Notch1-mediated signaling regulates proliferation of porcine satellite cells (PSCs)

Cellular Signalling 25 (2013) 561–569

Contents lists available at SciVerse ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

Notch1-mediated signaling regulates proliferation of porcine satellite cells (PSCs) Lili Qin a, Jian Xu a, Zhenfang Wu a, Zhe Zhang a, Jiaqi Li a, Chong Wang a,⁎, Qiaoming Long b,⁎⁎ a

College of Animal Science/Guangdong Provincial Key Lab of Agro-animal Genomics and Molecular Breeding, South China Agricultural University, Guangzhou, Guangdong, 510642, People's Republic of China b Department of Animal Science, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY 14850, USA

a r t i c l e

i n f o

Article history: Received 31 August 2012 Received in revised form 18 October 2012 Accepted 5 November 2012 Available online 13 November 2012 Keywords: Porcine satellite cell Notch rhNF-κB-induced Myogenic progenitor Cell cycle regulators GSK3β-3

a b s t r a c t Notch signaling is an evolutionarily conserved cell–cell communication mechanism involved in the regulation of cell proliferation, differentiation and fate decisions of mammalian cells. In the present study, we investigated the possible requirement for Notch signaling in the proliferation and differentiation of porcine satellite cells. We show that Notch1, 2 and 3 are expressed in cultured porcine satellite cells. Knock-down of NOTCH1, but not NOTCH2 and NOTCH3, decreases the proliferation of porcine satellite cells. In contrast, enhancement of NOTCH1 expression via treatment of porcine satellite cells with recombinant NF-κB increases the proliferation of porcine satellite cells. The alteration of porcine satellite cell proliferation is associated with significant changes in the expression of cell cycle related genes (cyclin B1, D1, D2, E1 and p21), myogenic regulatory factors (MyoD and myogenin) and the Notch effector Hes5. In addition, alteration of Notch1 expression in porcine satellite cells causes changes in the expression of GSK3β-3. Taken together, these findings suggest that of the four notch-related genes, Notch1is likely to be required for regulating the proliferation and therefore the maintenance of porcine satellite cells in vivo, and do so through activation of the Notch effector gene Hes5. © 2012 Elsevier Inc. All rights reserved.

1. Introduction Late in fetal development, a subset of the proliferating embryonic myogenic progenitors (myoblasts) become mitotically quiescent and adopt the satellite cell fate [1–3]. Residing between the basal lamina and plasma membrane of mature skeletal muscle fibers and mononucleated [4], satellite cells are a major source of progenitors in postnatal muscle [5–8]. Numerous previous studies have shown that satellite cells play an important role in supporting postnatal muscle growth and regeneration of myogenic tissues after muscle injury [9–11]. All quiescent satellite cells express the paired-box transcription factor Pax7 [8] and a majority of them express CD34 and M-Cadherin [12]. Upon mechanical, biochemical or hormonal stimuli-induced activation, satellite cells up-regulate some of the myogenic regulatory factors (MRFs), including Myf5, MyoD and myogenin and immediately re-enter the cell cycle, a process that re-capitulates many of the features of the embryonic myogenesis program [13]. Several signaling pathways, including the Notch [14], hepatocyte growth factor [15,16], myostatin [17] and p38a/b MAPK [18] have previously been implicated in the induction and regulation of activation of satellite cells. Signaling mediated through the Notch receptor is an evolutionarily conserved cell–cell communication mechanism that is required for regulation of cell proliferation, differentiation and cell fate decisions ⁎ Corresponding author. Tel.: +86 150 1317 5412; fax: +86 20 8528 0740. ⁎⁎ Corresponding author. Tel.: +1 607 254 5380; fax: +1 607 255 9829. E-mail addresses: [email protected] (C. Wang), [email protected] (Q. Long). 0898-6568/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cellsig.2012.11.003

[19–22]. Notch signaling is initiated by the interaction of the Notch receptors (Notch1–4 in mammals) with their ligands (Delta-like 1 and 4 and Jagged 1 and 2 in mammals). Ligand–receptor binding results in proteolytic cleavage and translocation of the Notch intracellular domain (NICD) into the nucleus, where it interacts with the C-promoter binding factor-1 (CBF1, as known as RBP-J). In the absence of Notch signaling, CBF-1/RBP-J recruits co-repressors to form transcriptional repressor complexes, which inhibit downstream target gene transcription. Upon activation of Notch signaling, NICD dissociates the CBF-1/RBP-J-containing repressor complexes and facilitates the formation of transactivation complexes. This leads to the activation of expression of the HES and HEY families of basic helix–loop–helix transcriptional factors [23,24]. The HES or HEY proteins, which normally function as transcriptional repressors, in turn, inhibit the expression of pro-differentiation genes, such as Mash1 and Math (for neurogenesis) [25] and Neurogenin 3 (for pancreas development) [26]. Notch signaling has been shown to be critical for maintaining the proliferative state of satellite cells in old muscle [14,27]. Active Notch signaling inhibits premature differentiation of myoblasts to prevent depletion of muscle progenitors [28,29]. In this sense, the Notch pathway during postnatal muscle growth and regeneration recapitulates its role in the regulation of myogenesis during embryonic development. While the importance of Notch signaling in control of satellite cell activation, proliferation and differentiation has been well recognized, the molecular factors/pathways that are involved in mediating the effects of Notch signal are poorly understood. This is partly due to

