Notocotylus primulus n. sp. (Trematoda: Notocotylidae) from the crested duck Lophonetta specularioides (Aves, Anatidae) from Patagonian coast, southwestern Atlantic Ocean

Journal Pre-proof Notocotylus primulus n. sp. (Trematoda: Notocotylidae) from the crested duck Lophonetta specularioides (Aves, Anatidae) from Patagonian coast, southwestern Atlantic Ocean

Julia Inés Diaz, Carmen Gilardoni, Eliana Lorenti, Florencia Cremonte PII:

S1383-5769(19)30327-7

DOI:

https://doi.org/10.1016/j.parint.2019.101976

Reference:

PARINT 101976

To appear in:

Parasitology International

Received date:

15 November 2018

Revised date:

27 June 2019

Accepted date:

16 August 2019

Please cite this article as: J.I. Diaz, C. Gilardoni, E. Lorenti, et al., Notocotylus primulus n. sp. (Trematoda: Notocotylidae) from the crested duck Lophonetta specularioides (Aves, Anatidae) from Patagonian coast, southwestern Atlantic Ocean, Parasitology International(2019), https://doi.org/10.1016/j.parint.2019.101976

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Notocotylus primulus n. sp. (Trematoda: Notocotylidae) from the Crested Duck Lophonetta specularioides (Aves, Anatidae) from Patagonian coast, southwestern Atlantic Ocean

Julia Inés Diaza,* [email protected], Carmen Gilardonib, Eliana Lorentia, Florencia Cremonteb

Centro de Estudios Parasitológicos y de Vectores (CCT La Plata-CONICET-UNLP),

of

a

Laboratorio de Parasitología (LAPA), Instituto de Biología de Organismos Marinos

-p

b

ro

120 e/61 y 62, B1900FWA La Plata, Buenos Aires province, Argentina

*

Jo ur

na

Corresponding author.

lP

Madryn, Chubut province, Argentina

re

(IBIOMAR) (CCT CONICET- CENPAT), Boulevard Brown 2915, U9120ACD Puerto

Journal Pre-proof Abstract Species in the genus Notocotylus (Trematoda, Notocotylidae) are cosmopolitan parasites of mainly aquatic birds and, to a lesser extent, mammals. In this paper we describe Notocotylus primulus n. sp. parasitizing the Crested Duck, Lophonetta specularioides, from the Patagonian coast, southwestern Atlantic Ocean, based on morphological and molecular data. The new species could be distinguished from its congeners by the combination of several features; among them, the position of the

of

genital pore that is prebifurcal and located close to the posterior margin of the oral

ro

sucker, a greater number of both ventral papillae and uterine loops, and a large cirrus

-p

sac. Molecular results of the ITS2 sequence support the location of this new species in

re

the genus Notocotylus due to a close relationship with Notocotylus malhamensis (the

lP

lower genetic distance of the ITS2 sequences).

na

Keywords: Anseriformes, Atlantic coast, Digenea, Notocotylidae, Patagonia,

Jo ur

Notocotylus primulus n. sp., Lophonetta specularioides

Journal Pre-proof 1. Introduction At present, 50 species of Notocotylus Diesing, 1839 (Trematoda, Notocotylidae) are reported worldwide parasitizing mainly aquatic birds and, to a lesser extent, mammals, mostly rodents [1–3]. Six species of this genus have been recorded in the southern part of South America: Notocotylus attenuatus (Rudolphi, 1809), Notocotylus biomphalariae Flores and Brugni, 2005, Notocotylus chionis Baylis, 1928, Notocotylus gibbus (Mehlis in Vreplin 1846), Notocotylus imbricatus (Noble, 1933), and Notocotylus tachyeretis

of

Duthoit, 1931 [4].

ro

Patagonia harbors about 23 bird species of the family Anatidae, of which around

-p

30% are residents, present in the area throughout the year with null or local movements

re

[5]. The Crested Duck, Lophonetta specularioides King, belongs to this class of birds; it is endemic of South America and frequents both marine and freshwater environments

lP

[6]. Although the helminth communities of wild ducks have been well studied in North

na

America, Europe, and Asia [7–10], little is known about other parts of the world including southern South America [4], where reports are mainly about nematodes [11].

