Novel alternative promoters of mouse glial cell line-derived neurotrophic factor gene

Biochimica et Biophysica Acta 1494 (2000) 63^74

www.elsevier.com/locate/bba

Novel alternative promoters of mouse glial cell line-derived neurotrophic factor gene Mikiei Tanaka, Sachiko Ito, Kazutoshi Kiuchi

1;

*

Laboratory for Genes of Motor Systems, Bio-Mimetic Control Research Program, The Institute of Physical and Chemical Research Center (RIKEN), Moriyama, Nagoya 463-0003, Japan Received 6 June 2000; received in revised form 7 August 2000; accepted 22 August 2000

Abstract We previously isolated cDNA and genomic DNA of the mouse glial cell line-derived neurotrophic factor (GDNF) gene and found that the gene consists of three exons. Recently, it was suggested that an alternative promoter exists within intron 1 of the human GDNF gene, but this has not been confirmed. Novel cDNA clones of the mouse GDNF gene were isolated by 5P-rapid amplification of cDNA ends from postnatal day-14 striatum. A novel exon, containing 351 nucleotides, exists between exon 1 and exon 3 (referred to as exon 2 in our previous report). Luciferase reporter assay showed that a core promoter for the novel exon 2 requires its 5P-untranslated region. Primer extension analysis and reverse transcription-PCR identified another novel transcript that starts 39 bp upstream of exon 3, and the core promoter activity exists within a region containing putative Sp1 sites. Although the core promoters for the novel exons are different from those previously identified, transcripts derived from each promoter coincidentally increased with interleukin-1L or tumor necrosis factor-K stimulation. Gel retardation assays suggested that the NF-UB binding site in intron 1 would be involved in the cytokine response of the mouse GDNF gene. ß 2000 Elsevier Science B.V. All rights reserved. Keywords : GDNF gene; Gene structure; Alternative promoter ; In£ammatory cytokine ; NF-UB

1. Introduction Glial cell line-derived neurotrophic factor (GDNF) was initially isolated and cloned as a potent neurotrophic factor for cultured dopaminergic neurons from the developing substantia nigra [1]. GDNF, distantly related to transforming growth factor-L (TGF-L), is a glycosylated protein of 39 kDa composed of a disul¢de-bonded homodimer [2,3]. In the central nervous system, in vitro studies suggest that GDNF plays an important role in the survival of developing midbrain dopaminergic neurons [1], cerebellar Purkinje neurons [4], and cranial and spinal cord moAbbreviations : GDNF, glial cell line-derived neurotrophic factor; 5PRACE, 5P-rapid ampli¢cation of cDNA ends; RT^PCR, reverse transcription^polymerase chain reaction; TGF-L, transforming growth factor-L; TPA, tetradecanoylphorbol 13-acetate; NGF, nerve growth factor; FGF-2, ¢broblast growth factor-2 ; TNF-K, tumor necrosis factor-K; IL1L, interleukin-1L; BDNF, brain-derived neurotrophic factor; NT-3, neurotrophin-3 ; NT-4, neurotrophin-4; MZF, myeloid zinc ¢nger * Corresponding author. Fax: +81-52-736-5865; E-mail : [email protected] 1 Present address: Department of Biomolecular Science, Faculty of Engineering, Gifu University, Gifu, Japan.

tor neurons [5,6]. In the peripheral nervous system, GDNF supports the development of multiple neuronal populations including sympathetic, parasympathetic and sensory neurons [7^9]. Immunohistochemical and in situ hybridization analyses showed that GDNF expression is widespread outside the nervous system [7,10^13]. Consistent with results of GDNF transcript localization, targeted disruption of the mouse GDNF gene showed that GDNF is essential for the development of kidney and enteric neurons during embryogenesis [14^16]. Therefore, GDNF gene expression would be controlled in a fairly complicated manner similar to the multiple promoter system observed in neurotrophin family members, nerve growth factor (NGF) [17], brain derived neurotrophic factor (BDNF) [18], neurotrophin-3 (NT-3) [19] and neurotrophin-4 (NT4) [20]. In our previous study, we found that the mouse GDNF gene consists of three exons and its promoter has a consensus TATA-box sequence 38 bp upstream from the transcription start site [21]. Recently, three groups have reported the structure and characteristics of the human GDNF gene. Two groups described a GDNF transcript that contains a short untranslated region as exon 1 [22,23]

0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 0 ) 0 0 2 1 8 - 9

BBAEXP 93456 30-10-00

64

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

while the other group showed that the 5P-untranslated region extended to more than 1 kb, consistent with the mouse GDNF gene [24]. Moreover, the latter group indicated that a second promoter is mapped to the 5P-£anking region of exon 2 and has relatively low promoter activity. Suter-Crazzolara et al. found additional exons and suggested the existence of another promoter in the human GDNF gene (GenBank accession no. AJ001896). To clarify the expression mechanism of the GDNF gene, pharmacological analyses have been performed using immortalized cell lines such as rat C6 glioma cells and neuroblastoma cells [25^29]. In our previous study, GDNF mRNA was increased in the presence of tetradecanoylphorbol 13-acetate (TPA), suggesting that an AP1 binding site is involved in the induction of the GDNF gene [21]. On the other hand, in a glial cell lineage, in£ammatory cytokines were found to stimulate the expression of neurotrophic factors such as NGF [30^33] and ¢broblast growth factor-2 (FGF-2) [34], and the signaling pathway through a transcription factor, NF-UB, has been evaluated [31,35]. Interleukin-1L (IL-1L) is known to be a cytokine-mediating cellular responses to injury in the central nervous system. It has been reported that IL-1L is trophic to dopaminergic and other catecholaminergic neurons [36^38], and also is a key factor for development of dopaminergic neurons [39]. In the case of GDNF expression, lipopolysaccharide, tumor necrosis factor-K (TNF-K) and IL-1L are found to increase protein secretion from primary cultured astrocytes [26], and also from rat or human glioblastoma cell line [27,40]. On the contrary, Ho and Blum indicated that IL-1L stimulates FGF-2 expression but not GDNF expression in rat striatum in vivo as well as in primary striatal astrocyte cultures in vitro [41]. Cytokine induction of the GDNF gene could have an analogy to that of other neurotrophic factor genes with multiple promoters. In this study, we have isolated GDNF cDNA clones from a library of postnatal day 14 mouse striatum by 5PRACE. Primer extension and reverse transcription-PCR (RT^PCR) analyses were performed on RNA from mouse astrocytes. We identi¢ed two novel GDNF transcripts and corresponding promoters, and estimated the characteristics of three alternative promoters. Using neural and glial cell lines, we compared relative activities of these promoters and degree of induction of each transcript by cytokine stimulation. We carried out gel retardation assays to estimate the in£ammatory cytokine responsive element, NF-UB binding site. 2. Materials and methods 2.1. cDNA cloning of mouse GDNF by 5P-RACE Total RNA was extracted from mouse striatum of postnatal day 14 with RNeasy extraction kit (Qiagen), and