562

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

the fact that Notch signaling apparently imposes two distinct blocks on myoblast cell differentiation, a CBF1-dependent and CBF1-independent mechanisms [30,31]. Additionally, although HES1 was thought to be the canonical effector of Notch signaling [24], recent studies have shown that other members of HES and HEY families of transcription factors may also act as effectors downstream of the Notch pathway [32–35]. Further complicating the situation is that several other signaling pathways, including the bone morphogenesis protein (BMP) [36], vascular endothelial growth factor (VEGF) [37], insulin growth factor like 1 (IGF1) [38] and wingless (Wnt) [39] pathways have been found to cross-talk with the Notch signaling pathway in control of myoblast proliferation and differentiation. Porcine satellite cells represent an ideal model system for studying the cellular and molecular basis for regulating myogenic stem cell proliferation and differentiation and for exploring the experimental conditions for myoblast transplantation. However, the molecular pathways governing the maintenance and activation of porcine satellite cells are incompletely understood. The goal of the present study is to understand the role of Notch signaling in regulating the activation, proliferation and differentiation of porcine satellite cells. We report here that Notch1, but not Notch2 and 3, is required for regulation of porcine satellite cells (PSCs). Additionally, we show that HES5, but not HES1, functions as the Notch pathway effector in PSCs to regulate the expression of MyoD and myogenin. Furthermore, we identify GSK3β-3 to be a target gene of the Notch pathway, which may potentially link the Notch and Wnt signaling pathways in PSCs. Our findings provide the first evidence that Notch signaling pathway plays a critical role in regulating the proliferation and differentiation of porcine satellite cells. 2. Materials and methods 2.1. Ethics statement All animal procedures were performed according to guidelines developed by the China Council on Animal Care and protocols were approved by the Animal Care and Use Committee of Guangdong Province, China. The approval ID or permit number are SCXK (Guangdong) 2004-0011 and SYXK (Guangdong) 2007-0081. 2.2. Isolation and culture of primary porcine satellite cells (PSCs) and cell treatment Postnatal day 1 (P1) Landrace piglets were anesthetized with sodium pentobarbital and hind deltoid muscles were removed and rinsed with phosphate buffered saline (PBS). The hindlimb deltoid muscles were deprived of blood vessels and other connective tissues by hand dissection, sliced into 1 mm3 pieces and digested for 2.5 h in PBS containing 0.1% collagenase II. After mixing with an equal volume of stop solution (DMEM containing 10% FBS), the tissue-collagenase mixture was passed through a Netwell™ insert with an aperture of 0.15 mm to remove large tissue residues. The flow-through cells were washed 3 times with PBS and passed through two sequential Netwell™ inserts with apertures of 0.076 mm and 0.037 mm, respectively. The flow-through cells were then plated into poly-L-lysine-coated flasks containing DMEM medium with 15% fetal bovine serum (FBS) and 0.5% chicken embryo extract and incubated in a humidified CO2 incubator at 37 °C. On the next day, cells in the flasks were treated with 0.25% trypsin for 5 min, washed 3 times with PBS and re-plated. To separate satellite cells from fibroblast cells, the re-plated cells were incubated in a humidified CO2 incubator at 37 °C only for 60 to 90 min and then transferred to a new flask. This adhering/detachment procedure was repeated 3 times to remove residual fibroblast cells. The purified satellite cells were then plated into laminin-coated 75 cm2 flasks and cultured at a density of 2.5 × 104 cells/cm2.

For siRNA transfection or rhNF-κB treatment, porcine satellite cells were seeded at 2 × 10 5 cells per well in six-well plates and transfected Si-NOTCH1: GCATGACGTCAACGAGTGT; Si-NOTCH2: CCAGGTGAA TATTGATGAA; Si-NOTCH3: CACACTTGACACTCCACTT and NC-control fragment (Invitrogen) with FuGENE HD Transfection Reagent (Roche, USA), according to the manufacturer's instructions. For rhNF-κB-treatment, recombinant human soluble RANK Ligand (PeproTech, USA) was added into the culture medium at a final concentration of 10 ng/mL. After 24 and 48 h, cells were harvested for the preparation of total RNA isolation or whole cell protein extraction. For difluorophenacetyl-al-alanyl-S-phenylglycine-t-butyl ester (DAPT) treatment, DAPT was added into the culture medium at a final concentration of 1 μM/mL. 2.3. Immunostaining and confocal microscopy Single cell suspensions of porcine satellite cells were prepared and plated using ultra low adherent wells of 6-well plate at 5000 cells/ well in sphere formation medium. After 2 days of treatment, the pancreatospheres were collected by centrifugation, washed with PBS, and fixed with 3.7% paraformaldehyde. The fixed porcine satellite cells were then incubated with an anti-Notch1 antibody (1:200, Cell Signaling Technology, cat#4380), washed and analyzed by confocal microscopy using LAS AF 1.2.0 Software (MIRL Core Facility, Wayne State University School of Medicine). 2.4. Flow cytometry and BrdU-labeling assays BrdU-labeling assay was performed using the FLUOS In Situ Cell Proliferation Kit (Roche) following the instructions recommended by the manufacturer. For flow cytometry, cells were harvested and washed in cold PBS twice. The washed cells were then fixed for 30 min in 70% ethyl alcohol that was pre-cooled at −20 °C. After 2 quick rinses with cold PBS, the fixed cells were incubated in 400 μL of propidium iodide (PI) solution and, subsequently, analyzed by a flow cytometer. 2.5. Cloning of GSK3β-3 The GSK3β-3 coding region was cloned by PCR from satellite cell cDNA using the following primers: F: CGCTCGAGATGTCAGGGCGGCCCAGAA R: GGGGTACCGGTGGAATTGGAAGCTGACG. The amplified cDNA fragment was digested with XhoI and KpnI for over 2 h, purified and subsequently ligated into the corresponding sites in the expression vector PEGFP-N1 (Promega). 2.6. Reverse transcription (RT) and real-time PCR analysis RNA isolation from porcine satellite cells was carried out using the Trizol RNA isolation Kit (Invitrogen). The isolated RNAs were treated with RNase-free DNAase for 15 min before cDNA synthesis. Reverse transcription was performed using SuperScript II reverse transcriptase (Invitrogen). Real-time PCR was carried out on an ABI Prism SDS 7000 thermal cycler in a 15 μL reaction mixture (SYBR Green Mix 7.5 μL, cDNA 2 μL, forward primer 0.2 μL, reverse primer 0.2 μL and H2O 5.1 μL), using the following cycling parameters: 40 cycles at 95 °C, 1 min, 15 s at 95 °C, 15 s at 60 °C, and 45 s at 72 °C. The following primers were used: Notch1: F: TGCCTGTGTCCACCTGGCTTCA; R: CTCCGTTTCGGCACAGGTGGGTA Notch2: F: TCTGCTCACCAGGATTCA R: CCTCGGGGCACATACAAC Notch3: F: GCTCCTTGCCCCCACTCT R:GAAACCCATTCCATCGCT

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

563

Notch4: F: TCCAAGAAATGCCCATAAAC R: CACATAGTAGGTGCCCAATAAA Hes1: F: AACTGCATGACCCAGATCAATG R: AGCCTCCAAACACCTTAGCC Hes5: F: GCGACCGCATCAACAGCA R: GCGTGGAGCGTCAGGAACT MyoD: F: TGCGTATTCTCAACCCCTTC R: AGTATGCAAGGGTGGAGTGG; Myogenin: F: AGGCTACGAGCGGACTGA R: GCAGGGTGCTCCTCTTCA; Myf5: F: TGGAAATCAGTTATAGGGAGTTTT; R: TTTGTGCTTACATTAAAAAGATGC Myf6: F: CTTGAGGGTGCGGATTTC R: CTCGAGGCTGACGAATCAA CCNB1: F: CGGGATCCATGGCGCTCCGAGTCACCAG R: CCGCTCGAGTTACACCTTTGCCACAGCCTTG CCND1: F: TGTTTGCAAGCAGGACTTTG R: ACGTCAGCCTCCACACTCTT CCND2: F: TGGGCTTCAGCAGGATGATG R: ACGGAACTGCTGCAGGCTGT CCNE1: F: ACAAAAGGAAACTCACCCTAACTG R: ACCTTAATATGCGAAGTGGACCT p21: F: TACTCCCCTGCCCTCAACAAGA R: CGCTATCTGAGCAGCGCTCAT GSK3β: F: CCTTGGACTAAGGTCTTCC R: GGCATTAGTATCTGAGGCT GSK3β-2: F: CACCAACAAGGGAGCAAA R: CGCACTCCTGAGGTGAAAT GSK3β-3: F: CCCTTCTAACAGAAAAGGGAA R: TCAGGTGGAATTGGAAGCTG GSK3β-4: F: AGGCACATCCTTGGACTAAG R: CCGGCATTAGTATCTTGAGT GSK3β-5: F: GACTTTGGAAGGGCACCAGA R: CCTTGTTGGTGTCCCTAGG β-Actin: F: AGGCACCACAGGTATTCAA R: GACGCCAATCAGGTAGTTT.