Jo ur

In this paper, we describe a new species of Notocotylus parasitizing the Crested Duck, L. specularioides, from the Patagonian coast, southwestern Atlantic Ocean, based on morphological and molecular data.

2. Materials and methods Two Crested Ducks, Lophonetta specularioides, were captured from Península Foca (47° 45’ S, 65° 55’ W), in the rocky littoral near the mouth of the estuary of the Deseado River, Puerto Deseado, Santa Cruz province, Argentina, during May 2016, under permits provided by the Wildlife Secretary of Santa Cruz province (Resolution Number 861/08). The birds were dissected and examined for helminths. The viscera

Journal Pre-proof were surveyed under a stereomicroscope. Helminths recovered were counted, most of them fixed in 5% hot formalin, preserved in 70% ethanol, stained with Semichon's acetocarmine or Gomori trichrome, mounted in Canada balsam, and studied using a light microscope Olympus BX51 (Olympus, Tokio, Japan). In addition, one specimen was dried using the critical point method, studied with a scanning electronic microscope (SEM) (Jeol 6360LV®, JEOL, Tokyo, Japan) and photographed. Drawings were made with the aid of a drawing tube. All measurements are given in micrometers except when

of

indicated, with the mean followed by the range in parentheses. Specimens were deposited

ro

in the Parasitological Collection of the Instituto de Biología de Organismos Marinos

-p

(IBIOMAR) (CCT CONICET-CENPAT), Puerto Madryn, Argentina (CNP-Par) and in

re

the Helminthological Collection, Museo de La Plata, La Plata (MLP). Three specimens were preserved in 100% ethanol and frozen for molecular

lP

analyses. Sequences were generated from DNA extracted from one specimen using the

na

GenEluteTM Mammalian Genomic DNA Miniprep Kit (Sigma, St. Louis, Missouri) according to the manufacturer’s instructions. The ITS2 and 28S regions of the rDNA

Jo ur

were amplified by PCR. The PCRs were performed in a total volume of 50 µl containing 10 X buffer (200mM Tris-HCl pH 8.4, 500mM KCl), 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.4 µM of each primer and 1 U of platinum Taq polymerase. 2 µl of genomic DNA was used as template. The ITS2 regions were amplified using as forward primer 5.8S-ITS2: 5’- GCTCGTGTGTCGATGAAGAG -3’, situated 114 bp from the 3’ end of the 5.8S gene, and as reverse primer 28S-ITS2: 5’- AGGCTTCGGTGCTGGGCT -3’, located 34 bp from the 5’ end of the conserved region of the lsrDNA. The 28S regions were amplified using as forward primer 28S28S: 5’- GTGAATACCCGCTGAACTTAAGC -3’, situated 16 bp from the 3’ end of the conserved region of the lsrDNA, and as reverse primer 28S-28S:

Journal Pre-proof 5’- TCTCCTTGGTCCGTGTTTCAA -3’, located 868 bp from the 5’ end of the conserved region of the lsrDNA. The cycling conditions included an initial denaturation at 94 ºC for 5 min followed by 40 cycles of 30 s at 94 ºC, 30 s at 56 ºC (annealing) for ITS2 and 52 ºC for 28S and 2 min at 72 ºC with a final extension step of 10 min at 72 ºC. Amplified PCR products were electrophoretically separated in a 1% (w/v) agarose gel stained with gel green. Negative controls for the PCR were always run to control for contamination. Relevant bands were sent for purifying and sequencing (MacroGen,

of

Korea). The ITS2 and 28S region sequences have been deposited in GenBank (see the

ro

accession numbers in Table 1). The other available ITS2 and 28S sequences of the

-p

members of the family Notocotylidae were taken from GenBank to compare with the

re

species here described (Table 1). The concatenated alignments were performed using MAFFT software (MAFFT software. available at

lP

http://www.ebi.ac.uk/Tools/msa/mafft/). Distance matrices among ITS2 sequences and

na

28S sequences respectively (p-distance model, i.e. percentage of pairwise character differences with pairwise deletion of gaps) were also calculated with MEGA6.

