflammatory bowel diseases, Aliment. Pharmacol. Ther. 40 (2014) 338–353, http://dx.doi.org/10.1111/apt.12838. [17] Infliximab, adalimumab and golimumab for treating moderately to severely active ulcerative colitis after the failure of conventional therapy |Guidance and guidelines| NICE, (n.d.). [18] R. Rismo, T. Olsen, G. Cui, E.J. Paulssen, I. Christiansen, K. Johnsen, et al., Normalization of mucosal cytokine gene expression levels predicts long-term remission after discontinuation of anti-TNF therapy in Crohn’s disease, Scand. J. Gastroenterol. 48 (2013) 311–319, http://dx.doi.org/10.3109/ 00365521.2012.758773. [19] B.E. Sands, From symptom to diagnosis: clinical distinctions among various forms of intestinal inflammation, Gastroenterology 126 (2004) 1518–1532. [20] G. D’Haens, W.J. Sandborn, B.G. Feagan, K. Geboes, S.B. Hanauer, E.J. Irvine, et al., A review of activity indices and efficacy end points for clinical trials of medical therapy in adults with ulcerative colitis, Gastroenterology 132 (2007) 763–786, http://dx.doi.org/10.1053/j.gastro.2006.12.038. [21] A. Nilsson, A. Danielsson, R. Löfberg, P. Benno, L. Bergman, O. Fausa, et al., Olsalazine versus sulphasalazine for relapse prevention in ulcerative colitis: a multicenter study, Am. J. Gastroenterol. 90 (1995) 381–387. [22] G. Cui, T. Olsen, I. Christiansen, B. Vonen, J. Florholmen, R. Goll, Improvement of real-time polymerase chain reaction for quantifying TNF-alpha mRNA expression in inflamed colorectal mucosa: an approach to optimize procedures for clinical use, Scand. J. Clin. Lab. Invest. 66 (2006) 249–259, http://dx.doi.org/ 10.1080/00365510600590472. [23] T. Olsen, R. Goll, G. Cui, A. Husebekk, B. Vonen, G.S. Birketvedt, et al., Tissue levels of tumor necrosis factor-alpha correlates with grade of inflammation in untreated ulcerative colitis, Scand. J. Gastroenterol. 42 (2007) 1312–1320, http://dx.doi.org/10.1080/00365520701409035. [24] R. Goll, T. Olsen, G. Cui, J. Florholmen, Evaluation of absolute quantitation by nonlinear regression in probe-based real-time PCR, BMC Bioinformatics 7 (2006) 107. [25] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C (T) method, Nat. Protoc. 3 (2008) 1101–1108.
T. Olsen et al. / Cytokine 79 (2016) 90–95 [26] F. Baert, L. Moortgat, G. Van Assche, P. Caenepeel, P. Vergauwe, M. De Vos, et al., Mucosal healing predicts sustained clinical remission in patients with early-stage Crohn’s disease, Gastroenterology 138 (2010) 463–468, http://dx. doi.org/10.1053/j.gastro.2009.09.056. quiz e10–1. [27] I.C. Solberg, I. Lygren, J. Jahnsen, E. Aadland, O. Høie, M. Cvancarova, et al., Clinical course during the first 10 years of ulcerative colitis: results from a population-based inception cohort (IBSEN Study), Scand. J. Gastroenterol. 44 (2009) 431–440, http://dx.doi.org/10.1080/00365520802600961. [28] J.F. Colombel, P. Rutgeerts, W. Reinisch, D. Esser, Y. Wang, Y. Lang, et al., Early mucosal healing with infliximab is associated with improved long-term clinical outcomes in ulcerative colitis, Gastroenterology 141 (2011) 1194– 1201, http://dx.doi.org/10.1053/j.gastro.2011.06.054. [29] P. Rutgeerts, R.H. Diamond, M. Bala, A. Olson, G.R. Lichtenstein, W. Bao, et al., Scheduled maintenance treatment with infliximab is superior to episodic treatment for the healing of mucosal ulceration associated with Crohn’s disease, Gastrointest. Endosc. 63 (2006) 433–442, http://dx.doi.org/10.1016/j. gie.2005.08.011. quiz 464. [30] F. Schnitzler, H. Fidder, M. Ferrante, M. Noman, I. Arijs, G. Van Assche, et al., Mucosal healing predicts long-term outcome of maintenance therapy with infliximab in Crohn’s disease, Inflamm. Bowel Dis. 15 (2009) 1295–1301, http://dx.doi.org/10.1002/ibd.20927.