with treatment and replicate as fixed factors and plate as random factor, if applicable. Significance of differences between least squares means was tested by the Tukey test (P b 0.05).

All the gene results of real-time PCR were compared with the β-actin.

3.2. NOTCH1-mediated signaling is functionally active in porcine satellite cells

2.7. Western blotting analysis Protein lysates were prepared by lysing porcine satellite cells in TNE buffer (1% NP-40, 10 mmol/L Tris–HCl, pH 7.8, 150 mmol/L NaCl, 1 mmol/L EDTA, 2 mmol/L Na3VO4, 10 mmol/L NaF and 10 μg/mL aprotinin). After centrifugation at 15,000 rpm/min for 20 min at 4 °C, an equal amount (15 μg) of individual lysates were resolved on a 10% SDS-PAGE denaturing gel and proteins were transferred to an Immunoblot PVDF-membrane (Bio Rad™). Notch1, Hes5, MyoD, myogenin, CCND1 and actin were detected with rabbit anti-human Notch1 (1:1000 dilution, Cell Signaling Technology (4380)), rabbit antihuman Hes5 (1:1000 dilution, Abcam (ab25374)), rabbit anti-mouse MyoD (1:300 dilution; Santa Cruz™ (sc-304)), goat anti-mouse myogenin (1:500 dilution; Santa Cruz™ (sc-31945)), rabbit antihuman cyclin D1 (1:1000 dilution; Cell Signaling Technology (2922)) and mouse anti-rabbit actin (Beyotime, China) antibodies overnight at 4 °C. The secondary antibodies used were HRP-conjugated goat anti-rabbit, rabbit anti-goat and goat anti-mouse (ProteinTech Group, Inc.; 1:10,000). Immuno-detection was carried out using ESL chemiluminescence substrates. 2.8. Statistical analysis All the data were subjected to analyses of variance using the MIXED procedure of SAS (version 9.1, SAS Institute, Inc., Cary, NC)

3. Results 3.1. Notch1 is highly expressed in porcine satellite cells (PSCs) Mammals have four Notch genes (Notch 1–4) that have been shown to be differentially expressed during embryonic development and in adult tissues [40–43]. As the first step to determine which Notch gene is required for the maintenance (self-renewal) of porcine satellite cells, we determined the expression of Notch1, Notch 2, Notch 3 and Notch4 in PSCs using quantitative RT-PCR, immunoblotting and immunohistochemical analyses. Notch1, Notch2, Notch3, but no Notch4 transcripts were detected in primary PSCs (Fig. 1A). The failure of detecting Notch4 transcript in PSCs was not due to low primer efficiency or other technical issues, since Notch4 transcripts were detectable in the pituitary (Fig. S1). Of the three transcriptionally active notch genes, Notch1 has the highest level of transcripts in PSCs, followed by Notch2 and 3, respectively, as shown by quantitative RT-PCR analysis (Fig. 1B). Immunoblotting analysis using a rabbit anti-human Notch1 antibody detected a 120-kDa product in PSCs (Fig. 1C bottom panel), and this product was significantly reduced in PSCs treated with the γ-secretase inhibitor DAPT. Together, these observations suggest that the anti-human Notch1 antibody used in our study specifically cross-reacts with the intracellular domain (the active form) of porcine Notch1 immunofluorescence staining showing that porcine Notch1 was primarily localized in the nuclear compartment of PSCs (Fig. 1D–F). These results indicate that while multiple Notch genes (i.e. Notch1–3) are transcriptionally active, Notch1 appears to be the most abundantly expressed and may be functionally active in porcine satellite cells, in light of its exclusive nuclear localization.

The finding that multiple Notch genes were transcriptionally active in primary porcine satellite cells has led us to assess which Notch gene(s) is functionally required in PSCs. For this study, we used synthetic siRNA to knock down Notch1, 2 and 3 in cultured PSCs and subsequently monitored the change of expression of Notch downstream genes, including Hes1, Hes5, Hey1, Hey2 and HeyL, and myogenic lineage transcription factors, MyoD, Myf5 and Myf6. Transfection of Notch1-, Notch2- and Notch3-siRNA into PSCs specifically down-regulated Notch1, Notch2 and Notch3 mRNA level, respectively, not the mRNA of homologous genes (Fig. 2A–C), suggesting that the synthetic siRNAs used in the experiment exhibited gene-specific interference effect. Knocking down Notch2 or Notch3 showed little effect on the expression of the Notch effector genes, Hes1 and Hes5, and any of the known myogenic genes, including MyoD, myogenin, Myf5 and Myf6 (Fig. 2B and C). Knocking down Notch1, however, resulted in a significant down-regulation of the expression of the Notch effector gene, Hes5, but not Hes1 (Fig. 2A and D–E). The mRNA expression of two myogenic transcription factors, Myf5 and Myf6, were not significantly altered in the Notch1 siRNA transfected PSCs (Fig. 2A). Together, these results indicate that while multiple Notch genes (i.e. Notch1, Notch1 and Notch3) are transcribed in porcine satellite cells, Notch1 appears to be the only one that is functionally important for the transcriptional regulation of porcine satellite cells. In addition, these results reveal that Hes5, not Hes1, functions as the likely “effector” gene to mediate Notch signaling in porcine satellite cells.