Jo ur

Gymnophalloides nacellae of the family Gymnophallide (order Bucephalata) were chosen as an outgroup. 3. Results

3.1 Description

Notocotylidae Kossak, 1911 Notocotylus primulus n. sp. (Figs. 1, 2) Description (based on 8 whole mounted specimens). Body 3,015 (2,370-4,200) long and 925 (750-1,300) maximum wide at level of ovary (Fig. A.1). Tegument covered by brush tip-like spines (Fig. 2), those just posterior to the oral sucker are tiny and pointed (Fig. 1B), those dorsolateral are wider and rhomboidal (Figs. 2C, E), and those ventral

Journal Pre-proof are thinner (Figs. 2D, F). Total number of ventral papillae 39-45; lateral and medial rows all contain 13-15 papillae (usually 14). Second papilla of middle row at same level or slightly above as first papilla of lateral rows (Fig. 1B). Oral sucker 140 (120-180) long, 163 (100-220) wide, with a circle of around of 20 scattered papillae surrounding the oral sucker (Fig. 1A). Esophagus 88 (50-140) long, bifurcating into two caeca, which run straight until the beginning of the uterus, then curve slightly between ovary and testes and terminate near to end of testes, distant 105 (100- 110) or 9 (7.3-9.5)% of

of

body length from posterior end of body. Testes opposite, lobed, longer than broad 590

ro

(370-950) long, 241 (100-350) wide. Cirrus sac median, straight, 991 (700-1,350) long,

-p

broad posteriorly and sharply narrowed anteriorly, containing saccular internal seminal

re

vesicle and pars prostatica. Cirrus sac representing 33.4 (27.5-38.8)% of total length. Cirrus not everted in available specimens. Common genital pore ventro-medial,

lP

considerably in front of intestinal bifurcation, reaching posterior margin or overlaying

na

oral sucker, ventral to beginning of esophagus. Ovary median, between testes, never entire, bilobed, 257 (200-350) long, 163 (120-200) wide. Vitelline reservoir

Jo ur

immediately anterior to ovary. Vitellaria formed of two lateral groups of 11-16 follicles extending from 25 (16- 45)% of body length from posterior end to 43 (26-50)% of body length from anterior end. Uterus extending anteriorly from ovary forming 30-37 major, laterally directed coils, with 10-11 coils anterior to vitelline follicles; some uterine coils slightly exceeding caeca, but contained by vitelline follicles. Metraterm muscular, sinisterly at level of cirrus pouch (Fig. 1). Eggs operculated, bearing single long filament at each pole; egg capsule 20 (18-20) long and 11 (10-12) wide (n=20), each filament of variable size 140 (120-170) long (Fig. 1C). Excretory pore opening dorsally at about level of posterior end of testes; excretory vesicle saccular.

Journal Pre-proof 3.2 Taxonomical summary Type host: Crested Duck Lophonetta specularioides King, 1828 (Aves, Anatidae). Type locality: Península Foca (47° 45’ S, 65° 55’ W), Puerto Deseado, Santa Cruz province, Argentina. Infection site: Mainly in caeca, also in large intestine. Specimens deposited: CNP-Par 173 (holotype), CNP-Par 183 (paratypes), and MLP 7507 (vouchers).

of

Etymology: Specific name is derived from “Primula”, the genus name of a group of

ro

plants commonly named “marguerite”, in honor to Dra. Margarita Ostrowski de Nuñez,

Prevalence: 100% (n=2).

na

3.3 Taxonomical remarks

lP

Range and mean intensity: 1-13 (7).

re

-p

a recognized and indefatigable Argentinean parasitologist.