95
[31] M. Daperno, F. Castiglione, L. de Ridder, I. Dotan, M. Färkkilä, J. Florholmen, et al., Results of the 2nd part scientific workshop of the ECCO. II: Measures and markers of prediction to achieve, detect, and monitor intestinal healing in inflammatory bowel disease, J. Crohns. Colitis. 5 (2011) 484–498, http://dx.doi. org/10.1016/j.crohns.2011.07.003. [32] J. Florholmen, Mucosal healing in the era of biologic agents in treatment of inflammatory bowel disease, Scand. J. Gastroenterol. 50 (2015) 43–52, http:// dx.doi.org/10.3109/00365521.2014.977943. [33] J. Florholmen, W. Fries, Candidate mucosal and surrogate biomarkers of inflammatory bowel disease in the era of new technology, Scand. J. Gastroenterol. 46 (2011) 1407–1417, http://dx.doi.org/10.3109/ 00365521.2011.627449. [34] L. Rosenberg, K.S. Nanda, T. Zenlea, A. Gifford, G.O. Lawlor, K.R. Falchuk, et al., Histologic markers of inflammation in patients with ulcerative colitis in clinical remission, Clin. Gastroenterol. Hepatol. 11 (2013) 991–996, http://dx. doi.org/10.1016/j.cgh.2013.02.030. [35] R. Paulssen, R. Goll, J. Florholmen, Pan European Networks Ltd., (n.d.). (accessed 21.11.15).
Contents lists available at ScienceDirect
Cytokine journal homepage: www.journals.elsevier.com/cytokine
Normalization of mucosal tumor necrosis factor-a: A new criterion for discontinuing infliximab therapy in ulcerative colitis Trine Olsen ⇑, Renathe Rismo, Mona Dixon Gundersen, Eyvind J. Paulssen, Knut Johnsen, Jan-Magnus Kvamme, Rasmus Goll, Jon Florholmen Research group of Gastroenterology and Nutrition, Department of Clinical Medicine, UiT The Arctic University of Norway, Tromsø, Norway
a r t i c l e
i n f o
Article history: Received 7 July 2015 Received in revised form 24 November 2015 Accepted 29 December 2015 Available online 8 January 2016 Keywords: Biomarker IBD IL-17 Interferon-c Tumor necrosis factor-a
a b s t r a c t Background: Biological agents such as anti-tumor necrosis factor (TNF) induce remission in ulcerative colitis. There is however no consensus regarding the discontinuation of this treatment. Aim: The aim of this study is to assess whether clinical parameters and mucosal cytokine mRNAs in healed colonic mucosa can predict long-term remission in ulcerative colitis following discontinuation of infliximab (IFX) therapy. Methods: The prospective Tromsø Inflammatory Bowel Disease (IBD) Study is based on an intensified induction treatment algorithm with IFX to achieve disease remission. Following clinical and endoscopic remission, IFX treatment was discontinued, and follow-up until relapse was performed. Patients who achieved clinical and endoscopic remission following an induction course of IFX were included. Expression levels of TNF alpha (TNF), interferon gamma (IFNG), interleukin (IL) 6 (IL6), IL17A, IL23, and transforming growth factor beta (TGFB) were quantified by real-time PCR in mucosal biopsies obtained at colonoscopy. Remission was defined as Ulcerative Colitis Disease Activity Index (UCDAI) below 3, and an endoscopic sub-score of 0–1. Relapse was defined as UCDAI score >3 and endoscopic sub-score >1. Mucosal cytokine transcript levels from 20 non-IBD patients with a normal colonoscopy served as control group. Results: Of the 45 patients included, twenty patients (44%) had normalized levels of mucosal TNF expression at the time of mucosal healing, whereas 35 of 42 (83%) had normalized IL17A expression levels, and 31 of 36 (86%) had normalized IFNG expression levels. The median time to relapse was 8 months (range 4–12). Normalization of TNF gene expression predicted 20 months (1–39) relapse-free survival after withdrawal of IFX compared to 5 months (3–7) in the group with elevated TNF expression. Mucosal expression levels of IL17A, IL23, IFNG, TGFB, IL6 did not predict long-term remission (>12 months) Conclusion: Normalization of mucosal TNF predicts long-term remission after discontinuation of IFX. Ó 2016 Published by Elsevier Ltd.
1. Introduction The treatment efficacy of inflammatory bowel disease (IBD) has been highly improved after the introduction of anti-tumor necrosis factor (TNF) such as infliximab in ulcerative colitis (UC) [1] and Crohn’s disease (CD) [2], adalimumab in UC [3] and CD [4], golimumab in UC [5] and certolizumab in CD [6]. In cases where anti-TNF treatment does not induce a cure of the disease, most patients receive maintenance therapy for at least the first year after
⇑ Corresponding author. E-mail addresses: [email protected] (T. Olsen), [email protected] (R. Rismo), [email protected] (M.D. Gundersen), eyvind.j.paulssen@uit. no (E.J. Paulssen), [email protected] (K. Johnsen), jan.magnus. [email protected] (J.-M. Kvamme), [email protected] (R. Goll), jon.florholmen@unn. no (J. Florholmen). http://dx.doi.org/10.1016/j.cyto.2015.12.021 1043-4666/Ó 2016 Published by Elsevier Ltd.