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

3

4

5

6

7

8

9 10

Notch1 Notch2 Notch3 Actin

D

Pituitary

1.4

l tro C

Relative mRNA expression (fold)

1 2

C Liver

PSC

1.6

on

B Lane #

D

A

AP T

564

Notch1

120 Kda

Actin

50 Kda

1.2 1.0

Passage of PSC

0.8 0.6

0

0.4

Notch1

0.2 0

Notch1

Notch2

E

Notch1

Notch3

Actin

3

5 120 Kda 50 Kda

F

DAPI

Notch1/DAPI

Fig. 1. Multiple Notch genes are expressed in porcine satellite cells. (A) RT-PCR analysis of Notch1, 2, 3 and 4 (lanes 2, 4, 6 and 8, respectively). Note that Notch4 transcript was not detected. Lanes 1 and 10 are DNA ladders. Amplification of the actin band serves as a positive control for the RT-PCR reaction. (B) Quantitative RT-PCR analysis of Notch1, 2 and 3 transcripts in PSC, liver and pituitary. (C) Immunoblotting analysis of Notch1 protein. NOTCH1 was detected as a 120-kDa product. Top: PSCs treated with 1 μM DAPT had significantly less Notch1 than control PSCs; bottom: Notch1 was detected in PSCs of different passages. (D–F) Immunohistochemistry of NOTCH1. Nuclei were counter-stained with DAPI. NOTCH1 is exclusively localized in the nucleus of porcine satellite cells. Scale bar = 50 μm.

3.3. Notch1 signaling regulates proliferation of porcine satellite cells through influencing cell cycle progression To determine the regulatory role of NOTCH1 in PSCs, we first assessed the effect of Notch1 down-regulation on the proliferation of cultured PSCs. For this study, PSCs were transfected with control or Notch1-specific siRNAs. The siRNA-transfected PSCs were then BrdU-labeled and analyzed by fluorescence-activated cell sorting (FACS) to determine the percentage of cells in the S and G2/M phases. FACS analysis showed that there were significantly fewer BrdU+ cells in the Notch1-siRNA treated PSCs (Fig. 3A). In addition, the number of Desmin-positive cells in the S, G2 and M phases were significantly reduced in the Notch1-siRNA transfected PSCs (16.90% vs 19.27% at 24 h, 2.41% vs 4.96% at 48 h after siRNA transfection) (Fig. 3B). In parallel studies, we examined the effects of siRNA-mediated downregulation of Notch2 and Notch3 on the proliferation of PSCs. No significant change of the percentage of Desmin + cells in S, G2 and M phases was detected in either Notch2 or Notch3 siRNA transfected PSCs, as compared to control siRNA-transfected PSCs (Fig. S3). We next assessed the effect of enhancing Notch signaling on the proliferation of PSCs. For this study, we treated PSCs with recombinant human NF kappa-B protein (rhNF-κB), a known activator of Notch1 signaling [44]. Immunoblotting showed that treatment of PSCs with rhNF-κB significantly increased the intracellular level of NOTCH1 (Fig. 3C–D), indicating that rhNF-κB enhanced Notch1 expression. FACS analysis indicated that PSCs treated with rhNF-κB overall had significantly more BrdU+ cells than control PSCs (Fig. 3E). In addition, rhNF-κB-treatment resulted in significantly more PSCs in the S, G2 and M phases (Fig. 3F). The effect of rhNF-κB on PSC proliferation was abolished by transfection of the cells with Notch1-siRNA, further suggesting that rhNF-κB acts through enhancing Notch1 signaling

(Fig. S5). Together, these results indicate that manipulation of Notch1 signaling affects the cell cycle progression, thereby the proliferation of cultured porcine satellite cells. 3.4. Notch1 signaling regulates the expression of myogenic lineage specific transcription factors and cell cycle regulators In mice, Notch1 signaling promotes proliferation and block differentiation of myoblast cells through two distinct mechanisms: Hes-dependent (via alteration of Hes1/5-regulated MyoD/myogenin expression) and Hes-independent (via general inhibition of cell cycle progression) mechanisms [30,31]. This has led us to hypothesize that Notch1 may regulate the proliferation of porcine satellite cells through a similar mechanism. To test this, we analyzed, via quantitative RT-PCR and immunoblotting, the expression of several cell cycle progression-related genes and key myogenic lineage transcription factors in PSCs following siRNA-mediated Notch1 knocking-down or rhNF-κB-mediated Notch1 up-regulation. Knocking-down Notch1 significantly decreased the expression of cyclin B1 (CcnB1), D1, but increased the expression of the cyclin-dependent kinase inhibitor, p21 (Fig. 4A and D). No significant change in cyclin D2 and E1 expression was detected. Enhancing Notch1 signaling, on the other hand, significantly increased the expression of cyclin B1, D1, D2, E1 and the Notch ligand Jagged1 (Fig. 4C), while the expression of p21 markedly decreased (Fig. 4B and E–F). Enhancing Notch1 signaling also significantly increased Hes5 expression and decreased the expression of two myogenic transcription factors, MyoD and myogenin (Fig. 4D and G–H). Up-regulation of Notch signaling did not alter the expression of Hes1, Myf5 and Myf6, at least at the transcriptional level (Fig. 4D). Collectively, these data indicate that manipulation of Notch1 signaling in porcine satellite cells affects the expression of the Notch downstream

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

0.8 0.6 0.4

* *

*

0.2

M yf 6

M yf 5

He s1 He s5 He y1 He y2 He yL M yo M yo D ge ni n

0

2.5 2.0 1.5 1.0

*

0.5 0

D

E

3.5 siRNA

3.0

No tc h1 Co nt ro l

siRNA-Notch3 siRNA-Control

4.0

Notch1

2.5 2.0

Hes5

1.5

MyoD

1.0 Myogenin

*

β-Actin M yf 6

M yf 5

He s1 He s5 He y1 He y2 He yL M yo M yo D ge ni n

0

3.0 siRNA-Notch1 siRNA-Control

2.5

*

2.0

*

1.5 1.0 0.5

*

*

0 No tc h1

0.5

No tc h No 3 tc h1 No tc h2

Relative mRNA expression (fold)

C

3.0

M yf 6

*

1.0

M yf 5

1.2

siRNA-Control

3.5

He s5 M yo D M yo ge ni n

1.4

siRNA-Notch2

4.0

Change of protein expression (fold)

siRNA-Control

He s1 He s5 He y1 He y2 He yL M yo M yo D ge ni n

1.6

No tc h No 2 tc h1 No tc h3

siRNA-Notch1

Relative mRNA expression (fold)

B 1.8

No tc h No 1 tc h2 No tc h3

Relative mRNA expression (fold)

A

565

Fig. 2. siRNA-mediated down-regulation of Notch1 expression alters the expression Hes5 and key myogenic regulatory factors in porcine satellite cells. Porcine satellite cells were transfected with control or Notch1 (A), Notch2 (B) or Notch3 (C)-specific siRNAs. Forty-eight hours after siRNA transfection, the porcine satellite cells were harvested and analyzed by real-time PCR for the expression of Hes1, Hes5, Hey1, Hey2, HeyL, MyoD, myogenin, Myf5 and Myf6. The efficacy of Notch1, 2 and 3-specific siRNA was verified by the detection of down-regulation of corresponding notch mRNA. (A) Knock-down of Notch1 significantly decreased the expression of Hes5, while it increased the expression of MyoD and myogenin. Hes1, Myf5 and Myf6 expression was not significantly altered. (B–C) Knock-down of Notch2 (B) and Notch3 (C) did not significantly affect the expression of Hes1, Hes5, MyoD, myogenin, Myf5 and Myf6. (D–E) Immunoblotting analysis and quantification of Notch1, Hes5, MyoD and myogenin protein expression in porcine satellite cells after Notch1 knock-down. The experiment was repeated three times and the values are expressed as means ± SE. *P b 0.05, control versus Notch1, Notch2 and Notch3 siRNA-treated.

effector gene Hes5 and the myogenic regulatory factors, MyoD and myogenin.

