Novel approach to produce biomass-derived oligosaccharides simultaneously by recombinant endoglucanase from Trichoderma reesei

Journal Pre-proof Novel approach to produce biomass-derived oligosaccharides simultaneously by recombinant endoglucanase from Trichoderma reesei Yuheng Tao (Conceptualization) (Methodology) (Software) (Formal analysis) (Writing - original draft) (Writing - review and editing), Lei Yang (Investigation), Limin Yin (Validation), Chenhuan Lai (Data curation), Caoxing Huang (Visualization), Xin Li (Resources), Qiang Yong (Supervision) (Project administration) (Funding acquisition)

PII:

S0141-0229(19)30219-4

DOI:

https://doi.org/10.1016/j.enzmictec.2019.109481

Reference:

EMT 109481

To appear in:

Enzyme and Microbial Technology

Received Date:

9 October 2019

Revised Date:

23 November 2019

Accepted Date:

26 November 2019

Please cite this article as: Tao Y, Yang L, Yin L, Lai C, Huang C, Li X, Yong Q, Novel approach to produce biomass-derived oligosaccharides simultaneously by recombinant endoglucanase from Trichoderma reesei, Enzyme and Microbial Technology (2019), doi: https://doi.org/10.1016/j.enzmictec.2019.109481

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Novel approach to produce biomass-derived oligosaccharides simultaneously by recombinant endoglucanase from Trichoderma reesei

Yuheng Taoa,b,c, Lei Yang, Limin Yin, Chenhuan Laia,b,c, Caoxing Huanga,b,c, Xin

a

ro of

Lia,b,c, Qiang Yonga,b,c*

Key Laboratory of Forestry Genetics & Biotechnology (Nanjing Forestry

-p

University), Ministry of Education, Nanjing 210037, People’s Republic of China b

re

Jiangsu Co-Innovation Center of Efficient Processing and Utilization of Forest

Resources, College of Chemical Engineering, Nanjing Forestry University, Nanjing

Jiangsu Province Key Laboratory of Green Biomass-based Fuels and Chemicals,

na

c

lP

210037, People’s Republic of Chin

ur

Nanjing 210037, People’s Republic of China

Jo

* Corresponding author:

Tel./fax: +86 25 85427471 Email address: [email protected]

HIGHLIGHTS 

Recombinant endoglucanase (ReEG I) was successfully produced by Pichia pastoris.

ReEG I has greater affinity for birchwood xylan than CMC.



ReEG I showed high XOS yield on birchwood xylan, up to 69.53 ± 1.4%.



ReEG I can produce XOS and COS concurrently on alkali-raised corncob

ro of



-p

residues.

re

Abstract

lP

The recombinant endoglucanase gene (EG I) from Trichoderma reesei was successfully expressed in Pichia pastoris for the purpose of producing

na

oligosaccharides from various biomass-derived substrates. Interestingly, the recombinant endoglucanase I (ReEG I) showed the catalytic activity towards both

ur

cellulose and xylan hydrolysis, yet it was more efficient with xylans. Among various

Jo

glucans and xylans substrates (paper pulp, carboxymethylated cellulose, oat spelt xylan, birchwood xylan), birchwood xylan displayed a higher yield of xylooligosaccharides (XOS) (69.5% after optimization). Eventually, it was observed that ReEG I could simultaneously produce XOS and COS, when the alkali-extracted corncob residues were used as substrate. This is the first report on simultaneous

production of XOS and COS by recombinant endoglucanase I from Trichoderma reesei expressed in Pichia pastoris, where a novel application of genetically engineered enzymes is proposed to provide an attractive application for high value utilization of biomass.

Keywords: endoglucanase Ⅰ; Trichoderma reesei; xylo-oligosaccharide; cello-

ro of

oligosaccharide; alkali-extracted corncob residues.