the induction period. Interestingly, after one year on anti-TNF maintenance treatment, 15–27% of patients on placebo still have a healed mucosa compared to 25–46% in the active group in UC [1,3,5,7], and from 0% to 18% in the placebo group compared to 10–44% in the active group in CD [6,8–10]. This implies that some patients are not in need of maintenance therapy during the first year after induction therapy. The main unresolved question is, who are they? A few studies describe the risk of relapse after withdrawal of anti-TNF agents in CD and UC patients. In two prospective studies of CD, 60% [11], and 46% [12] were still in remission after 1 year with concomitant immunosuppressive (IS) treatment. In two retrospective IBD studies the remission rate after discontinuation of anti-TNF was 35% after 7 years in CD [13], 61% in CD and 75% in UC after 1 year [14]; and finally, in an prospective observational study 55% of CD patients were in remission after 1 year [15] (for
91
T. Olsen et al. / Cytokine 79 (2016) 90–95
review, see [16]). So far there is no general agreement on when to discontinue ongoing anti-TNF therapy in IBD. As far as we know, one guideline from 2015 recommends withdrawal of anti-TNF therapy – the English NICE guideline recommends that withdrawal should be considered for patients who have been in stable clinical remission for 12 months [17]. The prospective Tromsø IBD study is based on a treatment algorithm with an intensified induction course of biological therapy (anti-TNF) to achieve endoscopic remission, followed by discontinuation of anti-TNF treatment. The study aim is to define criteria for discontinuing biological therapy. The first report was published in 2013 showing that normalized mucosal gene expression levels of TNF and IL17A predicted a longer time to relapse after discontinuing adalimumab in CD. The median time to relapse for elevated and normal mucosal TNF expression following cessation of adalimumab was 20 and 68 weeks, respectively [18]. In this study we report the results of the Tromsø IBD study design as described below for UC patients treated to disease remission and, and the search for biomarkers for discontinuation of IFX. 2. Methods 2.1. Patients The present study is based on a treatment algorithm with an intensified induction therapy to induce remission by biological therapy (anti-TNF), followed by withdrawal of biological therapy. The recruited subjects were patients with moderate to severe UC, treatment-dependent or resistant to steroid. Infliximab (IFX). 5 mg/kg (Remicade; Centocor Inc., Horsham, Pa., USA) was given as repeated infusions at 0, 2 and 6 week and then every 4 weeks until endoscopic remission. The UC diagnosis was based on established clinical, endoscopic and histological criteria [19]. Patients in disease remission (see below) following 2 or more infusions with IFX were included. Response to therapy was evaluated by clinical examination and colonoscopy 2–6 weeks after the last IFX infusion. Remission was defined as a reduction of the UCDAI score to less than 3 in addition to a reduction of the endoscopic sub-score to 0 or 1 [20]. Patients with severe co-morbidity were excluded. Following clinical and endoscopic remission, IFX therapy was discontinued and patients were followed-up with regular clinical evaluations. Relapse was defined using endoscopic and clinical disease activity indices (UCDAI-score >3 and endoscopic score >1) [21]. The patients were followed-up in a period of up to 104 months. Demographic data and co-medication are listed in Table 1. Biopsies from subjects with a normal colonoscopy and normal colonic histological examination served as controls. All participants were informed and gave written consent. The Regional Committee of Medical Ethics of North Norway and the Norwegian Social Science Data Services approved the study and the storage of biological material (ID: P REK NORD 14/2004). 2.2. Tissue samples Colonic mucosal biopsies at remission (2 biopsies from each patient) were sampled from the bowel region previously showing the most severe inflammation. Biopsy specimens for RNA extraction were immediately immersed in RNA later (Ambion Inc, Austin, USA) and stored at 4 °C overnight. 2.3. Cytokine gene expression Real-time PCR procedures have previously been described in detail [22,23] RNA was extracted from biopsies by the Trizol
Table 1 Demographic data in patients with inflammatory bowel disease treated with intensified induction therapy of infliximab until remission. Female/male (number) Age Duration of disease (years) Baseline CRP UCDAI before IFX (mean) UCDAI after IFX (mean) Endoscopic pre-score (mean) Endoscopic post-score (mean) Infusions of IFX (mean) Pre-calprotectin (lg/g) Post-calprotectin (lg/g) Medication at start 5ASAa Steroids Immunosuppressivea
16/29 36 (15–70) 5 (0–17) 5.5 (0–97) 10.1 (6–12) 1.6 (0–2) (P < 0.0005b) 2.7 (1–3) 0.7 (0–1) (P < 0.0005b) 3.8 (2–9) 2100 (210–2500) 65 (20–270) (P < 0.0005b) 43/45 (93%) 41/45 (85%) 38/45 (84%)
Values are median (range) if not other indicated. a Medication throughout induction period and after discontinuation of infliximab. b Pre- and post comparisons; Wilcoxon signed rank.