3.5. Notch1- and Wnt-mediated pathways cross-talk in PSCs The previous finding that Notch1-mediated signaling regulates proliferation and differentiation of myoblast cells via, at least in part, a Hes-independent mechanism has led to the speculation that the Notch signaling pathway may cross-talk with other signaling pathways that are involved in general regulation of cell cycle progression [45]. Indeed, several signaling pathways, including BMP [36], VEGF [37], IGF1 [38] and Wnt [39], have been shown to interact with the Notch pathway during myogenesis. Here, we investigated the possibility that Notch1- and Wnt-mediated signaling pathways cross-talk in porcine satellite cells. For this study, we first examined the effects of down- and up-regulation of Notch1 signaling on the expression of different splicing isoforms of GSK3β. Knocking-down Notch1 using siRNA did not alter the levels of GSK3β-1, GSK3β-2, GSK3β-4 and GSK3β-5 transcripts (Fig. S4). Interestingly, Notch1 down-regulation significantly reduced the intracellular level of GSK3β-3 transcripts in PSCs (Fig. 5A). On the other hand, upregulation of Notch1 by treating PSCs with rhNF-κB significantly increased the intracellular level of GSK3β-3 transcripts (Fig. 5B),

while it did not affect the levels of GSK3β-1, GSK3β-2, GSK3β-4 and GSK3β-5 transcripts (Fig. S4). Next, we investigated whether increased GSK3β-3 expression in PSCs affects the expression of myogenic transcription factors and cell cycle regulators. For this study, we transfected primary PSCs with an expression vector containing the full-length GSK3β-3 cDNA, and subsequently, assessed the expression of Notch pathway or cell proliferation-related genes. Expression of GSK3β-3 from the trans fected expression plasmid in the transfected PSCs was monitored by quantitative RT-PCR (Fig. 5C). GSK3β-3 overexpression in PSCs significantly increased the intracellular mRNA levels of Notch1 and Hes5 (Fig. 5C and E–F). In addition, the expression of CcnB1 and CcnD1 was significantly increased in GSK3β-3 overexpressing cells (Fig. 5D–F). Interestingly, however, MyoD and p21 expression were found to be significantly reduced in GSK3β-3 transfected cells (Fig. 5C and D, respectively). Together, these results indicate that, as in mouse myoblasts, Notch1-mediated signaling regulates the proliferation and differentiation of PSCs at least partly through interacting with the Wnt signaling pathway. 4. Discussion Porcine satellite cells represent an ideal model system for studying the cellular and molecular basis for regulating myogenic stem cell

566

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

% of BrdU Positive Cells

40 35

Notch1 siRNA Control siRNA

*

30 25 20 15 10

*

5 0 24 h

48 h

% of Cells in S, G2 and M phases

B

A

25 20 15 10 5

*

0 24 h

Time after siRNA transfection

48 h

Time after siRNA transfection

D l

Fold Change of NOTCH1 Expression

tro on C

rh

N

F-

κB

C

*

Notch1 siRNA Control siRNA

Notch1 Actin

3.0

rhNF-κB Control

2.5 2.0 1.5 1.0 0.5 0

F

% of BrdU Positive Cells

45

*

40

rhNF-κB Control

35 30 25

**

20 15 10 5 0 24 h

48 h

Time after rhNF-KB transfection

% of Cells in S, G2 and M phases

E

25 20

rhNF-KB Control

**

15 10

*

5 0

24 h

48 h

Time after rhNF-KB transfection

Fig. 3. Modulation of Notch 1 expression affects the proliferation of porcine satellite cells. (A–B) FACS analysis of PSCs transfected with control or Notch1-specific siRNAs. Knock-down of Notch1 decreases the numbers of BrdU+ PSCs and PSCs in the S, G2 and M phases. (C–D) Western blotting analysis of PSCs treated with recombinant human NF-κB (rhNF-κB). rhNF-κB treatment increases Notch1 protein expression in PSCs. (E–F) FACS analysis of porcine satellite cells treated with rhNF-κB. rhNF-κB treatment increases the percentage of BrdU+ porcine satellite cells (E) and the number of porcine satellite cells in the S, G2 and M phases. (F). All experiments were repeated three times and all values are expressed as means ± standard error (SE). *P b 0.05, control versus siRNA-Notch1, or control versus rhNF-κB-treated.

proliferation and differentiation and for exploring the experimental conditions for myoblast transplantation. We set out to investigate the role of Notch-mediated signaling in regulating the activation, proliferation and differentiation of porcine satellite cells. We show here that while three Notch genes (Notch1, 2 and 3) are expressed in porcine satellite cells, only Notch1 appears to be required for the regulation of porcine satellite cells. Notch1 signaling controls the expression of Hes5, which in turn may regulate the expression of myogenic regulatory factors MyoD and myogenin. Notch1 signaling also regulates the expression of GSK3β-3, a downstream target of the Wnt signaling pathway. These observations are the first to demonstrate that the Notch1–Hes5 cascade is the preferred signaling pathway for the regulation of porcine satellite cells. Our findings thus provide important functional and mechanistic insight into the role of Notch signaling in the regulation of porcine satellite cells.

Mammals have four Notch genes (Notch1–4) that were shown to share a high degree of sequence homology [22,41,46]. Previous studies demonstrated that these Notch genes are differentially expressed both spatially and temporarily during mammalian embryonic development [22,41,46,47]. More importantly, genetic studies in mice have shown that the Notch genes have distinct functions during embryonic development [48–55]. In this study, we found through RT-PCR that Notch1, Notch2 and Notch3, but not Notch4, were transcribed in porcine satellite cells (Fig. 1A–B). This finding, which is in line with an earlier report that Notch4 is an endothelial cell-specific mammalian Notch [55], suggests that Notch4 is unlikely required for regulation of porcine satellite cells. This result also indicates that Notch1, Notch2 and Notch3 are all potential regulators in porcine satellite cells. Interestingly, however, our siRNA-mediated knock-down studies revealed that only Notch1 receptor is functionally active in