At present and according to [1,2,12,13] there are 50 valid species of the genus

Jo ur

Notocotylus which parasitize birds and mammals. However, only the following eight species have a prebifurcal genital pore: Notocotylus aegyptiacus (Odhner, 1905) and Notocotylus naviformis Tubangui, 1932 from Anas platyrhynchos from Europa and Africa, and Philippines respectively; Notocotylus skrjabini Ablasov, 1953 [synonym: N. breviserialis (Stunkard, 1967)] parasitizing A. platyrhynchos from Asia and Africa, Anas bahamensis and Amazonetta brasiliensis from Brazil, and ardeids from Bulgaria; Notocotylus mamii (Hsu, 1954) described from rabbits (experimentally) from China; Notocotylus vinodae Gupta and Singh, 1987 parasitizing anatids form India; Notocotylus johnstoni Cribb, 1991 from Hydromys chrysogaster Geoffroy, 1904 from Australia; Notocotylus fosteri Kinsella and Tkach, 2005 from Oryzomys

Journal Pre-proof palustris (Harlan, 1937) from USA, Notocotylus loeiensis Chaisiri, Mor and Ribas, 2011 from Rattus losea from Thailand [1,12]. Of these species, only N. fosteri and N. loeiensis have a genital pore as far anterior as in the species here described, located next to the posterior margin of the oral sucker. However, these two mentioned species have a lower number of ventral papillae, 10-13 in N. fosteri and 9-11 in N. loeiensis vs. 13-15 in the species here described. Also, N. fosteri and N. loeiensis have an unspined tegument, whereas the new species has the body completely covered by rhomboidal

of

spines. The number of previtelline uterine loops in the two mentioned species is lower

ro

than in the new species (5-7 in N. fosteri and 2-4 in N. loeiensis vs. 10-12 in N. primulus

-p

n. sp.). Additionally, the cirrus sac in N. fosteri represents 18.38 % of the total body

re

length (in the holotype) whereas in the species here described the cirrus sac is longer, representing 33.6 (29-38.8) % of the total body length.

lP

The new species differ from all species of Notocotylus registered in South

na

America by the number of ventral glands and/or position of genital pore [14–17]. Taking into account that helminth dispersion frequently occurs by latitudinal

Jo ur

movements of migratory birds, it is also important to distinguish present specimens from those Notocotylus species recorded in Nearctic and Central American hosts. In this sense, N. lopezneyrai Dubois and Pérez Viguera, 1953 were reported in Cuba, and N. atlanticus Stunkard, 1966, N. attenuatus (Rudolphi, 1809), N. breviserialis (Stunkard, 1967), N. forsteri, N. gibbus, N. imbricatus, N. magniovatus Yamaguti 1934, N. minutus Stunkard, 1966, N. pacifera (Noble, 1933), N. regis Harwood, 1939, and N schmidti Brooks and Heard, 1977 were registered in mammal and bird from different North American localities. However, all mentioned species (except N. forsteri opportunely compared) have a postbifurcal genital pore, being this position a constant character in all described species [1,2,7]. Additionally, N. breviserialis, N. gibbus, N. lopezneirai, N.

Journal Pre-proof pacifera, N. regis and N. schmidti have less number of ventral glands than those observed in the new species, whereas, N. atlanticus and N. attenuatus have greater number of ventral glands than those counted in the present specimens [7,18–21]. Notocotylus magniovatus has a shorter cirrus sac in relation to the total body length, greater number of preuterine glands, and larger eggs than the species here described [7,22]. In addition, in N. imbricatus the first ventral gland in the medial row is located posterior to the first lateral ones, the number of uterine loops are less, and vitellaria

of

began posteriorly than in present specimens [16]. Furthermore, both in N. imbricatus

ro

and N. minutus ventral glands began immediately after the genital pore and also N.

re

-p

minutus is smaller than species here described [16,20].