method (Invitrogen, Paisley, UK). Total RNA concentration was measured at 260 nm with U-1500 UV/Vis spectrophotometer (Hitachi Instruments Inc, San Jose, CA, USA). Reverse transcription of total RNA was performed by iScript (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Levels of mRNA for TNF, IL-17, IL-23, IFN-c, TGF-b, IL-6 and beta-actin (ACTB) (house-keeping gene) were determined in duplicates by real-time quantitative RT-PCR using TaqMan chemistry (Applied Biosystems, Foster City, CA, USA) and a standardized threshold value. Except for the IFNG assay, all assays were in-house; primer sequences are listed in Table 2. Stability of ACTB as housekeeping gene in the present context has been ascertained earlier [23,24]. The CT values were analyzed according to the delta-delta-CT method [25]. 2.4. Statistics UCDAI scores defined outcome and relapse. Post-treatment remission was strictly defined as UCDAI less than 3 with endoscopic sub score of 0 or 1. Cytokine transcript levels were analyzed as ‘‘normalization/not normalization” as defined by the 97.5th percentile of the normal controls. Time to relapse was analyzed using Kaplan–Meier survival analysis, and different potential predictors were tested. Factors showing a Log-Rank P < 0.10 were then analyzed in a multiple regression by Cox proportional hazard analysis. The resulting model was then reduced until all remaining predictors were significant. However, due to the small sample size, the number of covariates we were able to include in the model was limited. P-values below 0.05 were considered significant. All statistical analyses were performed in IBM SPSS Statistics 22. 3. Results 3.1. Study population Forty-five patients in endoscopic and clinical remission after IFX induction treatment were included. After discontinuation of IFX therapy patients were followed up with regular clinical evaluations. IBD co-medication at start of the IFX induction treatment is shown in Table 1, where the 5ASA and immunosuppressive agents (azathioprine or methotrexate) were continued during the induction period and after discontinuation of IFX. The steroids were stopped in all patients during the initial induction period of IFX. Other demographic and clinical data are presented in Table 1.
92
T. Olsen et al. / Cytokine 79 (2016) 90–95
Table 2 Primer sequences. Gene-bank ID
Forward primer sequence 50 –30 Reverse primer
TNF
CACGCTCTTCTGCCTGCTG CCAGAGGGAAGAGTTCCCCAGGGAC GATGATCTGACTGCCTGGGC FAM – BHQ TGATTGGAAGAAACAACGATGACT TGGTGTCACTGCTACTGCTGCTGAGC ATTGTGATTCCTGCCTTCACTATG FAM – BHQ CCCAAGGACTCAGGGACAAC TCAGTTCTGCTTGCAAAGGATCCACCAG TCCTAGCAGCTTCTCATAAAAAATCA FAM – BHQ CCAGGAGCCCAGCTATGAAC CCTTCTCCACAAGCGCCTTCGGT CCCAGGGAGAAGGCAACTG FAM – TAMRA CTGCTGAGGCTCAAGTTAAAAGTG CAGCACGTGGAGCTGTACCAGAAATACAGC TGAGGTATCGCCAGGAATTGT FAM – BHQ Assay design from Applied Biosystems Ref No. Hs00174143_m1
IL17A IL23 IL6 TGFB1 IFNG
Probe sequence 50 –30 Conjugation
Reference sequence NM_000594.3 NM_002190.2 NM_016584.2 NM_000600.3 NM_000660.3
Primer sequences were designed in primer express.