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

A

B Notch1 siRNA Control siRNA

700 600 500 400 300

*

*

200

**

100

450

Relative expression of mRNA

rhNF-κB Control

**

350 300 250

*

200 150

*

100

**

50 0

CcnB1

CcnD1

CcnD2

CcnE1

CcnB1

p21

CcnD1

CcnD2

CcnE1

p21

D

*

Actin

0.5

ch

rhNF-κB Control Hes5

3.0 2.5 2.0

H Treatment

Notch1 siRNA Control siRNA

MyoD

* Myogenin

1.5 1.0

CCND1

0.5 0

M yf 6

0

G 3.5

CCND1

1.0

N ot

F

Notch1 Control

1.5

1

Jagged1

siRNA

*

in

0

*

2.0

Actin CcnD1

Change of protein expression (fold)

2.0 1.0

E

M yo ge n

3.0

2.5

5

5.0 4.0

rhNF-κB Control

M yo D

6.0

**

3.0

H es

*

7.0

3.5

H es 1

rhNF-κB Control

Relative expression of mRNA (fold)

C

Fold change of protein

**

400

M yf 5

Relative expression of mRNA

800

0

Fold change of protein

567

rhNF-κB Control

4.0 3.5 3.0 2.5

* *

*

2.0

*

1.5 1.0 0.5 0 Hes5

MyoD

Myogenin

CcnD1

Fig. 4. Alteration of Notch1 expression affects the expression cell cycle regulators and myogenic regulatory factors. Porcine satellite cells were either transfected with control or Notch1-specific siRNA (A and E–F), or treated with recombinant human NF-κB (B–D, G–H) to decrease or increase Notch1 expression. (A–B) Quantitative RT-PCR analyses of cyclin B1, D1, D2, E1 and p21 mRNA expressions in control and Notch1-siRNA transfected (A) or control and rhNF-κB-treated (B) porcine satellite cells. (C) Quantitative RT-PCR analyses of Jagged1 (C), Hes1, Hes5, MyoD, myogenin, Myf5 and Myf6 (D) mRNA expressions in control and rhNF-κB-induced porcine satellite cells. (E–F) Immunoblotting analysis (E) and quantification (F) of cyclin D1 protein (CCND1) expression in control and Notch1-siRNA transfected porcine satellite cells. (G–H) Immunoblotting analysis (G) and quantification (H) of Hes5, MyoD, myogenin and cyclin D1 protein expression in control and rhNF-κB-treated porcine satellite cells. All the experiments were repeated three times and the values are expressed as means ± SE. *P b 0.05, **P b 0.01, control versus siRNA, or control versus rhNF-κB-treated.

porcine satellite cells at the basal level (not ligand-induced Notch signaling) (Fig. 2A–E). This result, is in line with recent findings which suggest that a basal level of NOTCH1 signaling is required for maintaining or renewal of satellite cells in postnatal muscle [56,57]. It may also imply that NOTCH1 is the preferred receptor in porcine satellite cells for mediating Notch signaling. Further studies are needed to determine whether Notch2 and Notch3 are involved in mediating any ligand-induced Notch signaling in porcine satellite cells. At least three lines of evidence from previous studies support the

hypothesis that Notch1 plays a major role in regulating porcine satellite cells. First, Notch1 has been shown to play a predominant role in regulating cell proliferation and cell fate determinations during the development of other organ systems, such as the pancreas [26], skeletal muscle [49], hematopoiesis [58] and the central nervous system and hematopoietic cells [59]. Second, only NOTCH1 is able to bind to Numb and being degraded by the E3 ubiquitin ligase ITCH [60], both of which have been demonstrated to have critical roles in regulating myogenesis. Third, it has been suggested that the function of

568

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

B 0.07

Notch1 siRNA Control siRNA

0.06 0.05 0.04

*

*

0.03 0.02 0.01 0

24 h

Relative expression of Gsk3β-3 mRNA (fold)

Relative expression of Gsk3β-3 mRNA (fold)

A

0.16

*

0.12 0.10 0.08 0.06 0.04 0.02 0

48 h

24 h

Time after siRNA transfection

48 h

Time of rhNF-κB treatment

D 12

** GSK3β-3 Control

10 8 6 4

** *

2

*

0 Notch1

Gsk-3β-3

Hes5

Relative expression of mRNA (fold)

C

400 350

250

**

200 150 100

**

50 0 CcnB1

CcnD1

p21

F l t ro on C

G

sk

3β

-3

E

GSK3β-3 Control

**

300

MyoD

Notch1 Hes5 MyoD CCND1 Actin

Relative expression of protein (fold)

Relative expression of mRNA (fold)

rhNF-κB Control

**

0.14

4.5 4.0

GSK3β-3 Control

**

3.5

*

3.0 2.5 2.0

*

1.5 1.0

**

0.5 0 Notch1

Hes5

MyoD

CcnD1

Fig. 5. Basal level Notch1 is required for GSK3β-3 expression in porcine satellite cells. (A–B) Quantitative RT-PCR analyses of Gsk3β-3 mRNA expression in porcine satellite cells transfected with control or Notch1-specific siRNA (A) or treated with recombinant human NF-κB (B). (C–D) Quantitative RT-PCR analyses of mRNA expression of Notch or myogenic regulatory factors (Notch1, Hes5 and MyoD) (C) and cell cycle regulators (CcnB1, CcnD1 and p21) in porcine satellite cells overexpressing GSK3β-3. (E–F) Immunoblotting analyses (E) and quantification (F) of Notch1, Hes5, MyoD, and CcnD1 protein expression in porcine satellite cells overexpressing GSK3β-3. All experiments were repeated three times and the values are expressed as means ± SE. *P b 0.05, **P b 0.01, control versus siRNA, or control versus rhNF-κB-treated.

Notch3 in porcine satellite cells, if any, is likely to antagonize Notch1 signaling [61,62]. The molecular pathways downstream of Notch signaling in satellite cells are very complex and incompletely understood. Depending on species and tissue/cell types, several members of the Hes (Hes1, 5 and 7) and Hey (Hey1, Hey2 and HeyL) families of transcription factors can act as targets of the Notch signaling pathway [23,24,33–35,63]. In the present study, we investigated which transcription factor is the target of Notch1 signaling in porcine satellite cells. We found that Hes5, not Hes1, is regulated by Notch1 signaling (Fig. 1A–E). Furthermore, we showed that activated Hes5 expression regulates the expression of myogenic regulatory genes, MyoD and myogenin (Fig. 4C, E–F). This observation is, at least partly, in line with the previous report that Hes1, the primary target of Notch signaling in other organ systems [24], is not required for Notch1 action in mouse myoblasts [31]. Interestingly, however, both Hes1 and Hes5 expression were strongly induced by

activated Notch1 signaling neural progenitor cells and were thought to play a complementary role in mediating Notch-mediated inhibition of neural differentiation [33]. In addition, Hes1, Hes5 and Hey1 were all shown to be up-regulated in human primary myoblasts treated with myostatin, which was known to induce Notch signaling [64]. Furthermore, Bjornson et al. recently showed that Hes6 expression is significantly upregulated, whereas the expression of other Notch target genes including Hes1, Hes5, Hey1, Hey2 and HeyL are suppressed by enhanced Notch signaling [56]. Thus, our results reveal a unique mechanism utilized by porcine satellite cells for Notch1 signal transduction. Further studies will be needed to determine whether ligand-induced Notch activation also utilizes the Notch–Hes5 pathway to regulate downstream target genes in porcine satellite cells. Another important finding from the present study is that in porcine satellite cells activated Notch signaling upregulates the expression of Gsk3β-3 (Fig. 5A–F), an alternatively spliced isoform of the