then poly (A)‡ RNA was isolated by mRNA extraction kit (Promega). RACE experiments were performed using the Marathon cDNA Ampli¢cation kit (Clontech). Double-stranded cDNA synthesized from 2 Wg of poly (A)‡ RNA was subjected to PCR ampli¢cation with the adapter primer AP1 (including in the kit) and the GDNF-speci¢c primer, RACE-R1 corresponding to the formerly exon 2 (Table 1). Temperature cycling parameters consisted of initial denaturation at 94³CU1 min, followed by ¢ve cycles of 94³CU30 s, 72³CU3 min, then ¢ve cycles of 94³CU30 s, 70³CU3 min, then 25 cycles of 94³CU20 s, 68³CU3 min. Following ampli¢cation, the primary product was diluted and ampli¢ed again with the adapter primer AP2 and the RACE-R2 corresponding to the nested position of RACE-R1 (Table 1). Temperature cycling parameters consisted of initial denaturation at 94³C for 1 min, followed by 35 cycles of 94³C for 30 s, 68³C for 3 min, then ¢nally 68³C for 10 min. 2.2. RT^PCR After cell culture was washed with PBS, total RNA was extracted with RNeasy RNA extraction kit (Qiagen) followed by DNase I treatment. 3 Wg of total RNA thus obtained was reverse-transcribed with oligo (dT) primer and RNase H3 reverse transcriptase for 1 h at 42³C (Gibco BRL). After RNase H treatment, the cDNA synthesized was subjected to PCR ampli¢cation with primers listed in Table 1. PCR ampli¢cation was carried out as follows : initial denaturation at 95³C for 3 min, followed by 25 cycles of 95³CU1 min, 60³CU1 min and 72³CU1 min for L-actin using actin-se and actin-an primers, or for GDNF exon 1 30 cycles of 95³CU1 min, 62³CU1 min and 72³CU1 min using EXON1se and EXON4an-1 primers, or for GDNF exon 2 35 cycles of 95³CU1 min, 62³CU1 min and 72³CU1 min using EXON2se and EXON4an-2 primers, or for GDNF exon 3 35 cycles of 95³CU1 min, 60³CU1 min and 72³CU1 min using EXON3se and EXON4an-2 primers, then 72³C for 10 min. To determine optimal experimental conditions for relative quanti¢cation of transcripts, we preliminarily tested RT^PCR at several cycle numbers (20^40 cycles) with variable cDNA concentrations (0^0.2 Wg cDNA). Using two sets of indepenTable 1 Oligonucleotide sequences Name

Sequence (5P^3P)

RACE-R1 RACE-R2 EXON1se EXON2se EXON3se EXON4an-1 EXON4an-2 actin-se actin-an

GCAGCGGGAAGGCAGACGCGGTGT GGAGCAACACCAGGCAGACA TGGATTGCGTGCTCTTGCTC GAACCCAACAGCTGCGGAGAAAA TTCTCTTCCCCGCTGCCC CATGACGTCATCAAACTGGTCAGGA CCACACCGTTTAGCGGAATGC AAGTGTGACGTTGACATCCGT CTCATCGTACTCCTGCTT

BBAEXP 93456 30-10-00

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

dently prepared cDNA samples, semi-quantitative RT^ PCR was performed in triplicate for each. 2.3. DNA sequencing 5P-RACE or RT^PCR products were electrophoresed in 1.5% agarose gel and appropriate size of DNA fragments were puri¢ed with QIAgel extraction kit (Qiagen), then subcloned in pGEM-T vector (Qiagen) for sequence analysis. Genomic DNA fragments were subcloned in pBluescript from genomic l clones provided in the previous study. Nucleotide sequences were determined by the dideoxynucleotide chain termination method using a Thermo Sequenase cycle sequencing kit or a Cy5 Thermo Sequenase Dye Terminator kit (Amersham Pharmacia). The reactions were run on an ALFred sequencer. Promoter sequences were searched for transcription factor binding sites using a program of MatInspector [42]. 2.4. Cell culture Mouse C1300 neuroblastoma cells, which are derived from Neuro2a cell line, were obtained from RIKEN cell bank and propagated in RPMI1640 supplemented with 10% fetal bovine serum as recommended. Mouse astroglial cell-lines TGA-3 were cloned from a primary culture of neonatal astrocyte. The cells were cultured in Dulbecco's modi¢ed Eagle's medium (DMEM) plus 7% fetal bovine serum. A culture within the tenth serial passage after recovery from frozen stocks was used for experiments. In the expression test, cells grown to 70^80% con£uence in 6-cm dish plates were rinsed with phosphate-bu¡ered saline (PBS) once, then incubated in Opti-MEM plus 1% fetal bovine serum for 24 h, followed by an exchange with the medium containing 10 ng/ml of IL-1L or TNF-K, and incubated for the desired times. 2.5. Plasmid pGL3-Basic and pRL-TK luciferase reporter vectors (Promega) were used for GDNF promoter reporter assays. A 3.5 kb EcoRI/BamHI fragment containing exon 1 and its upstream region, a 2.5 kb EcoRI/PvuII fragment containing exon 2 and its upstream region and a 1.7 kb EcoRI/SmaI fragment containing exon 3 (formerly named as exon 2) and its upstream region was subcloned from the VmgGDNF1 clone isolated previously [21]. DNA fragments were prepared from the subclone maintained in the pBluescript vector with appropriate restriction enzyme digestion and then treated with T4 polymerase or klenow fragment if necessary. DNA fragments thus obtained were ligated into the pGL3-Basic vector at SmaI site, giving pGL3^GDNF constructs. In the case of pGL3^GDNF (DraI/BstUI) construct containing upstream of exon 2, the corresponding fragment was prepared by PCR ampli¢cation using primers (TTTAAAAGCTTTCCGT-

65

GAGCC as a sense primer, CGCGGGGTTAAGGC as an antisense primer), since there is another BstUI site in the fragment. The PCR product was completely bluntended using T4 polymerase and then treated by T4 polynucleotide kinase. The resultant fragment was ligated into SmaI site of pGL3-Basic vector. In the case of pGL3^ GDNF (EcoRI/HinfI) or PGL3^GDNF (XbaI/HinfI) containing exon 3 and its upstream region, 1.1 kb of EcoRI/ ApaI or 0.7 kb of XbaI/ApaI fragment was treated with Klenow fragment to give a blunt-ended form at EcoRI or XbaI site. These fragments were ligated into the pGL3^ GDNF (SacI/HinfI) construct cleaved with KpnI, which was blunt-ended by T4 polymerase then cleaved with ApaI. 2.6. Transfection and luciferase assay Cells were grown to 80^90% con£uence in a 12-well plate (Falcon). The pGL3^GDNF construct was transiently transfected in the presence of Tfx-50 (Promega) according to the manufacturer's instructions. Transfection mixture for TGA-3 cells consisted of 2.7 Wg of plasmid pGL3^GDNF and 12.2 Wl of Tfx-50 reagent in 0.4 ml of OPTI-MEM (Gibco BRL). pRL-TK control vector (onetenth the amount of experimental vector) was added to determine transfection e¤ciency. After a 15-min incubation at room temperature, the transfection mixture was brie£y vortexed and added to the cells previously rinsed with PBS. The cells were returned to a CO2 incubator and incubated at 37³C for 1 h. The transfected cells were then gently overlaid with DMEM or RPMI1640 containing FBS prewarmed to 37³C, and incubated for an additional 48 h before the luciferase assay. Luciferase assays were performed using Dual-Luciferase Reporter Assay System (Promega). The transfected cells were rinsed with cold PBS twice and incubated in 250 Wl of Passive Lysis bu¡er for 15 min at room temperature. Ten Wl of cell lysate was mixed with 50 Wl of ¢re£y luciferase assay reagent, and then the £uorescence intensity was integrated for 10 s using a Turner Designs Model TD-20/20 luminometer (Promega). Subsequently, the resultant mixture was used for a Renilla luciferase assay. 2.7. Southern hybridization Total genomic DNA derived from adult mouse kidney was purchased from Clontech. Genomic DNA from TGA3 cells was prepared by the method of Blin and Sta¡ord [43]. Brie£y, TGA-3 cell lysate treated with proteinase K for 1 h at 55³C was extracted with phenol saturated by Tris-bu¡ered saline, then extracted with chloroform/isoamylalcohol (24:1). Genomic DNA was precipitated by adding 3 volumes of cold ethanol, then rinsed with 70% ethanol once and air-dried, followed by suspending with 1 mM Tris^HCl (pH 8.0), 0.1 mM EDTA. DraI/SmaI fragment (270 bp) located between exon 2 and exon 3 was