3.4 Molecular analyses

lP

The PCR amplification of the rDNA from the adult of N. primulus n. sp. gave a

na

product of 1407 bp comprising 115 bp of final sequence of 5.8S, 294 bp of complete ITS2 and 998 bp of partial 28S sequence. Pairwise distance among 28S sequences was

Jo ur

very low when compared with all available genera including in the family Notocotylidae (between 0.031-0.05%) and is not useful to differentiate among genera. Pairwise distance between ITS2 of the species here described and Notocotylus malhamensis Boyce et al., 2012 and N. fosteri was 0.037% and 0.053% respectively, and the distances with Ogmocotyle spp. were higher (between 0.274-0.316%).

4. Discussion All the species of the genus Notocotylus are associated with wetland habitats, where the life cycle involves aquatic gastropods as intermediate hosts [2], both from fresh and brackish waters [1]. Cercariae usually encyst on vegetation or sometimes on

Journal Pre-proof the outer shell and/or operculum of the snail first intermediate host [14]. However there are records of cercariae encysted into the redia [23,24]. At present, two marine cercariae of the Notocotylidae family have been recorded in South America; one in the snail Laevilitorina caliginosa (Gould) (Littorinidae) that was identified as Paramonostomum antarcticum Graefe, 1968 because it was found in the same area of the adults, which were found parasitizing the Sheath-bill Chionis alba (Gmelin) [25]. The other cercaria was recorded in the limpet Nacella magellanica (Gmelin) (Nacellidae) in Comodoro

of

Rivadavia and Puerto Deseado, on the southern coast of Atlanctic Ocean [26–28]. In

ro

this case, the cercariae encyst inside the rediae [28], thus it is improbable that N.

-p

magellanica acts as intermediate host for N. primulus n. sp., because the Crested Duck

re

cannot feed on these limpets, which are large and strongly adhered to the rocky substrate.

lP

Molecular results of ITS2 sequences support the location of this new species in

na

the genus Notocotylus. However, the new species could just be compared with two species of genus Notocotylus and three species of genus Ogmocotyle. Despite N.

Jo ur

fosteri is a marine species and it was morphologically similar to the species here described, the ITS2 sequence of N. malhamensis was closest to the species here described. Even though 28S sequences of six genera are available, the genetic distances among sequences were very low and, for this reason, this sequence is not enough to discriminate among genera or species. To improve the molecular approach, it would be necessary to sequence non-coding region of rDNA (ITS) or mithocondrial DNA (COI). Sequence divergences at COI regularly allow the discrimination of closely related species [29]. Although several Notocotylus species were registered in American hosts, none of them has the same combination of morphological characteristics as those observed

Journal Pre-proof in specimens found in L. specularioides. This study enlarges to seven the number of known species of Notocotylus parasitizing birds from Argentina. In addition, this record expands the diversity, distribution and host range known of the genus, being the first record of a trematode parasite in L. specularioides.

Acknowledgements The authors gratefully acknowledge Cristián Ituarte for his help in the field and Patricia

of

Sarmiento of the Servicio de Microscopía Electrónica de Barrido from Museo de La

ro

Plata. Fieldwork was conducted in a Natural Protected Area currying the permissions

-p

given by Secretaría de Turismo y Áreas Protegidas of Santa Cruz Provinces. Present

re

study was partially funded by Consejo Nacional de Promoción Científica y Tecnológica (PIP 0698), Universidad Nacional de La Plata (N628, N758); Agencia Nacional de

lP

Promoción Científica y Tecnológica (PICT 2013-1702, PICT 2015-0841), and

na

Conservation, Food and Health Foundation. Authors wish to thank reviewers for their

comparisons.

Jo ur

suggestions and Vasyl Tkach who selflessly provide us the sequences of N. forsteri for

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Journal Pre-proof References [1]

J.M. Kinsella, V. V Tkach, Notocotylus fosteri sp. nov. (Trematoda, Notocotylidae) from the rice rat , Oryzomys palustris in Florida Key words, Acta Parasitologica. 50 (2005) 194–198.