3.2. Time to relapse and survival analyses The median time to relapse was 8 months (4–12). None of the factors age, smoking, duration of disease, faecal calprotectin at discontinuation, or immunosuppressive co-medication were predictors of relapse (data not shown). We performed subgroup analyses according to mucosal cytokine gene expression at the time of IFX discontinuation. Cut-off for normalization of cytokine gene expression in UC patients was defined by the upper bound of the 95% CI for mean CT value of each cytokine measured in samples from control patients. Of 45 patients, 20 had normalized TNF expression levels at the time of mucosal healing, whereas 31/36, 16/20, 35/42, 36/43 and 17/24 had normalized IFNG, IL-6, IL-17, IL23 and TGFB expression levels, respectively (for some subjects not all cytokine gene expressions were measurable due to lack of cDNA resulting in several missing values) We then performed Kaplan Meier survival analysis for the 45 patients in subcategories as defined by normalization/not normalization of the cytokine gene expression. This is presented in Figs. 1–3 for TNF, IL-17 and IFNG. Normalization of TNF gene expression predicted 20 months (1–39) relapse free survival after discontinuation of IFX The corresponding value was 5 months (3–7) in the group with a higher than normal TNF-a expression at the time of endoscopic remission. In similar way, relapse free survival periods for IL-17 and IFG are shown in Figs. 2 and 3, respectively. Sex was also a near significant predictor (Log Rank P = 0.14; Breslow P = 0.04) in favor of longer relapse free survival period for women. To explore this further, a Cox regression model was constructed adding TNF and sex as predictors. Both variables were significant, and the result is shown in Fig. 4 (see Table 3). Mucosal expressions of IFNG, IL-6, IL-17, IL-23 and TGFB did not predict long term remission (defined as median remission >12 months) (data not shown). 4. Discussion In the present study we have demonstrated that normalization of mucosal gene expression levels of TNF predicts sustained remission following discontinuation of IFX therapy in patients with UC treated to endoscopic remission. The median relapse-free survival time for the group with normalized mucosal TNF was 20 months versus 5 months for the group with increased TNF. This indicates an additional criterion for when to discontinue anti-TNF treatment in patients with UC. Anti TNF- therapy has been a great step forward in the treatment of IBD. Still there are several unresolved questions concerning the details in the management of IBD patients, including
Fig. 1. Kaplan–Meier plot of relapse-free survival according to normalization or not of mucosal gene transcript of TNF after discontinuation of infliximab in patients with ulcerative colitis in remission. The median survival time for the group with normalized TNF was 20 months (1–39) versus 5 months (3–7) for the group with increased TNF.
whether or not to discontinue anti-TNF therapy, and if so when? According to the English NICE guidelines discontinuation of antiTNF treatment should be considered for patients who have been in stable clinical remission for 12 months [17]. In the few studies reported [11–15], discontinuing anti-TNF in CD resulted in disease remission for 6–12 months. In the current study, and a previous reported study in CD from our group [18], anti-TNF was stopped after achieving disease remission with an endoscopic sub score of 0–1. A healed mucosa represents a new treatment goal in the management of IBD [26], and is associated with an improved long term prognosis both for UC [27,28] and CD [29,30]. In our study no time period of remission was required before anti-TNF therapy was discontinued/stopped. The medium time to relapse was 8 months (95% CI 4–12), in the same range as reported in other studies [11–16]. In these studies clinical risk factors for relapse included sex (male), increased CRP [12] and long-term duration of disease [14]. In our study we also found an association with sex; being female was independently associated with a long-term remission
T. Olsen et al. / Cytokine 79 (2016) 90–95
Fig. 2. Kaplan–Meier plot of relapse-free survival according to normalization or not of mucosal gene transcript of IL17A after discontinuation of infliximab in patients with ulcerative colitis in remission. The median survival time for the group with normalized IL17A was 10 months (6–14) versus 5 months (3–7) for the group with increased IL17A.
Fig. 3. Kaplan–Meier plot of relapse-free survival according to normalization or not of mucosal gene transcript of IFNG after discontinuation of infliximab in patients with ulcerative colitis in remission. The median survival time for the group with normalized IFNG was 9 months (4–14) versus 5 months (1–5) for the group with increased IFNG.
period. Unfortunately, biopsies for histological examination were not taken regularly at remission. This is due to the fact that there is no agreement on the definition of mucosal healing on the histological level [31] but this should be validated in future studies (for
93
Fig. 4. Cox regression plot of relapse-free survival according to normalization or not of mucosal gene transcript of TNF after discontinuation of infliximab in patients with ulcerative colitis in remission. The plot is stratified according to mucosal TNF transcript, corrected for the effects of sex (model P = 0.010). Sex shoved a HR of 2.3 (1.1–4.7) indicating increased risk of relapse for men (P = 0.025). Age was not a significant predictor and was removed from the model.
review, see [32]). Of special interest was the finding that normalization of mucosal gene transcript of TNF was a predictor of long term remission. When mucosal gene transcript of TNF was normalized, the median time to relapse was 20 months versus 5 months in the group with elevated mucosal TNF transcripts. Similar results were reported in another study from our group in CD patients where the median time to relapse was 17 months and 5 months, for normalized and elevated mucosal TNF transcripts, respectively [18]. Based on previous reports, [11–15] an endoscopic normalized mucosa should be one of the criteria included in defining stop-criteria for biologic agents in IBD. This study in UC, and the previous reported study in CD from our group [18], we propose an additional criterion: normalization of mucosal TNF expression. In this study IFNG and IL17A were also significant predictors in the Kaplan–Meier analysis; however the median time to relapse was less than 12 months for patients with normalization of these mediators. We did not find any significant prediction for normalization of the mucosal transcripts for IL-6, IL-23 and TGFB, all main mediators of the inflammatory process in IBD [33]. This may be explained by a lack of power, due to small number of observations. The results are in keeping with our hypothesis that the down regulation of some of the main inflammatory pathways in IBD predict long term disease remission, and should be included as a new treatment goal. The concept of immunological remission was introduced in 2012.1 Various immune molecules in blood have been used, and normalization of these parameters has been described as ‘‘biochemical healing” [34]. A further transomic approach including genomics, proteomics and metabolomics factors to define a set of fingerprints for long-term remission after discontinuing biologics in IBD should be performed, and is ongoing in our group [35]. Therefore, the concept of immunological mucosal healing could be the new treatment goal in IBD, and as natural follow-up of the English NICE recommendations [17].