BBAEXP 93456 30-10-00

66

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

radiolabeled with 32 P-CTP (speci¢c activity 800 Ci/mmol, AmershamPharmacia) using a rediprime II DNA labeling system in the presence of random hexamers (Pharmacia). Ten Wg of genomic DNA cleaved with restriction enzymes were electrophoresed in 0.8% agarose gel and blotted onto Biodyne plus nylon membrane (Pall Gelman Sciences). This membrane was hybridized at 65³C with a 32 P-labeled probe in a hybridization solution (Clontech), followed by washing with the solution twice at 50³C for 40 min. The membrane was exposed on X-OMAT (Kodak) overnight. 2.8. Primer extension To determine the transcription start site, 5 Wg of poly (A)‡ RNA prepared from TGA-3 cells was annealed to oligonucleotide probe 32 P-end-labeled by T4 polynucleotide kinase (Takara) in 250 mM KCl, 10 mM Tris^HCl (pH 8.0), 1 mM EDTA at 65³C for 1 h, then allowed to stand at room temperature for 1 h. After precipitation with ethanol, the annealed primer was extended at 42³C for 1 h with reverse transcriptase (Gibco BRL) in a commercially provided bu¡er in the presence of RNase inhibitor RNasin (Promega). The resultant sample was electrophoresed in a 8 M urea/6% acrylamide sequencing gel at 1700 V for 2 h. The DNA sequence ladder was prepared using BcaBest sequencing kit (Takara) with the corresponding oligonucleotide probe and applied to the gel at the same time. The gel was dried and autoradiographed by X-OMAT ¢lm with ampli¢cation or exposed with Bioimaging analyzer (Fuji ¢lm).

11.5 Wl of reaction mixture containing 100 mM KCl, 10 mM Tris^HCl (pH 7.5), 1 mM EDTA, 12.5% glycerol, 0.1% Triton X-100, 0.5 Wg of poly(dI-dC)cpoly(dI-dC), 2.5 Wg of bovine serum albumin, and 5000 cpm of labeled probe (approximately 80 pg). This mixture was incubated for 30 min at 4³C. In the supershift assays, anti-NF-UB p50, anti-NF-UB p65, or anti-c-Rel (Santa Cruz Biotechnology) was added to the reaction mixture after a 30-min incubation and further incubated for 1 h at 4³C. The binding reaction mixture was separated by 5% polyacrylamide gel electrophoresis at 20 mA at 4³C. The gels were dried and exposed to X-OMAT ¢lm (Kodak). 3. Results 3.1. Isolation of mouse GDNF cDNA clones To investigate a multi-promoter system of the mouse GDNF gene, we performed 5P-RACE with a cDNA library from mouse striatum at postnatal day 14 using a primer corresponding to mouse GDNF exon 2 named in

2.9. Gel retardation assay TGA-3 cells were incubated with IL-1L (10 ng/ml) and TNF-K (10 ng/ml) for 2 h before harvesting as described above. Nuclear extracts were prepared according to the methods of Schreiber [44] and stored at 380³C until use. Protein concentration was determined using the Lowry assay (BioRad). Gel retardation assays were performed using double-stranded oligonucleotides (Table 2). Annealed oligonucleotides were end-labeled with [Q-32 P]ATP by T4 polynucleotide kinase (Takara) and puri¢ed over an NAP-5 column (Amersham Pharmacia Biotech). An aliquot (0.5 Wl) of nuclear extract (2.0 Wg/Wl) was added to Table 2 Oligonucleotide sequences for gel retardation assay Name

Sequence (5P^3P)

Region

5P-ups

CTGAGTGGCCTTTCCGGAAG

itn1-a itn1-b itn1-c itn2-a itn2-b itn2-c NF-UB

GAGAAGGGTAATTCCCCTAC CTACAGGAAACACCCGAATT TAAATAGGAAAACCCTCTTA CGGGAGGGATGTACCCCGGA TGGATGGGACTTTTCGCCAA CAGATGGGGGCTACCCCGTG ATCGAGGGGACTTTCCCTAG

31484/31475 5P-£anking region 32389/32380 intron 1 31184/31175 intron 1 356/346 intron 1 31385/31376 intron 2 31104/31095 intron 2 3374/3365 intron 2 Consensus sequence

Fig. 1. (A) Nucleotide sequence of PSTM-1 (upper) and PSTM-2 (lower) cDNA clones from P14 mouse striatum. In the PSTM-1 cDNA clone, nucleotides 106^174 (underlined) correspond to previous exon 2, and nucleotides 155^174 (italic) correspond to the 5P-RACE primer. The nucleotide sequence without underline is a novel transcript of mouse GDNF gene. The PSTM-2 cDNA clone was terminated within exon 2 (underlined). The last 20 bp (italic) corresponds to a 5P-RACE primer. Another cDNA clone of 5 bp short form was also isolated (data not shown). (B) Genomic organization of mouse GDNF gene. The mouse GDNF gene is divided into four exons, represented by the numbered and boxes. Three types of cleavage sites are indicated : B, BamHI, E, EcoRI, X, XhoI. Positions of the four cloned DNAs are shown down the structure.

BBAEXP 93456 30-10-00

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

67

our previous study [21]. One isolated cDNA clone, PSTM1, comprised a novel 104 bp sequence, which was followed by the consensus sequence of exon 2 (Fig. 1A, upper). Another cDNA clone, PSTM2, has a 2 bp truncated form of exon 2 at its 5P-end (Fig. 1A, lower). A cDNA clone which showed a 5 bp truncation of exon 2 at its 5P-end was also isolated (data not shown). The other isolated cDNA clones contained a part of exon 1 sequence, similar to cDNA clones previously reported [21^ 24]. 3.2. Mapping of the novel GDNF cDNA

Fig. 2. Genomic southern hybridization. Restriction enzyme digested genome DNA from adult kidney or TGA-3 cells were blotted onto a nylon membrane. The 0.4 kb upstream region of novel exon 2 (270 bp long DraI/SmaI fragment) was used for probe preparation. Radiolabeled probe was hybridized at 65³C for 1.5 h, then washed at 50³C. H, HindIII, P, PstI, E, EcoRI.