[2]

K. Chaisiri, S. Morand, A. Ribas, Notocotylus loeiensis n. sp. (Trematoda: Notocotylidae) from Rattus losea (Rodentia: Muridae) in Thailand, Parasite. 18 (2011) 35–38. K. Boyce, G. Hide, P.S. Craig, P.D. Harris, C. Reynolds, A. Pickles, M.T. Rogan,

of

[3]

ro

Identification of a new species of digenean Notocotylus malhamensis n. sp.

-p

(Digenea: Notocotylidae) from the bank vole (Myodes glareolus) and the field

re

vole (Microtus agrestis), Parasitology. 139 (2012) 1630–1639. doi:10.1017/S0031182012000911.

B.M.M. Fernandes, M.C.N. Justo, M.Q. Cardenas, S.C. Cohen, South American

lP

[4]

[5]

na

Trematodes Parasites of Birds and Mammals, 2015. E. Coconier, D. Blanco, Reporte final aves acuáticas en la Argentina, La

Jo ur

Conservación de Las Aves Acuáticas Para Las Américas (Waterbird Conservation for the Americas). Wetlands Int. Buenos Aires, Argentina. (2005). [6]

J. Kear, Ducks, geese and swans: species accounts (Cairina to Mergus) Vol. 2, Oxford Uni, 2005.

[7]

M.E. McDonald, Key to nematodes reported in waterfowl, Department of the Interior, Bureau of Sport Fisheries and Wildlife. 142 (1981).

[8]

K.M. Kavetska, The intestinal nematodes of wild ducks (Anatinae) from northwestern part of Poland, Wiadomosci Parazytologiczne. 51 (2005) 167.

[9]

C. Atkinson, N. Thomas, D. Hunter, eds., Parasites diseases of wild birds, USA, 2008.

Journal Pre-proof [10] K.M. Kavetska, K. Królaczyk, B. Pilarczyk, E. Kalisińska, Stomach nematodes of wild ducks (subfamily Anatinae) wintering in the North-Western Poland, Bulletin of the Veterinary Institute in Pulawy. 56 (2012) 27–31. doi:10.2478/v10213-012-0005-5. [11] M.L. Agüero, C. Gilardoni, F. Cremonte, J.I. Diaz, Stomach nematodes of three sympatric species of anatid birds off the coast of Patagonia, Journal of Helminthology. (2015) 1–5. doi:10.1017/S0022149X15000899.

of

[12] S. Yamaguti, Synopsis of digenetic trematodes of vertebrates, 1971.

ro

[13] T.H. Cribb, Notocotylidae (Digenea) from the Australian water rat Hydromys

-p

chrysogaster Geoffroy, 1804 (Muridae), Systematic Parasitology. 18 (1991) 227–

re

237.

[14] H.A. Baylis, A new Species of Notocotylus [Trematoda], with some Remarks on

lP

the Genus, Ann. & Mag. Nat. Hist. 10 (1928) 582–585.

na

[15] C.M.G. Duthoit, A new species of the Trematode genus Notocotylus, Annals and Magazine of Natural History. 7 (1931) 290–293.

Jo ur

doi:10.1080/00222933108673313. [16] L.I. Lunaschi, C.A. Sutton, Fauna helmintologica de las aves del lago Pellegrini, Limnobios. 2 (1987) 707–711. [17] V. Flores, N. Brugni, Notocotylus biomphalariae n. sp.(Digenea: Notocotylidae) from Biomphalaria peregrina (Gastropoda: Pulmonata) in Patagonia, Argentina, Systematic Parasitology. 61 (2005) 207–214. [18] G. Dubois, I. Pérez Vigueras, Notocotylus lopezneyrai n. sp.(Notocotylidae) parasite del intestine del Rosthramus sociabilis levis Friedman Aves, Mem. Soc. Cubana Hist. Nat. 21 (1953) 251–255. [19] L.C. Muniz-Pereira, S.B. Amato, Natural hosts of Notocotylus breviserialis