-p

Introduction

Oligosaccharide, a linear or branched oligomeric sugar, comprises of something

re

between two and ten monosaccharide constituents linked through varying glycosidic

lP

bonds. Oligosaccharides have multiple physiological functions, including promoting proliferation of beneficial gut bacteria, improving the composition of intestinal

na

microbiome and bolstering overall immune system performance and robustness[1,2]. In the context of physiological function, cello-oligosaccharides (COS) and xylo-

ur

oligosaccharides (XOS) have been reported frequently, because of their excellent

Jo

performance. Regarding COS, they not only regulate carbohydrate metabolism and lipid metabolism in humans and mice, but also improve intestinal barrier function and increase tight junction proteins [3,4]. Differently, XOS has been shown to promote the proliferation of beneficial bacteria [5], prevent aging, and improve human immunity [6]. In terms of industrial consumption，XOS and COS are additives in various

animal feeds and human foods [7,8]. At present, preparation methods for functional oligosaccharides typically include glycosyl transfer, physical degradation, acid hydrolysis, or enzymatic degradation [9– 12]. Acid hydrolysis is a common method to obtain oligosaccharides, however, the products obtained from this process were riddled with a variety of undesirable impurities such as assorted monosaccharides (xylose, arabinose, glucose) and furfural.

ro of

Presence of these impurities hampers XOS bioactivity and therefore demands further purification, which problematically elevates production costs [13]. As a more

-p

selective preparation method, the glycosyl transfer method requires high initial sugar concentration and has low conversion rate[11]. Other physical degradation methods,

re

such as microwave and ultrasound, are still in technological infancy and require

lP

significant advancement prior to industrial application[12]. Therefore, among these methods, enzymatic degradation is favored because of its mild reaction conditions,

na

high selectivity, and potential for being implemented for large-scale production. The class of enzymes most viable for performing this function at industrial scale are

ur

glycanases, such as endoglucanase, xylanase and mannanase, which have been

Jo

studied across many works over recent years [14,15]. Glycanases function as hydrolyzing enzymes, which hydrolyze polysaccharide substrates into oligosaccharides. However, during the process of enzyme production, glycanase and glycosidase often appear together, which can problematically further hydrolyze the generated oligosaccharides into monosaccharides [15].

To improve the yields of oligosaccharides using glycanase systems, it will be necessary to separate the glycosidase in glycanase preparation. A common method for achieving the purpose is to fractionate the natural enzymes by different isoelectric points or molecular weights, the methods applied for separating out glycosidase include membrane separation, ultrafiltration, or adsorption[16–18]. For example, Ding et al. synthesized an immobilized polymer system for affinity separation of

ro of

endoglucanase, resulting in near complete recovery of 99.8% [19]. Another way of

overcoming the glycosidase hurdle is facilitating/inducing heterologous expression of

-p

glycanase by microorganisms[20]. Sun et al. successfully expressed

Thermomonospora fusca xylanase A (TfxA) in Pichia pastoris. Using this novel

re

enzyme, the previously cited authors were able to generate a highly pure solution of

lP

XOS from both birchwood and wheat bran xylan that was mainly comprised of xylobioses and some longer-chain oligosaccharides [21]. Among the endoglucanases

na

of Trichoderma reesei, endoglucanase I (EG I) is of particular interest due to its nonspecificity[22]. Interestingly, Lawoko et al. found that the EG I isolated from T. reesei

ur

exhibited xylanase activity [23]. Inspired by this, using the EG I from T. reesei to

Jo

prepare XOS, or even a mixture of XOS and COS, might be an attractive thought. This may have a cost advantage for the high value-added conversion of biomass, since a mixture of two oligosaccharides can be obtained using only one enzyme. Nevertheless, there were no reports on the production of COS or XOS by heterologous expression of the T. reesei endoglucanase I.

Therefore, the objective of this study is to simultaneously produce XOS and COS by EG I. Recognizing the success of Sun’s study and methodology, we decided to take a similar approach involved P. pastoris. In this work, the egl1 gene of T. reesei was cloned and expressed in P. pastoris. Using this novel recombinant endoglucanase, trials were performed to investigate its viability as a means of producing XOS and

ro of

COS simultaneously.