Probe derived from the novel sequence of clone PSTM1 was hybridized with the Vmg GDNF1 which was previously cloned from a mouse genomic library [21], suggesting that the novel portion of the PSTM1 cDNA was located downstream of exon 1. We found that exon 2 was located 4.4 kb downstream of exon 1 based on the sequence of Vmg GDNF1. To determine the locus of PSTM1, we sequenced the Vmg GDNF1 clone and found that this additional exon was mapped at 2.5 kb downstream of exon 1. Therefore, the mouse GDNF gene is organized as in Fig. 1B, in which we designate the novel cDNA as exon 2 and formerly named exon 2 as exon 3. Furthermore, we con¢rmed the mouse GDNF gene structure by means of genomic southern hybridization (Fig. 2). Genome DNA fragments from mouse adult kidney and

Fig. 3. Primer extension analysis of the transcription start sites. (A) The end-labeled oligonucleotide probe, primer II-2, was hybridized with 5 Wg of poly(A)‡ RNA from TGA-3 cells and analyzed. Primer-extended products were synthesized as described in Section 2. The sequence ladder (A, C, G, T) was generated by sequencing the 5P-£anking region of the novel exon with the same primer used for primer extension analysis. The potential transcription start sites are indicated by arrows. (B) The end-labeled probe, primer III-2, was hybridized with 5 Wg of poly(A)‡ RNA from TGA-3 cells and analyzed. Symbols are the same as described above.

BBAEXP 93456 30-10-00

68

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

Fig. 4. (A) Nucleotide sequence of the novel exon 2 and its 5P-£anking region. Transcription start sites determined by primer extension analysis are indicated by arrowheads. Antisense primers used for primer extension analysis are indicated by arrows. Nucleotide region corresponding to PSTM1 clone is underlined. Putative transcription factor binding sites, and a TAAA repeat sequence are boxed. Coincident nucleotides with human GDNF gene are indicated by asterisks on the head. The numbers alongside the sequence refer to the nucleotide position relative to the most 5P-extreme end of exon 2. (B) Nucleotide sequence of the novel exon 3 and its 5P-£anking region. The 3P-splicing site is indicated by a vertical line. Alternative splicing region is underlined. The numbers alongside the sequence refer to the nucleotide position relative to the most 5P-extreme end of exon 3.

TGA-3 cell line were hybridized with a probe corresponding to upstream of exon 3 (DraI/SmaI). Consistent with the results from sequence analysis, 12 kb of EcoRI fragments, 3.0 kb of HindIII fragments, and 2.8 kb of PstI fragments were hybridized in both genome DNA fragments tested (Fig. 2). 3.3. Identi¢cation of transcription start sites corresponding to exon 2 and exon 3 To determine transcription initiation sites corresponding to exon 2, we ¢rst executed RNase mapping using a 0.4 kb cRNA probe corresponding to the HindIII/PvuII fragment, resulting that RNA transcript proceeds 250 bp upstream from 5P-end of PSTM1 clone (data not shown). To con¢rm the initiation site, a primer extension experiment was performed using several primers around the putative initiation point. As shown in Fig. 3A, extension of primer II-2 yielded three distinct signals at 247, 246, and 243 bp upstream from the 5P-end of the PSTM1 clone. The results

were con¢rmed by primer extension analysis using primer II-1 around 160 bp downstream from the initiation sites (data not shown). Therefore, exon 2 consists of 351 nt as a 5P-untranslated region. Since the 2 bp truncated form of exon 2 at 5P-end as PSTM2 clone was obtained (Fig. 1), we suspected an additional exon and promoter upstream of exon 3 as likely in human GDNF gene (GenBank accession no. AJ001896) [24]. We performed primer extension analysis using primer III-1 and obtained two signals corresponding to 5P-£anking region of exon 3 (data not shown). To con¢rm the transcription start sites, primer extension experiment was carried out using primer III-2 upstream of PSTM2 clone. As shown in Fig. 3B, two transcription start sites were observed at 39 and 38 bp upstream of formerly identi¢ed exon 2. 3.4. Organization of mouse GDNF gene As shown in Fig. 4A, nucleotide sequence of novel exon

BBAEXP 93456 30-10-00

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

69

Fig. 5. Identi¢cation of core promoter regions of the mouse GDNF exon 2. pGL3^GDNF constructs containing promoter 2 region were transiently transfected into TGA-3 cells. The resultant values were normalized to those of pGL3^GDNF (DraI/StuI). Values (n = 6) are represented by mean þ S.E.M. of at least three independent experiments.

2 and its 0.2 kb 5P-£anking region of the mouse gene is homologous to that of the human gene, in particular, 350/ +90 and +200/+351 fragments of the mouse gene. A unique repeat sequence, (TAAA)6 , is located at 382/ 359, which is related to binding sites of a forkhead transcription factor, FREAC or a zinc ¢nger protein, G¢-1. In addition, a low homology TATA-box like sequence (362/ 354) was found in the repeat sequence compared to the consensus sequence, STATAAAWR (0.853 of matrix similarity according to the program of MatInspector [42]), though that repeat sequence is not conserved in the human gene. On the other hand, a putative Sp1 site is located in exon 2, +172/+181. There also exist several transcription

binding sites, AP4, c-ets, myeloid zinc ¢nger 1, and POU domain factor, Brn2. The mouse GDNF exon 2 contains two ATG sequences (+318/+320 and +325/+327). Compared with human GDNF exon 2 [24], the sequence of the corresponding mouse GDNF exon 3 shows 94% homology, whereas 68% homology is found in the preceding 39 bp sequence of exon 3, and lower homology in the 5P-£anking region (Fig. 4B). The 3P-end sequence of the 39 bp fragment is CAG following cytosine-rich sequence, which is consistent with the consensus 3P-splice site. Four putative Sp1 binding sites are located in a candidate promoter 3. putative deltaEF1, gut-enriched Kruppel-like factor, ikaros1, c-myb and Nkx2.5 are observed in the

Fig. 6. Identi¢cation of core promoter regions of the mouse GDNF exon 3. Each of pGL3^GDNF constructs containing promoter 3 region was transiently transfected into TGA-3 cells. The resultant values were normalized to those of pGL3^GDNF (Sau3AI/HinfI). A hatched line represents an alternative splicing exon region.