Journal Pre-proof (Digenea, Notocotylidae) parasite of Brazilian waterfowl, Memórias Do Instituto Oswaldo Cruz. 90 (1995) 711–714. [20] Szidat, Studies on the Morphology and Life-History of Notocotylus minutus n. sp., a Digenetic Trematode from Ducks: Horace W. Stunkard, The Journal of Parasitology. 46 (1960) 803–809. [21] H.W. Stunkard, The Morphology and Life-History of Notocotylus atlanticus n. sp., a Digenetic Trematode of Eider Ducks, Somateria mollissima, and the

of

Designation, Notocotylus duboisi nom. nov., for Notocotylus imbricatus (Looss,

ro

1893) Szidat, 1935, Biological Bulletin. 131 (1966) 501–515.

-p

[22] S. Yamaguti, Zur Entwicklungsgeschichte von Notocotylus Attenuatus (Rud.,

re

1809) und N. magniovatus Yamaguti, 1934, Zeitschrift Für Parasitenkunde. 10 (1938) 288–292. doi:10.1007/bf02124952.

lP

[23] S. Yamaguti, A synoptical review of life histories of digenetic trematodes of

Keigaku Pu, 1975.

na

vertebrates with special reference to the morphology of their larval forms.,

Jo ur

[24] R. Hechinger, Faunal survey and identification key for the trematodes (Platyhelminthes: Digenea) infecting Potamopyrgus antipodarum (Gastropoda: Hydrobiidae) as first intermediate host, Zootaxa. 3418 (2012) 1–27. [25] G. Graefe, Paramonostomum antarcticum n. sp.(Trematoda: Notocotylidae) und Beobachtungen zur Larvenentwicklung in der Antarktis, Parasitology Research. 30 (1968) 207–232. [26] S.R. Martorelli, E. Morriconi, P.S. Marcotegui, Efectos de dos estadios larvales de digeneos sobre la gónada de Nacella (P.) Magellanica y N.(P.) deaurata en Ushuaia, Argentina, Parasitologıa Latinoamericana. 60 (2005) 351–352. [27] E. Bagnato, C. Gilardoni, G. Di Giorgio, F. Cremonte, A checklist of marine

Journal Pre-proof larval trematodes (Digenea) in molluscs from Argentina, Southwestern Atlantic coast, Check List. 11 (2015). doi:10.15560/11.4.1706. [28] C. Gilardoni, G. Di Giorgio, E. Bagnato, F. Cremonte, Survey of trematodes in intertidal snails from Patagonia, Argentina: new larval forms and diversity assessment, Journal of Helminthology. (2018) 1–10. doi:10.1017/S0022149X18000329. [29] P.D. Hebert, S. Ratnasingham, J.R. de Waard, Barcoding animal life: cytochrome

of

c oxidase subunit 1 divergences among closely related species, Biological

Jo ur

na

lP

re

-p

ro

Sciences. 270 (2003) S96–S99.

Journal Pre-proof Figure captions

Fig. 1 Line drawings of Notocotylus primulus n. sp. (Trematoda: Notocotylidae) from the Crested Duck, Lophonetta specularioides (Aves, Anatidae), from Patagonian coast, southwestern Atlantic Ocean. a. Ventral view, internal anatomy. b. External ventral view showing papillae distribution. c. Egg. Scales: a, b = 500µm; c= 50µm.

of

Fig. 2 SEM photographs of Notocotylus primulus n. sp. (Trematoda: Notocotylidae)

ro

from the Crested Duck, Lophonetta specularioides (Aves, Anatidae), from Patagonian

-p

coast, southwestern Atlantic Ocean. a. Oral sucker showing genital pore (arrow)

re

surrounded by a ring of papillae (black arrow). b. Detail of genital pore. c. Anterior lateral dorsal spines. d. Posterior lateral dorsal spines. e. Anterior ventral spines. f.