Materials and methods Strains and reagents

-p

Trichoderma reesi Rut C-30 was preserved by Institute of Biochemical

re

Engineering, Nanjing Forestry University (Nanjing, Jiangsu, China). Pichia pastoris

lP

expression host GS115, X-33 and KM71H were purchased from Invitrogen (Carlsbad, California, USA). Primers were synthesized and provided by Beijing Genomics

na

Institute (Beijing, China). Expression vector pPICZαA was preserved by Nanjing Forestry University (Nanjing, Jiangsu, China). Escherichia coli DH5α was from Yale

ur

stock center (New haven, Connecticut, USA) and was published by Taylor et al[24].

Jo

Trizol reagent and Plasmid Miniprep Kit were purchased Generay Biotech (Shanghai, China). Easy PureTM HiPure Plasmid MaxiPrep Kit and EasyPure PCR Purification Kit were acquired from Transgen Biotech (Beijing, China). Yeast gDNA Miniprep Kit was obtained from BioMIGA (San Diego, California, USA). RNA extraction kit, restriction enzymes EcoR I, Not I, Pme I, and DNA molecular weight standards were procured from TaKaRa (Ostu, Japan). SDS-PAGE standards were received from

Fermentas (Ontario, CA). EasyPure Quick Gel Extraction Kit was purchased from Promega (Madison, Wisconsin, USA). YNB was from Biosharp (Hefei, Anhui, China). Bradford, bovine serum albumin, yeast extract, Peptone, Trytone, ZecoinTM, carboxymethylated cellulose, oat spelt xylan and birchwood xylan were all purchased from Sigma-Aldrich (St. Louis, Missouri, USA). Standard reagent of xylose, xylobiose, xylotriose, xylotetraose, xylopentaose, xylohexaose, glucose, cellobiose,

ro of

cellotriose, cellotetraose, cellopentaose and cellohexaose were purchased from Megazyme (Bray, Ireland).

-p

Construction of recombinant expression plasmid and expression of recombinant endoglucanase

re

After the RNA was isolated from T. reesei using RNA extraction kit, cDNA for

lP

PCR amplification was synthesized using Oligo dT primer and Superscript II reverse transcriptase. The primers used for cloning the egl1 gene were 5′-

na

GAATTCCATGGCGCCCTCAGTTACAC-3′ (forward primer) and 5′GCGGCCGCTCAACGCTCTAAAGGCAT -3′ (reverse primer). The underlined

ur

sequences from the previous primer descriptions represent the restriction sites EcoR I

Jo

and Not I, respectively. The PCR product was first ligated to the pPICZαA vector. The recombinant pPICZαA-egl1 plasmid was transformed into E. coli DH5α cells for replication and the transformants were screened with a LB-Zeocin plate (25 μg/mL). After amplified and purified, the recombinant plasmid was digested with Pme I endonuclease to obtain linearized DNA. Finally, the linearized DNA was integrated

into three kinds of P. pastoris electrocompetent cells (GS115, KM71H and X33) with an electroporator (Bio-Rad Gene Pulser XcellTM) as per the manufacturer’s introductions (operation voltage of 2000 V and operation time of 5 ms). The recombinants were selected on YPDS plates (1% yeast extract, 2% peptone, 0.5% methanol) containing Zeocin at 100, 250, 500, and 1000 μg/mL. The integration of egl1 into the genome of P. pastoris was confirmed by colony PCR. The clones

ro of

capable to grow in the presence of 500 μg/mL Zeocin were further point inoculated on MM-agar medium (containing 2% agarose, 1.34% yeast nitrogen base (YNB), 4 x 10% biotin and 0.5% methanol) supplemented with 0.5% carboxymethylated cellulose

-p

5

(CMC). The clear halo of the plate after Congo red staining indicates CMC-

re

hydrolyzing-activity of the clone. The potent clones observed on plates were tested

lP

for expression of recombinant endoglucanase in BMGY medium (containing 1% yeast extract, 2% peptone, 0.1 M potassium phosphate buffer pH 6.0, 1.34% yeast

na

nitrogen base (YNB), 4 × 10-5% biotin and 1% glycerol) for 16 h and then in BMMY medium (1% methanol instead of glycerol) for 96 h. The recombinant endoglucanase

ur

production by these clones was quantitated by endoglucanase assay.