BBAEXP 93456 30-10-00

70

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

Fig. 7. (A) Schematic diagram of mouse GDNF gene promoters and transcripts. The untranslated regions are indicated by open boxes, and the coding regions by hatched boxes. Box sizes are not accurate to actual nucleotide lengths. (B) Sequence comparison of intervening regions of mouse and human GDNF gene. Intron 1, exon 2, and intron 2 of mouse GDNF gene are compared with intron 1 of human GDNF gene using the default values of window and stringency (11 and 10 bp, respectively). Mouse GDNF exon 2 region is shaded.

upstream region of exon 3. There are three putative sites for NF-UB in intron 2. Around the transcription start site for exon 3, c-myb, MyoD and c-ets are located in the 5PUTR of exon 3. The nucleotide sequences have been submitted to the GenBank database under GenBank accession no. D88351. 3.5. Analysis of GDNF promoter activities To identify a core promoter region for transcript containing exon 2, a luciferase reporter construct containing each of several fragments around its 5P-£anking region was transfected to TGA-3 mouse glial cells or C1300 mouse neuroblastoma cells. In Fig. 5, the promoter activity was observed in the 0.2 kb DraI/StuI region. Deletion of the Cfr10I/StuI region as well as the DraI/BstUI region from the DraI/StuI fragment showed little promoter activity, indicating that not only upstream region but downstream region of the transcription start site are required for the promoter activity. NheI/PvuII region, in which putative Sp1 site is contained showed little promoter activity. Moreover, KpnI/PvuII fragment showed little increase in promoter activity compared to KpnI/StuI fragment. Taken together, the 3112/+108 region, which contains a TATA box-like sequence is required for the proximal promoter activity. Sequence of the DraI/StuI region shows high homology to that of the human gene. 0.4 kb of upstream region of the 3112/+108 fragment showed depression of promoter 2 activity. The activity of alternative promoter 3 was observed in the SacI/HinfI fragment corresponding to the region from 3449 to +59 (Fig. 6). The pGL3^GDNF (PstI/HinfI) plasmid containing the 336/+59 fragment showed very weak promoter activity, indicating that the 3449/336 fragment contributes to the promoter activity. However, lower promoter activity was observed in the 3449/336 (SacI//PstI) region as well as in the 3224/336 (ApaLI/PstI) region compared with in the 3449/+59 region, indicating that

Fig. 8. Mouse GDNF mRNA induction in response to IL-1L. Total RNA was extracted from TGA-3 cells treated with IL-1L (10 ng/ml) for 2 or 4 h. Synthesized cDNA (0.3 Wg) was used for PCR ampli¢cation as described in Section 2. Semi-quantitative RT^PCR was performed using primers EXON1se and EXON4an-1 (A), EXON2se and EXON4an-2 (B), EXON3se and EXON4an-2 (C) or actin-se and actin-an (D). Band intensity (n = 6) is represented by mean þ S.E.M. of two independent experiments.

BBAEXP 93456 30-10-00

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

71

Fig. 9. Gel retardation assay using TGA-3 cells treated with cytokines. (A) Nuclear extracts from TGA-3 cells treated with or without cytokines were incubated with radiolabeled oligonucleotides containing NF-UB like-sequences as described in Table 2. (B) Nuclear extracts from TGA-3 cells treated with cytokines were interacted with the putative NF-UB site, itn1-a as in A. Antibodies were mixed with the reaction mixture and incubated for 1 h at 4³C. The speci¢c DNA/protein complexes (arrowheads) and the supershifted bands (arrow) are indicated.

the four putative Sp1 sites are not su¤cient for promoter activity. The 336/+59 region is required for the proximal promoter activity. As the promoter activity of 3224/+59 (ApaLI/HinfI) fragment shows more than that of 3122/ +59 (Sau3AI/HinfI), the core promoter for transcript starting from exon 3 can be de¢ned as the 283 bp of 3224/+59 fragment. In the core promoter region, four putative Sp-1 sites are located at sequences of 376/364, 3110/397, 3149/3137 and 3172/3160, which would be critical for the promoter activity (Fig. 4B). Promoter activities using C1300, neuroblastoma cells were also observed in promoter 3. Promoter assay using neuroblastoma cells showed that core promoter regions of the three promoters were coincident with the above results, suggesting that these promoters function in neuronal cells as well as glial cells (data not shown). 3.6. Structure of mouse GDNF gene and its transcripts As shown in Fig. 7A, the transcript generating from either exon 1 or exon 2 links to exon 3 after splicing. Nucleotide sequence at the 5P splice site of exon 2, GTGGCA shows conservation with the minimal essential sequence for 5P splicing but di¡ers from the consensus mammalian splice site, GTRAGT [45,46]. In addition, transcription of mouse GDNF gene is able to initiate from exon 3. From the results of RT^PCR experiments, all of transcripts comprise exon 3 and exon 4, and show smaller sized splicing variants as previously reported [47^ 50]. Therefore, there exist six types of GDNF transcripts in the mouse gene (Fig. 7A). Mouse GDNF gene consists of 2.6 kb of intron 1, 1.5 kb of intron 2, and 17 kb of intron 3, while the human GDNF gene consists of 4.6 kb

of intron 1 and 18 kb of intron 2 [24]. Fig. 7B shows a dot diagram between 4.4 kb of the mouse gene including intron 1, exon 2 and intron 2, and 4.6 kb of the human gene including intron 1 (GenBank accession no. AF063586), indicating there are several homologous regions including mouse GDNF exon 2. Recently, 10.2 kb of the 5P-£anking region and 9.4 kb of exon and intron region of the rat GDNF gene has been reported (GenBank accession no. AJ011432). Exon 1 and its 4 kb downstream region shows high homology between rat and mouse genes (94% and 84%, respectively), suggesting that rat GDNF gene is closely related to the mouse gene. 3.7. Transcriptional regulations of the GDNF promoters To estimate the e¡ect of cytokine stimulation on each promoter activity, we performed semi-quantitative RT^ PCR using TGA-3 cells. As shown in Fig. 8A, the expression level of transcript containing exon 1 increased approximately 3-fold by the treatment with IL-1L after 2 h incubation, and then declined to the basal level after 4 h incubation. Expression pro¢les of other transcripts starting in exon 2 or exon 3 in the presence of IL-1L were almost the same as that of exon 1 (Fig. 8B and C). A RT^PCR product corresponding to the coding region was consistently increased in the presence of IL-1L (data not shown). Expression levels of L-actin were unchanged in the conditions tested (Fig. 8D). In the case of TNF-K, similar induction patterns were obtained. Promoter activities peaked at 2 h incubation, and showed approximately 2-fold increase in exon 1 and exon 2, and exon 3. The expression was diminished after 4 h incubation (data not shown). During treatment with IL-1L or TNF-K, the cell