L. Qin et al. / Cellular Signalling 25 (2013) 561–569

GSK3β gene (pigs have 5 different isoforms, GSK3β-1–5) [65]. As a serine/threonine kinase, GSK3β can phosphorylate and increase the stability of Notch intracellular domain (NICD) [66]. Thus, GSK3β may function to enhance Notch signaling in porcine satellite cells. Additionally, given the well-characterized role of GSK3β in mediating Wnt signaling pathway [65], it is possible that GSK3β-3 may act to coordinate the cross-talk between Notch and Wnt signaling pathways in porcine satellite cells. Further studies of the interactions between Notch and Wnt signaling pathways in porcine satellite cells is likely to unravel novel insight into the molecular mechanisms regulating the activation and proliferation of porcine satellite cells. In conclusion, the present study demonstrated that Notch1, not Notch2–4, is required for maintenance and renewal of porcine satellite cells. The Notch1 signaling pathway utilizes Hes5 as the downstream effector to regulate the expression of several myogenic regulatory factors, including MyoD and myogenin, which directly or indirectly affect the expression of cycle regulators, such as p21 and cyclins. Notch signaling also upregulates the expression of GSK3β-3. Together, these findings provide evidence that the activation and proliferation of porcine satellite cells is regulated by a distinct Notch– Hes5 pathway. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.cellsig.2012.11.003. Acknowledgments We thank the National Natural Science Funds (31072008) and the Guangdong Provincial Natural Science Foundation (9251064201000005) for supporting this work. References [1] J. Gros, M. Manceau, V. Thome, C. Marcelle, Nature 435 (7044) (2005) 954–958. [2] L. Kassar-Duchossoy, E. Giacone, B. Gayraud-Morel, A. Jory, D. Gomes, S. Tajbakhsh, Genes & Development 19 (12) (2005) 1426–1431. [3] F. Relaix, D. Rocancourt, A. Mansouri, M. Buckingham, Nature 435 (7044) (2005) 948–953. [4] A. Mauro, Journal of Biophysical and Biochemical Cytology 9 (1961) 493–495. [5] R. Bischoff, Anatomical Record 182 (2) (1975) 215–235. [6] D. Montarras, J. Morgan, C. Collins, F. Relaix, S. Zaffran, A. Cumano, T. Partridge, M. Buckingham, Science 309 (5743) (2005) 2064–2067. [7] B. Peault, M. Rudnicki, Y. Torrente, G. Cossu, J.P. Tremblay, T. Partridge, E. Gussoni, L.M. Kunkel, J. Huard, Molecular Therapy 15 (5) (2007) 867–877. [8] P. Seale, L.A. Sabourin, A. Girgis-Gabardo, A. Mansouri, P. Gruss, M.A. Rudnicki, Cell 102 (6) (2000) 777–786. [9] A. Asakura, Trends in Cardiovascular Medicine 13 (3) (2003) 123–128. [10] J.C. Chen, D.J. Goldhamer, Reproductive Biology and Endocrinology 1 (2003) 101. [11] T. Endo, Regenerative Medicine 2 (3) (2007) 243–256. [12] J.R. Beauchamp, L. Heslop, D.S. Yu, S. Tajbakhsh, R.G. Kelly, A. Wernig, M.E. Buckingham, T.A. Partridge, P.S. Zammit, The Journal of Cell Biology 151 (6) (2000) 1221–1234. [13] S.B. Charge, M.A. Rudnicki, Physiological Reviews 84 (1) (2004) 209–238. [14] I.M. Conboy, T.A. Rando, Developmental Cell 3 (3) (2002) 397–409. [15] K.J. Miller, D. Thaloor, S. Matteson, G.K. Pavlath, American Journal of Physiology. Cell Physiology 278 (1) (2000) C174–C181. [16] R. Tatsumi, J.E. Anderson, C.J. Nevoret, O. Halevy, R.E. Allen, Developmental Biology 194 (1) (1998) 114–128. [17] S. McCroskery, M. Thomas, L. Maxwell, M. Sharma, R. Kambadur, The Journal of Cell Biology 162 (6) (2003) 1135–1147. [18] N.C. Jones, K.J. Tyner, L. Nibarger, H.M. Stanley, D.D. Cornelison, Y.V. Fedorov, B.B. Olwin, The Journal of Cell Biology 169 (1) (2005) 105–116. [19] S. Artavanis-Tsakonas, M.D. Rand, R.J. Lake, Science 284 (5415) (1999) 770–776. [20] M. Baron, Seminars in Cell & Developmental Biology 14 (2) (2003) 113–119. [21] J. Lewis, Seminars in Cell & Developmental Biology 9 (6) (1998) 583–589. [22] E. Robey, Current Opinion in Genetics and Development 7 (4) (1997) 551–557. [23] T. Iso, L. Kedes, Y. Hamamori, Journal of Cellular Physiology 194 (3) (2003) 237–255. [24] S. Jarriault, C. Brou, F. Logeat, E.H. Schroeter, R. Kopan, A. Israel, Nature 377 (6547) (1995) 355–358. [25] R. Kageyama, T. Ohtsuka, J. Hatakeyama, R. Ohsawa, Experimental Cell Research 306 (2) (2005) 343–348. [26] A. Apelqvist, H. Li, L. Sommer, P. Beatus, D.J. Anderson, T. Honjo, D.A.M. Hrabe, U. Lendahl, H. Edlund, Nature 400 (6747) (1999) 877–881. [27] I.M. Conboy, M.J. Conboy, G.M. Smythe, T.A. Rando, Science 302 (5650) (2003) 1575–1577.