1
Florholmen J, Nordic Meeting in Gastroenterology, June 2012, Reykjavik, Iceland.
94
T. Olsen et al. / Cytokine 79 (2016) 90–95
Table 3 Mucosal gene expression relative to normal controls. Cytokine gene
Relapse within 12 months
TNF
Yes No Yes No Yes No Yes No Yes No Yes No
IL17 IL23 IFN TGF IL6
Pre treatment
Post treatment
P (ANOVA)
Estimate
P (ANOVA)
Estimate
<0.0005
2.7 (1.6–4.6)⁄ 4.5 (2.2–9.2)⁄ 37.0 (13.5–101.3)⁄ 74.2 (20.2–273)⁄ 4.3 (1.5–12.1)⁄ 3.7 (1.0–14.1) 7.0 (2.1–23.0)⁄ 7.1 (1.6–31.0)⁄ 1.8 (1.2–2.7)⁄ 3.2 (1.9–5.4)⁄ 58.0 (13.3–253.0)⁄ 23.6 (4.1–136.6)⁄
0.021
1.7 1.2 4.1 2.9 2.4 2.5 3.3 0.9 1.2 1.4 4.3 2.7
<0.0005 0.001 <0.0005 <0.0005 <0.0005
0.002 0.004 0.013 0.226 0.100
(1.1–2.7)⁄ (0.6–2.5) (1.6–10.6)⁄ (0.7–12.3) (1.2–4.7)⁄ (0.9–6.6) (1.2–9.0)⁄ (0.2–4.9) (0.8–1.8) (0.8–2.5) (0.8–22.9) (0.3–20.8)
Factor difference in mRNA levels compared to normal controls. Values are mean difference (95% CI of mean). Asterisk denotes significant difference from normal controls (oneway ANOVA; Bonferroni corrected posthoc comparison)
5. Conclusion Normalization of mucosal TNF transcript may be an important criterion in the evaluation of when to discontinue treatment with IFX in UC. Declaration of interest None. Acknowledgements We thank Marian Remijn, Line Wilsgaard and Ingrid Christiansen for expert technical assistance. This Project was supported by the Northern Norway Regional Health Authorities. References [1] P. Rutgeerts, W.J. Sandborn, B.G. Feagan, W. Reinisch, A. Olson, J. Johanns, et al., Infliximab for induction and maintenance therapy for ulcerative colitis, N. Engl. J. Med. 353 (2005) 2462–2476, http://dx.doi.org/10.1056/ NEJMoa050516. [2] S.R. Targan, S.B. Hanauer, S.J. van Deventer, L. Mayer, D.H. Present, T. Braakman, et al., A short-term study of chimeric monoclonal antibody cA2 to tumor necrosis factor alpha for Crohn’s disease. Crohn’s disease cA2 study group, N. Engl. J. Med. 337 (1997) 1029–1035, http://dx.doi.org/10.1056/ NEJM199710093371502. [3] W.J. Sandborn, G. van Assche, W. Reinisch, J.-F. Colombel, G. D’Haens, D.C. Wolf, et al., Adalimumab induces and maintains clinical remission in patients with moderate-to-severe ulcerative colitis, Gastroenterology 142 (2012) 257– 265, http://dx.doi.org/10.1053/j.gastro.2011.10.032. e1-3. [4] J. Colombel, W.J. Sandborn, P. Rutgeerts, R. Enns, S.B. Hanauer, R. Panaccione, et al., Adalimumab for maintenance of clinical response and remission in patients with Crohn’s disease: the CHARM trial, Gastroenterology 132 (2007) 52–65, http://dx.doi.org/10.1053/j.gastro.2006.11.041. [5] W.J. Sandborn, B.G. Feagan, C. Marano, H. Zhang, R. Strauss, J. Johanns, et al., Subcutaneous golimumab maintains clinical response in patients with moderate-to-severe ulcerative colitis, Gastroenterology 146 (2014) 96–109, http://dx.doi.org/10.1053/j.gastro.2013.06.010. e1. [6] X. Hébuterne, M. Lémann, Y. Bouhnik, O. Dewit, J.-L. Dupas, M. Mross, et al., Endoscopic improvement of mucosal lesions in patients with moderate to severe ileocolonic Crohn’s disease following treatment with certolizumab pegol, Gut 62 (2013) 201–208, http://dx.doi.org/10.1136/gutjnl-2012-302262. [7] B.G. Feagan, P. Rutgeerts, B.E. Sands, S. Hanauer, J.-F. Colombel, W.J. Sandborn, et al., Vedolizumab as induction and maintenance therapy for ulcerative colitis, N. Engl. J. Med. 369 (2013) 699–710, http://dx.doi.org/10.1056/ NEJMoa1215734. [8] P. Rutgeerts, B.G. Feagan, G.R. Lichtenstein, L.F. Mayer, S. Schreiber, J.F. Colombel, et al., Comparison of scheduled and episodic treatment strategies of infliximab in Crohn’s disease, Gastroenterology 126 (2004) 402–413. [9] J.F. Colombel, W.J. Sandborn, W. Reinisch, G.J. Mantzaris, A. Kornbluth, D. Rachmilewitz, et al., Infliximab, azathioprine, or combination therapy for Crohn’s disease, N. Engl. J. Med. 362 (2010) 1383–1395, http://dx.doi.org/ 10.1056/NEJMoa0904492.