BBAEXP 93456 30-10-00

72

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

morphology and viability appeared the same as that under an unstimulated condition. 3.8. Putative NF-UB site in intron 1 According to sequence analyses, there are several putative NF-UB binding sites in the 5P-£anking region and intron 1 and 2. To evaluate whether these sites are functional, we carried out gel retardation assay using nuclear extract from TGA-3 cells. Fig. 9A shows that DNA/protein complex occurred in NF-UB site located in nt 32389/ 32380 of intron 1, which was increased in nuclear protein derived from cells treated by cytokines. To investigate whether the intronic putative NF-UB site would be bound by NF-UB transcription factor, we performed supershift assay using anti-bodies to NF-UB subunits. Fig. 9B shows that the intronic NF-UB complex interacts with anti-p50 and anti-p65 antibodies, but not with anti-c-Rel antibody, which is the same as results of the conventional NF-UB complex. In addition, retarded bands diminished in the presence of the consensus oligonucleotide of NF-UB binding site (data not shown), indicating that the putative NFUB site in intron 1 interacts with NF-UB composed of p50 and p65 subunits. 4. Discussion GDNF promotes cell survival and di¡erentiation both in CNS and PNS. Considering that GDNF elicits a potential trophic action in a wide variety of cells, we presume a multi-promoter system for GDNF gene expression. To address this hypothesis, we performed 5P-RACE using a cDNA library from postnatal day-14 mouse striatum and obtained novel cDNA clones. We isolated two novel cDNAs and corresponding promoters of the mouse GDNF gene. Our newly identi¢ed exon 2 was determined to be a 351-bp-long exon, and has not been identi¢ed as an exon in the human gene. Using a primer extension technique, we found an additional 39 bp sequence just upstream of exon 3, which shows signi¢cant homology compared with that of human GDNF exon 2. In the mouse GDNF gene, three alternative promoters probably work to produce GDNF transcripts. In the case of the human GDNF gene, Grimm et al. reported the existence of a second putative promoter according to the sequence data and slight promoter activity existed in 3P-end part of intron 1, 0.9 kb region upstream from exon 2 [24]. The alternative promoter of the human gene corresponds to promoter 3 for mouse GDNF transcript starting from exon 3; however, they have not shown any evidence for the transcription initiation site of human GDNF gene. From the promoter reporter assay, we de¢ned the core promoter for transcript starting from exon 3, in which four proximal Sp1 sites exist. Although lower homology is shown around promoter 3 region to human gene (Fig.

4B), single putative Sp1 site is found upstream region in human gene, suggesting that the human promoter elicits dependence on Sp1 site as well as mouse promoter 3, though further analysis is necessary to determine the transcription start site of human GDNF exon 2. We also observed 336/+59 region is required for promoter activity, suggesting that putative cis-element in that region, c-myb, MyoD, c-ets or Ik2 might activate promoter 3 driven by Sp1. Suter-Crazzolara et al. proposed the existence of alternative exons and promoters within intron 1 (GenBank accession no. AJ001896). According to their data, the alternatively spliced exons are located around 0.9^0.5 kb upstream from exon 2. Although dot matrix indicated signi¢cant homology between mouse and human gene in the corresponding region, at least our novel mouse GDNF exon 2 is de¢nitely distinct from their proposed human exon (Fig. 7B). Another human GDNF truncated form, ATF-2, previously described by Schaar and his colleagues was not observed [49]. Mouse GDNF gene organization of exon 1, exon 3, and exon 4 is comparable to those of the human GDNF gene [22^24]. From the 5P-RACE experiment, predominant cDNA clones were transcripts starting from exon 1 while the novel cDNA clones were minor ones, suggesting that promoter 1 supports major part of GDNF transcripts in the postnatal striatum. The GDNF transcripts from astroglial TGA-3 cells showed a ratio similar to those from the striatum. The luciferase promoter assay also revealed that the core promoter activity of promoter 1 gave the highest promoter activity among three of them (data not shown). This is possibly because the promoter 1 is preferentially driven by TATA-box, a typical transcription initiation element. Primer extension analyses revealed that transcription start site of exon 2 was far upstream of PSTM1 clone. The exon 2 sequence shows 67% of GC-content, particularly in +31/+54 and +118/+152 regions, which would cause to terminate the reverse transcription. Therefore, cDNA synthesis might be interrupted due to the secondary structure of mRNA. We de¢ned the core promoter for promoter 2 as 0.2 kb around the transcription start site, the 3112/+108 region. The TATA-box like sequence is located in the 5P-£anking region, suggesting a possible transcription initiation ciselement, whereas promoter 2 shows weak promoter activity compared to TATA-box containing promoter 1, possibly due to rather low stringency to the consensus sequence of TATA-box. Remarkably, only 5P-£anking region of exon 2, for instance, the 3112/34 region is not su¤cient for promoter activity, indicating that 5P-UTR of exon 2 is required for the promoter 2 activity (Fig. 5). Promoter analyses of insulin-like growth factor-I (IGF-I) gene revealed that essential promoter elements are located in its 5P-UTR [51,52], in which potential transcription binding sites for C/EBP K and L, HNF-1K were identi¢ed in the 5PUTR of IGF-I [53,54]. In the case of the 5P-UTR of exon

BBAEXP 93456 30-10-00

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

2, a c-ets site at +102/+109 might be a candidate for the cis-element ; however, there might be other unknown one(s) involved in transcription initiation. On the other hand, there exists a putative Sp1 site within 5P-UTR of exon 2. However, the Sp1 site in 5P-UTR of exon 2 would not be functional from the results of luciferase reporter assay (Fig. 5). Moreover, RNase mapping using probe of the 3112/+331 region revealed no transcription start site around the Sp1 site (data not shown). Therefore, there is no alternative promoter within exon 2 region. To characterize three promoters, we investigated time course of transcription in the presence of IL-1L revealing that all of them were transiently activated after 2 h incubation. Similar results were obtained in the treatment with TNF-K, indicating possibilities of promoter regulation through common signaling pathways. IL-1L receptor leads to activation and nuclear translocation of NF-UB, which induces target genes such as cytokines and trophic factors including NGF [31]. Putative NF-UB sites are located in introns as in Fig. 4 and also 5P-£anking region, 31484/ 31475, whereas the only site in intron 1 could interact with NF-UB dependent on cytokine stimulation, which was con¢rmed by supershift assay. Therefore, the intronic NF-UB site might be involved in promoter regulation in cytokine response. In the human and murine manganese superoxide dismutase (Mn-SOD) gene, the NF-UB binding site in intron was required for the gene induction after treatment of cytokine. In addition to the NF-UB site, proximal C/EBP and NF-1 binding sites were synergistically involved in the cytokine response [55^57]. In the mouse GDNF gene, C/EBP and NF-1 binding sites are located 240 and 50 bp downstream of the NF-UB site in intron 1, respectively, suggesting that GDNF gene might respond to cytokines in a similar way to Mn-SOD gene via these transcription factor binding sites. We are now investigating the function of these cis-elements. In this study, we isolated two novel promoters in addition to the promoter previously identi¢ed in mouse GDNF gene, and observed that all of them are simultaneously stimulated by in£ammatory cytokines in astroglial cells, suggesting a common promoter regulation to the three promoters. In this context, the multiple promoter system seems to be redundant toward the cytokine response; however, further investigation is needed into responsive elements to clarify regulation mechanisms of the mouse gene expression. More extensive research would be necessary for revealing speci¢c roles or functions of the multiple promoter system in mouse GDNF gene.