Jo ur

na

lP

Posterior ventral spines. Scales: a = 20µm; b= 10µm; c-f= 5µm.

Journal Pre-proof Table 1. Sequences ITS2 and 28S of rDNA for species of the family Notocotylidae and Gymnopalloides nacellae (family Gymnophallidae, order Bucephalata outgroup). Pairwise distance was calculated among ITS2 and 28S sequences respectively and there are presented as the percentage of nucleotide differences in comparison with Notocotylus primulus n. sp. (gaps treated as missing data)

Ogmocotyle capricorni Notocotylus malhamensis

Notocotylus intestinalis

Notocotylus attenuat us Nototcoylus sp. UKPO-2003

Notocotylus sp. JTD2012 Notocotylus sp. AK2017 Notocotylus sp. BH2008 Tristriata anatis

Ogmogaster

adult

Argentin a

MH880281. 1

ITS2-28S

adult

United Kingdom

JQ766940.1

ITS2

0.037

adult

United States China

MK614163

ITS2

0.053

ITS2

0.316

Goats

adult

ITS2

0.274

Capricornis crispus (Mammalia) Myodes glareolus, Microtus agrestis (Mammalia) Oryzomys palustris Bithynia fuchsiana, Parafossarulu s striatulus, Melanoides tuberculata (Gastropoda) Not specified

adult

KR080174. 1 KR080170. 1 AB367788. 1

ITS2

0.309

United Kingdom

JQ766939.1

28S

0.046

United States Vietnam

MK614163

28S

0.048

JQ890563.2

28S

0.035

of

Lophonetta specularioide s (Aves) Myodes glareolus, Microtus agrestis (Mammalia) Oryzomys palustris Goats

Pairwis e distanc e -

adult

Jo ur

Notocotylus fosteri

Sequence d region of rDNA

Limnaea palustris (Gastropoda) Ondatra zibethicus (Mammalia) Radix balthica (Gastropoda) Physa gyrina (Gastropoda) Littorina saxatilis (Gastropoda) Balaenoptera

ro

Ogmocotyle sp. JM2015 Ogmocotyle sikae

GenBank Accession Number

-p

Notocotylus fosteri

Locality

China

re

Notocotylus malhamensis

Stage

lP

Notocotylus primulus n. sp.

Host

adult

na

Species

adult redia

Japan

Not specified redia

Not specified United Kingdom

AF184259.1

28S

0.039

AY222219. 1

28S

0.044

adult

United States

JQ670849.1

28S

0.050

cercaria

Norway

KY513158. 1

28S

0.044

cercaria

EU712725.1

28S

0.044

cercaria

United Stated Norway

KX833057. 1

28S

0.031

adult

Argentin

KM258675.

28S

0.037

Journal Pre-proof antartica Quinqueserialis quinqueserialis Catatropis indicus

Nacella magellanica (Gastropoda)

a

1

adult

United States

JQ670848.1

28S

0.037

adult

Australia

AY222220. 1

28S

0.044

Not specified metacercari a

Ukraine

AF184258.1

28S

0.033

Argentin a

KM246857. 1

ITS2 28S

0.593 0.470

Jo ur

na

lP

re

-p

ro

of

Paramonostomum anatis Gymnophalloides nacellae

borealis (Mammalia) Ondatra zibethicus (Mammalia) Cairina moschata (Aves) Not specified

Jo ur

na

lP

re

-p

ro

of

Journal Pre-proof

Jo ur

na

lP

re

-p

ro

of

Journal Pre-proof

Journal Pre-proof

Highlights

na

lP

re

-p

ro

of

Notocotylus primulus n. sp. is described from Lophonetta specularioides from Argentina. The new species is morphologically and genetically characterized It is the first record of a trematode parasite in the endemic Crested Duck

Jo ur

  

Figure 1

Figure 2