[10] P. Rutgeerts, G. Van Assche, W.J. Sandborn, D.C. Wolf, K. Geboes, J.-F. Colombel, et al., Adalimumab induces and maintains mucosal healing in patients with Crohn’s disease: data from the EXTEND trial, Gastroenterology 142 (2012) 1102–1111, http://dx.doi.org/10.1053/j.gastro.2012.01.035. e2. [11] M. Lémann, J.-Y. Mary, B. Duclos, M. Veyrac, J.-L. Dupas, J.C. Delchier, et al., Infliximab plus azathioprine for steroid-dependent Crohn’s disease patients: a randomized placebo-controlled trial, Gastroenterology 130 (2006) 1054–1061, http://dx.doi.org/10.1053/j.gastro.2006.02.014. [12] E. Louis, J.-Y. Mary, G. Vernier-Massouille, J.-C. Grimaud, Y. Bouhnik, D. Laharie, et al., Maintenance of remission among patients with Crohn’s disease on antimetabolite therapy after infliximab therapy is stopped, Gastroenterology 142 (2012) 63–70, http://dx.doi.org/10.1053/j.gastro.2011.09.034. e5; quiz e31. [13] A.W.G. Waugh, S. Garg, K. Matic, L. Gramlich, C. Wong, D.C. Sadowski, et al., Maintenance of clinical benefit in Crohn’s disease patients after discontinuation of infliximab: long-term follow-up of a single centre cohort, Aliment. Pharmacol. Ther. 32 (2010) 1129–1134, http://dx.doi.org/10.1111/ j.1365-2036.2010.04446.x. [14] C. Steenholdt, A. Molazahi, M.A. Ainsworth, J. Brynskov, O. Østergaard Thomsen, J.B. Seidelin, Outcome after discontinuation of infliximab in patients with inflammatory bowel disease in clinical remission: an observational Danish single center study, Scand. J. Gastroenterol. 47 (2012) 518–527, http://dx.doi.org/10.3109/00365521.2012.660541. [15] T. Molnár, P.L. Lakatos, K. Farkas, F. Nagy, Z. Szepes, P. Miheller, et al., Predictors of relapse in patients with Crohn’s disease in remission after 1 year of biological therapy, Aliment. Pharmacol. Ther. 37 (2013) 225–233, http://dx. doi.org/10.1111/apt.12160. [16] B. Pariente, D. Laharie, Review article: why, when and how to de-escalate therapy in inflammatory bowel diseases, Aliment. Pharmacol. Ther. 40 (2014) 338–353, http://dx.doi.org/10.1111/apt.12838. [17] Infliximab, adalimumab and golimumab for treating moderately to severely active ulcerative colitis after the failure of conventional therapy |Guidance and guidelines| NICE, (n.d.). [18] R. Rismo, T. Olsen, G. Cui, E.J. Paulssen, I. Christiansen, K. Johnsen, et al., Normalization of mucosal cytokine gene expression levels predicts long-term remission after discontinuation of anti-TNF therapy in Crohn’s disease, Scand. J. Gastroenterol. 48 (2013) 311–319, http://dx.doi.org/10.3109/ 00365521.2012.758773. [19] B.E. Sands, From symptom to diagnosis: clinical distinctions among various forms of intestinal inflammation, Gastroenterology 126 (2004) 1518–1532. [20] G. D’Haens, W.J. Sandborn, B.G. Feagan, K. Geboes, S.B. Hanauer, E.J. Irvine, et al., A review of activity indices and efficacy end points for clinical trials of medical therapy in adults with ulcerative colitis, Gastroenterology 132 (2007) 763–786, http://dx.doi.org/10.1053/j.gastro.2006.12.038. [21] A. Nilsson, A. Danielsson, R. Löfberg, P. Benno, L. Bergman, O. Fausa, et al., Olsalazine versus sulphasalazine for relapse prevention in ulcerative colitis: a multicenter study, Am. J. Gastroenterol. 90 (1995) 381–387. [22] G. Cui, T. Olsen, I. Christiansen, B. Vonen, J. Florholmen, R. Goll, Improvement of real-time polymerase chain reaction for quantifying TNF-alpha mRNA expression in inflamed colorectal mucosa: an approach to optimize procedures for clinical use, Scand. J. Clin. Lab. Invest. 