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

References [19] [1] L.F. Lin, D.H. Doherty, J.D. Lile, S. Bektesh, F. Collins, GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons, Science 260 (1993) 1130^1132. [2] K.T. Poulsen, M.P. Armanini, R.D. Klein, M.A. Hynes, H.S. Phil-

[20]

73

lips, A. Rosenthal, TGF beta 2 and TGF beta 3 are potent survival factors for midbrain dopaminergic neurons, Neuron 13 (1994) 1245^ 1252. C. Eigenbrot, N. Gerber, X-ray structure of glial cell-derived neurotrophic factor at 1.9 A resolution and implications for receptor binding (letter), Nat. Struct. Biol. 4 (1997) 435^438. H.T. Mount, D.O. Dean, J. Alberch, C.F. Dreyfus, I.B. Black, Glial cell line-derived neurotrophic factor promotes the survival and morphologic di¡erentiation of Purkinje cells (published erratum appears in Proc. Natl. Acad. Sci. USA 92 (1995) 11945), Proc. Natl. Acad. Sci. USA 92 (1995) 9092^9096. C.E. Henderson, H.S. Phillips, R.A. Pollock, A.M. Davies, C. Lemeulle, M. Armanini, L. Simmons, B. Mo¡et, R.A. Vandlen, L.C. Simpson et al., GDNF : a potent survival factor for motoneurons present in peripheral nerve and muscle, Science 266 (1994) 1062^1064. R.W. Oppenheim, L.J. Houenou, J.E. Johnson, L.F. Lin, L. Li, A.C. Lo, A.L. Newsome, D.M. Prevette, S. Wang, Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF, Nature 373 (1995) 344^346. M. Trupp, M. Ryden, H. Jornvall, H. Funakoshi, T. Timmusk, E. Arenas, C.F. Ibanez, Peripheral expression and biological activities of GDNF, a new neurotrophic factor for avian and mammalian peripheral neurons, J. Cell Biol. 130 (1995) 137^148. T. Ebendal, A. Tomac, B.J. Ho¡er, L. Olson, Glial cell line-derived neurotrophic factor stimulates ¢ber formation and survival in cultured neurons from peripheral autonomic ganglia, J. Neurosci. Res. 40 (1995) 276^284. A. Buj-Bello, V.L. Buchman, A. Horton, A. Rosenthal, A.M. Davies, GDNF is an age-speci¢c survival factor for sensory and autonomic neurons, Neuron 15 (1995) 821^828. D.L. Choi-Lundberg, M.C. Bohn, Ontogeny and distribution of glial cell line-derived neurotrophic factor (GDNF) mRNA in rat, Brain Res. Dev. Brain Res. 85 (1995) 80^88. P. Suvanto, J.O. Hiltunen, U. Arumae, M. Moshnyakov, H. Sariola, K. Sainio, M. Saarma, Localization of glial cell line-derived neurotrophic factor (GDNF) mRNA in embryonic rat by in situ hybridization, Eur. J. Neurosci. 8 (1996) 816^822. N.A. Pochon, A. Menoud, J.L. Tseng, A.D. Zurn, P. Aebischer, Neuronal GDNF expression in the adult rat nervous system identi¢ed by in situ hybridization, Eur. J. Neurosci. 9 (1997) 463^471. J.P. Golden, J.A. DeMaro, P.A. Osborne, J. Milbrandt, E.M. Johnson Jr., Expression of neurturin, GDNF, and GDNF family-receptor mRNA in the developing and mature mouse, Exp. Neurol. 158 (1999) 504^528. M.P. Sanchez, I. Silos-Santiago, J. Frisen, B. He, S.A. Lira, M. Barbacid, Renal agenesis and the absence of enteric neurons in mice lacking GDNF, Nature 382 (1996) 70^73. J.G. Pichel, L. Shen, H.Z. Sheng, A.C. Granholm, J. Drago, A. Grinberg, E.J. Lee, S.P. Huang, M. Saarma, B.J. Ho¡er, H. Sariola, H. Westphal, Defects in enteric innervation and kidney development in mice lacking GDNF, Nature 382 (1996) 73^76. M.W. Moore, R.D. Klein, I. Farinas, H. Sauer, M. Armanini, H. Phillips, L.F. Reichardt, A.M. Ryan, K. Carver-Moore, A. Rosenthal, Renal and neuronal abnormalities in mice lacking GDNF, Nature 382 (1996) 76^79. M.M. Racke, P.J. Mason, M.P. Johnson, R.G. Brankamp, M.D. Linnik, Demonstration of a second pharmacologically active promoter region in the NGF gene that induces transcription at exon 3, Brain Res. Mol. Brain Res. 41 (1996) 192^199. T. Timmusk, K. Palm, M. Metsis, T. Reintam, V. Paalme, M. Saarma, H. Persson, Multiple promoters direct tissue-speci¢c expression of the rat BDNF gene, Neuron 10 (1993) 475^489. A. Leingartner, D. Lindholm, Two promoters direct transcription of the mouse NT-3 gene, Eur. J. Neurosci. 6 (1994) 1149^1159. T. Salin, T. Timmusk, U. Lendahl, M. Metsis, Structural and functional characterization of the rat neurotrophin-4 gene, Mol. Cell. Neurosci. 9 (1997) 264^275.