569

[28] K. Schuster-Gossler, R. Cordes, A. Gossler, Proceedings of the National Academy of Sciences of the United States of America 104 (2) (2007) 537–542. [29] E. Vasyutina, D.C. Lenhard, H. Wende, B. Erdmann, J.A. Epstein, C. Birchmeier, Proceedings of the National Academy of Sciences of the United States of America 104 (11) (2007) 4443–4448. [30] D. Nofziger, A. Miyamoto, K.M. Lyons, G. Weinmaster, Development 126 (8) (1999) 1689–1702. [31] C. Shawber, D. Nofziger, J.J. Hsieh, C. Lindsell, O. Bogler, D. Hayward, G. Weinmaster, Development 122 (12) (1996) 3765–3773. [32] R. Kageyama, T. Ohtsuka, Cell Research 9 (3) (1999) 179–188. [33] T. Ohtsuka, M. Ishibashi, G. Gradwohl, S. Nakanishi, F. Guillemot, R. Kageyama, EMBO Journal 18 (8) (1999) 2196–2207. [34] J. Sun, C.N. Kamei, M.D. Layne, M.K. Jain, J.K. Liao, M.E. Lee, M.T. Chin, Journal of Biological Chemistry 276 (21) (2001) 18591–18596. [35] M.F. Buas, S. Kabak, T. Kadesch, Journal of Biological Chemistry 285 (2) (2010) 1249–1258. [36] C. Dahlqvist, A. Blokzijl, G. Chapman, A. Falk, K. Dannaeus, C.F. Ibanez, U. Lendahl, Development 130 (24) (2003) 6089–6099. [37] C.J. Shawber, Y. Funahashi, E. Francisco, M. Vorontchikhina, Y. Kitamura, S.A. Stowell, V. Borisenko, N. Feirt, S. Podgrabinska, K. Shiraishi, K. Chawengsaksophak, J. Rossant, D. Accili, M. Skobe, J. Kitajewski, The Journal of Clinical Investigation 117 (11) (2007) 3369–3382. [38] T. Kitamura, Y.I. Kitamura, Y. Funahashi, C.J. Shawber, D.H. Castrillon, R. Kollipara, R.A. DePinho, J. Kitajewski, D. Accili, The Journal of Clinical Investigation 117 (9) (2007) 2477–2485. [39] A.S. Brack, I.M. Conboy, M.J. Conboy, J. Shen, T.A. Rando, Cell Stem Cell 2 (1) (2008) 50–59. [40] L.M. Aparicio, V.M. Villaamil, G.A. Gallego, I.S. Cainzos, R.G. Campelo, L.V. Rubira, S.V. Estevez, L.L. Mateos, J.L. Perez, M.R. Vazquez, O.F. Calvo, M.V. Bolos, Cancer Genomics & Proteomics 8 (2) (2011) 93–101. [41] S. Cormier, S. Vandormael-Pournin, C. Babinet, M. Cohen-Tannoudji, Gene Expression Patterns 4 (6) (2004) 713–717. [42] M.P. Felli, M. Maroder, T.A. Mitsiadis, A.F. Campese, D. Bellavia, A. Vacca, R.S. Mann, L. Frati, U. Lendahl, A. Gulino, I. Screpanti, International Immunology 11 (7) (1999) 1017–1025. [43] J.I. Jonsson, Z. Xiang, M. Pettersson, M. Lardelli, G. Nilsson, European Journal of Immunology 31 (11) (2001) 3240–3247. [44] J. Bash, W.X. Zong, S. Banga, A. Rivera, D.W. Ballard, Y. Ron, C. Gelinas, EMBO Journal 18 (10) (1999) 2803–2811. [45] M.F. Buas, T. Kadesch, Experimental Cell Research 316 (18) (2010) 3028–3033. [46] A. Joutel, E. Tournier-Lasserve, Seminars in Cell & Developmental Biology 9 (6) (1998) 619–625. [47] E. Lammert, J. Brown, D.A. Melton, Mechanisms of Development 94 (1–2) (2000) 199–203. [48] H.T. Cheng, M. Kim, M.T. Valerius, K. Surendran, K. Schuster-Gossler, A. Gossler, A.P. McMahon, R. Kopan, Development 134 (4) (2007) 801–811. [49] R.A. Conlon, A.G. Reaume, J. Rossant, Development 121 (5) (1995) 1533–1545. [50] Y. Hamada, Y. Kadokawa, M. Okabe, M. Ikawa, J.R. Coleman, Y. Tsujimoto, Development 126 (15) (1999) 3415–3424. [51] S.S. Huppert, A. Le, E.H. Schroeter, J.S. Mumm, M.T. Saxena, L.A. Milner, R. Kopan, Nature 405 (6789) (2000) 966–970. [52] L.T. Krebs, Y. Xue, C.R. Norton, J.P. Sundberg, P. Beatus, U. Lendahl, A. Joutel, T. Gridley, Genesis 37 (3) (2003) 139–143. [53] B. McCright, X. Gao, L. Shen, J. Lozier, Y. Lan, M. Maguire, D. Herzlinger, G. Weinmaster, R. Jiang, T. Gridley, Development 128 (4) (2001) 491–502. [54] P.J. Swiatek, C.E. Lindsell, A.F. Del, G. Weinmaster, T. Gridley, Genes & Development 8 (6) (1994) 707–719. [55] H. Uyttendaele, G. Marazzi, G. Wu, Q. Yan, D. Sassoon, J. Kitajewski, Development 122 (7) (1996) 2251–2259. [56] C.R. Bjornson, T.H. Cheung, L. Liu, P.V. Tripathi, K.M. Steeper, T.A. Rando, Stem Cells 30 (2) (2012) 232–242. [57] P. Mourikis, R. Sambasivan, D. Castel, P. Rocheteau, V. Bizzarro, S. Tajbakhsh, Stem Cells 30 (2) (2012) 243–252. [58] S. Kojika, J.D. Griffin, Experimental Hematology 29 (9) (2001) 1041–1052. [59] J.D. Lathia, M.P. Mattson, A. Cheng, Journal of Neurochemistry 107 (6) (2008) 1471–1481. [60] B.J. Beres, R. George, E.J. Lougher, M. Barton, B.C. Verrelli, C.J. McGlade, J.A. Rawls, J. Wilson-Rawls, Mechanisms of Development 128 (5–6) (2011) 247–257. [61] P. Beatus, J. Lundkvist, C. Oberg, U. Lendahl, Development 126 (17) (1999) 3925–3935. [62] Y. Ono, H. Sensui, S. Okutsu, R. Nagatomi, Journal of Cellular Physiology 210 (2) (2007) 358–369. [63] M.F. Buas, S. Kabak, T. Kadesch, Journal of Cellular Physiology 218 (1) (2009) 84–93. [64] C. McFarlane, G.Z. Hui, W.Z. Amanda, H.Y. Lau, S. Lokireddy, G. Xiaojia, V. Mouly, G. Butler-Browne, P.D. Gluckman, M. Sharma, R. Kambadur, American Journal of Physiology. Cell Physiology 301 (1) (2011) C195–C203. [65] H. Dierick, A. Bejsovec, Current Topics in Developmental Biology 43 (1999) 153–190. [66] D.R. Foltz, M.C. Santiago, B.E. Berechid, J.S. Nye, Current Biology 12 (12) (2002) 1006–1011.