66 (2006) 249–259, http://dx.doi.org/ 10.1080/00365510600590472. [23] T. Olsen, R. Goll, G. Cui, A. Husebekk, B. Vonen, G.S. Birketvedt, et al., Tissue levels of tumor necrosis factor-alpha correlates with grade of inflammation in untreated ulcerative colitis, Scand. J. Gastroenterol. 42 (2007) 1312–1320, http://dx.doi.org/10.1080/00365520701409035. [24] R. Goll, T. Olsen, G. Cui, J. Florholmen, Evaluation of absolute quantitation by nonlinear regression in probe-based real-time PCR, BMC Bioinformatics 7 (2006) 107. [25] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C (T) method, Nat. Protoc. 3 (2008) 1101–1108.
T. Olsen et al. / Cytokine 79 (2016) 90–95 [26] F. Baert, L. Moortgat, G. Van Assche, P. Caenepeel, P. Vergauwe, M. De Vos, et al., Mucosal healing predicts sustained clinical remission in patients with early-stage Crohn’s disease, Gastroenterology 138 (2010) 463–468, http://dx. doi.org/10.1053/j.gastro.2009.09.056. quiz e10–1. [27] I.C. Solberg, I. Lygren, J. Jahnsen, E. Aadland, O. Høie, M. Cvancarova, et al., Clinical course during the first 10 years of ulcerative colitis: results from a population-based inception cohort (IBSEN Study), Scand. J. Gastroenterol. 44 (2009) 431–440, http://dx.doi.org/10.1080/00365520802600961. [28] J.F. Colombel, P. Rutgeerts, W. Reinisch, D. Esser, Y. Wang, Y. Lang, et al., Early mucosal healing with infliximab is associated with improved long-term clinical outcomes in ulcerative colitis, Gastroenterology 141 (2011) 1194– 1201, http://dx.doi.org/10.1053/j.gastro.2011.06.054. [29] P. Rutgeerts, R.H. Diamond, M. Bala, A. Olson, G.R. Lichtenstein, W. Bao, et al., Scheduled maintenance treatment with infliximab is superior to episodic treatment for the healing of mucosal ulceration associated with Crohn’s disease, Gastrointest. Endosc. 63 (2006) 433–442, http://dx.doi.org/10.1016/j. gie.2005.08.011. quiz 464. [30] F. Schnitzler, H. Fidder, M. Ferrante, M. Noman, I. Arijs, G. Van Assche, et al., Mucosal healing predicts long-term outcome of maintenance therapy with infliximab in Crohn’s disease, Inflamm. Bowel Dis. 15 (2009) 1295–1301, http://dx.doi.org/10.1002/ibd.20927.
95
[31] M. Daperno, F. Castiglione, L. de Ridder, I. Dotan, M. Färkkilä, J. Florholmen, et al., Results of the 2nd part scientific workshop of the ECCO. II: Measures and markers of prediction to achieve, detect, and monitor intestinal healing in inflammatory bowel disease, J. Crohns. Colitis. 5 (2011) 484–498, http://dx.doi. org/10.1016/j.crohns.2011.07.003. [32] J. Florholmen, Mucosal healing in the era of biologic agents in treatment of inflammatory bowel disease, Scand. J. Gastroenterol. 50 (2015) 43–52, http:// dx.doi.org/10.3109/00365521.2014.977943. [33] J. Florholmen, W. Fries, Candidate mucosal and surrogate biomarkers of inflammatory bowel disease in the era of new technology, Scand. J. Gastroenterol. 46 (2011) 1407–1417, http://dx.doi.org/10.3109/ 00365521.2011.627449. [34] L. Rosenberg, K.S. Nanda, T. Zenlea, A. Gifford, G.O. Lawlor, K.R. Falchuk, et al., Histologic markers of inflammation in patients with ulcerative colitis in clinical remission, Clin. Gastroenterol. Hepatol. 11 (2013) 991–996, http://dx. doi.org/10.1016/j.cgh.2013.02.030. [35] R. Paulssen, R. Goll, J. Florholmen, Pan European Networks Ltd., (n.d.).