BBAEXP 93456 30-10-00

74

M. Tanaka et al. / Biochimica et Biophysica Acta 1494 (2000) 63^74

[21] N. Matsushita, Y. Fujita, M. Tanaka, T. Nagatsu, K. Kiuchi, Cloning and structural organization of the gene encoding the mouse glial cell line-derived neurotrophic factor, GDNF, Gene 203 (1997) 149^ 157. [22] P.A. Baecker, W.H. Lee, A.N. Verity, R.M. Eglen, R.M. Johnson, Characterization of a promoter for the human glial cell line-derived neurotrophic factor gene, Brain Res. Mol. Brain Res. 69 (1999) 209^ 222. [23] D. Woodbury, D.G. Schaar, L. Ramakrishnan, I.B. Black, Novel structure of the human GDNF gene, Brain Res. 803 (1998) 95^104. [24] L. Grimm, E. Holinski-Feder, J. Teodoridis, B. Sche¡er, D. Schindelhauer, T. Meitinger, M. Ue¤ng, Analysis of the human GDNF gene reveals an inducible promoter, three exons, a triplet repeat within the 3P-UTR and alternative splice products, Hum. Mol. Genet. 7 (1998) 1873^1886. [25] A. Ho, A.C. Gore, C.S. Weickert, M. Blum, Glutamate regulation of GDNF gene expression in the striatum and primary striatal astrocytes, NeuroReport 6 (1995) 1454^1458. [26] E. Appel, O. Kolman, G. Kazimirsky, P.M. Blumberg, C. Brodie, Regulation of GDNF expression in cultured astrocytes by in£ammatory stimuli, NeuroReport 8 (1997) 3309^3312. [27] A.N. Verity, T.L. Wyatt, B. Hajos, R.M. Eglen, P.A. Baecker, R.M. Johnson, Regulation of glial cell line-derived neurotrophic factor release from rat C6 glioblastoma cells, J. Neurochem. 70 (1998) 531^ 539. [28] C. Suter-Crazzolara, K. Unsicker, GDNF mRNA levels are induced by FGF-2 in rat C6 glioblastoma cells, Brain Res. Mol. Brain Res. 41 (1996) 175^182. [29] P. Naveilhan, I. Neveu, D. Wion, P. Brachet, 1,25-Dihydroxyvitamin D3, an inducer of glial cell line-derived neurotrophic factor, NeuroReport 7 (1996) 2171^2175. [30] M. Carman-Krzan, B.C. Wise, Arachidonic acid lipoxygenation may mediate interleukin-1 stimulation of nerve growth factor secretion in astroglial cultures, J. Neurosci. Res. 34 (1993) 225^232. [31] W.J. Friedman, S. Thakur, L. Seidman, A.B. Rabson, Regulation of nerve growth factor mRNA by interleukin-1 in rat hippocampal astrocytes is mediated by NFkappaB, J. Biol. Chem. 271 (1996) 31115^ 31120. [32] D. Lindholm, R. Heumann, M. Meyer, H. Thoenen, Interleukin-1 regulates synthesis of nerve growth factor in non-neuronal cells of rat sciatic nerve, Nature 330 (1987) 658^659. [33] X. Vige, E. Costa, B.C. Wise, Mechanism of nerve growth factor mRNA regulation by interleukin-1 and basic ¢broblast growth factor in primary cultures of rat astrocytes, Mol. Pharmacol. 40 (1991) 186^ 192. [34] D.M. Araujo, C.W. Cotman, Basic FGF in astroglial, microglial, and neuronal cultures: characterization of binding sites and modulation of release by lymphokines and trophic factors, J. Neurosci. 12 (1992) 1668^1678. [35] J.W. Brooks, S.B. Mizel, Interleukin-1 signal transduction, Eur. Cytokine Netw. 5 (1994) 547^561. [36] Y. Akaneya, M. Takahashi, H. Hatanaka, Interleukin-1 beta enhances survival and interleukin-6 protects against MPP+ neurotoxicity in cultures of fetal rat dopaminergic neurons, Exp. Neurol. 136 (1995) 44^52. [37] J. Wang, K.S. Bankiewicz, R.J. Plunkett, E.H. Old¢eld, Intrastriatal implantation of interleukin-1. Reduction of parkinsonism in rats by enhancing neuronal sprouting from residual dopaminergic neurons in the ventral tegmental area of the midbrain, J. Neurosurg. 80 (1994) 484^490. [38] S. Zalcman, J.M. Green-Johnson, L. Murray, D.M. Nance, D. Dyck, H. Anisman, A.H. Greenberg, Cytokine-speci¢c central monoamine alterations induced by interleukin-1, -2 and -6, Brain Res. 643 (1994) 40^49. [39] Z.D. Ling, E.D. Potter, J.W. Lipton, P.M. Carvey, Di¡erentiation of mesencephalic progenitor cells into dopaminergic neurons by cytokines, Exp. Neurol. 149 (1998) 411^423.

[40] A.N. Verity, T.L. Wyatt, W. Lee, B. Hajos, P.A. Baecker, R.M. Eglen, R.M. Johnson, Di¡erential regulation of glial cell line-derived neurotrophic factor (GDNF) expression in human neuroblastoma and glioblastoma cell lines, J. Neurosci. Res. 55 (1999) 187^197. [41] A. Ho, M. Blum, Regulation of astroglial-derived dopaminergic neurotrophic factors by interleukin-1 beta in the striatum of young and middle-aged mice, Exp. Neurol. 148 (1997) 348^359. [42] K. Quandt, K. Frech, H. Karas, E. Wingender, T. Werner, MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data, Nucleic Acids Res. 23 (1995) 4878^4884. [43] N. Blin, D.W. Sta¡ord, A general method for isolation of high molecular weight DNA from eukaryotes, Nucleic Acids Res. 3 (1976) 2303^2308. [44] E. Schreiber, P. Matthias, M.M. Muller, W. Scha¡ner, Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells, Nucleic Acids Res. 17 (1989) 6419. [45] H.D. Madhani, C. Guthrie, Dynamic RNA-RNA interactions in the spliceosome, Annu. Rev. Genet. 28 (1994) 1^26. [46] M.J. Moore, C.C. Query, P.A. Sharp, in: R.F. Gestland, J.F. Atkins (Eds.), The RNA World, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1993, pp. 303^357. [47] N. Cristina, C. Chatellard-Causse, M. Manier, C. Feuerstein, GDNF : existence of a second transcript in the brain, Brain Res. Mol. Brain Res. 32 (1995) 354^357. [48] J.E. Springer, J.L. Seeburger, J. He, A. Gabrea, E.P. Blankenhorn, L.W. Bergman, cDNA sequence and di¡erential mRNA regulation of two forms of glial cell line-derived neurotrophic factor in Schwann cells and rat skeletal muscle, Exp. Neurol. 131 (1995) 47^52. [49] D.G. Schaar, B.A. Sieber, A.C. Sherwood, D. Dean, G. Mendoza, L. Ramakrishnan, C.F. Dreyfus, I.B. Black, Multiple astrocyte transcripts encode nigral trophic factors in rat and human, Exp. Neurol. 130 (1994) 387^393. [50] C. Suter-Crazzolara, K. Unsicker, GDNF is expressed in two forms in many tissues outside the CNS, NeuroReport 5 (1994) 2486^2488. [51] D.W. Mittanck, S.W. Kim, P. Rotwein, Essential promoter elements are located within the 5P untranslated region of human insulin-like growth factor-I exon I, Mol. Cell. Endocrinol. 126 (1997) 153^163. [52] S. Huang, P.M. Thule, L.S. Phillips, Identi¢cation of novel promoter and repressor elements in the 5P-£anking regions of the rat insulinlike growth factor-I gene, Biochem. Biophys. Res. Commun. 206 (1995) 279^286. [53] L.A. Nolten, F.M. van Schaik, P.H. Steenbergh, J.S. Sussenbach, Expression of the insulin-like growth factor I gene is stimulated by the liver-enriched transcription factors C/EBP alpha and LAP, Mol. Endocrinol. 8 (1994) 1636^1645. [54] L.A. Nolten, P.H. Steenbergh, J.S. Sussenbach, Hepatocyte nuclear factor 1 alpha activates promoter 1 of the human insulin-like growth factor I gene via two distinct binding sites, Mol. Endocrinol. 9 (1995) 1488^1499. [55] K. Maehara, T. Hasegawa, H. Xiao, A. Takeuchi, R. Abe, K. Isobe, Cooperative interaction of NF-kappaB and C/EBP binding sites is necessary for manganese superoxide dismutase gene transcription mediated by lipopolysaccharide and interferon-gamma, FEBS Lett. 449 (1999) 115^119. [56] Y. Xu, K.K. Kiningham, M.N. Devalaraja, C.C. Yeh, H. Majima, E.J. Kasarskis, D.K. St. Clair, An intronic NF-kappaB element is essential for induction of the human manganese superoxide dismutase gene by tumor necrosis factor-alpha and interleukin-1beta, DNA Cell Biol. 18 (1999) 709^722. [57] P.L. Jones, D. Ping, J.M. Boss, Tumor necrosis factor alpha and interleukin-1beta regulate the murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP-beta and NF-kappaB, Mol. Cell. Biol. 17 (1997) 6970^6981.

BBAEXP 93456 30-10-00