Jo

Purification of recombinant endoglucanase The culture supernatant was filtered and loaded into a high-affinity Ni2+-charged

resin column (10 mm×100 mm, GenScript). Purification was performed with gradient elution using binding buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0, 8 bed volumes) and elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM

imidazole, pH 8.0, 10 bed volumes). Both the crude and purified enzymes were analyzed by SDS-PAGE, and their enzyme activities were determined. Protein concentrations were determined by the Bradford assay using bovine serum albumin as a standard. Preparation of oligosaccharides using recombinant endoglucanase Five substrates (carboxymethyl cellulose (CMC), paper pulp, oat spelt xylan,

ro of

birchwood xylan and alkali-extracted corncob residues) were treated with

recombinant endoglucanase at pH 5.0 (Na2HPO4–citric acid buffer) and 50 oC for 72

-p

h, each of which were sampled at 12-h intervals. After 72 h, the enzymes were

inactivated by immersing the suspension in near-boiling water (~95 °C) for 5 min.

re

Next, the suspension was centrifuged at 10,000 rpm for 10 min, and the supernatant

lP

was collected to analyze sugars concentration by HPAEC-PAD. In order to obtain higher XOS yields from the birchwood xylan substrate, the

na

enzymatic hydrolysis conditions of pH, temperature, substrate concentration and enzyme dosage were optimized. The ranges of pH, temperature, birchwood xylan

ur

concentration and enzyme concentration tested were 3-8, 30-70 oC, 2-20 g/L and 5-40

Jo

U/g birchwood xylan, respectively. Finally, a time-course of XOS production was performed.

Enzyme assays Endoglucanase activity (CMCase activity) was quantitatively measured using a colorimetric method, involving the 3,5-dinitrosalicylic acid (DNS) assay with CMC as

substrate [25]. Specifically, the reaction mixture containing 0.5 mL of enzyme solution and 1 mL of 2% CMC prepared in 50 mM citrate buffer was incubated at 50 °C for 30 min. The reaction was terminated by the addition of 3 mL DNS, followed by 5 min of boiling the reaction tube. After cooling under running water, the solution was diluted to 25 mL using double-distilled water. Absorption of the solution was measured at 550 nm using a UV spectrophotometer, and the concentration of

ro of

reducing sugars was estimated using a glucose standard curve as reference. One unit

(U) of enzyme activity toward CMC was defined as the amount of enzymes required

-p

to release 1 μmol of reducing sugars per min.

Enzyme kinetics of recombinant endoglucanase hydrolysis

re

Enzyme kinetics of recombinant endoglucanase hydrolysis were assayed at 50 oC

lP

for 30 min. CMC (2-20 mg mL-1) and birchwood xylan (5–40 mg mL-1) were prepared and Na2HPO4–citric acid buffer and recombinant endoglucanase were added.

na

Km and Vmax were determined through Lineweaver–Burk plot. To determine the catalytic turnover number (kcat), Vmax was divided by the molar enzyme concentration

ur

used in the reaction.

Jo

Analysis of oligosaccharides in enzymatic hydrolysate After enzymatic hydrolysis, the hydrolysate was centrifuged (10,000 rpm, 5 min)

prior to filtration using a 0.22 μm nylon Acrodisc syringe filter and injected to a Dionex ICS-3000 system. The system was equipped with an analysis anion-exchange column of CarboPac PA200 (3 mm×250 mm) in combination with a guard column of

CarboPac PA200 (3 mm×50 mm) at 30 ℃. Two eluents were prepared as the mobile phase in plastic bottles pressurized with inert nitrogen gas between ~6-9 psi of pressure. The eluent consisted of 0.1 M NaOH and 0.5 M NaOAc containing 0.1 M NaOH solution (NaOAc-NaOH). For respective analysis of XOS or COS, the flow rate was held at 0.3 mL/min and the elution profile was: 0-25 min, 100-80 mM NaOH (linear gradient) and 0-100 mM NaOAc-NaOH (linear gradient); 25-35 min, 100 mM

ro of

NaOH. For the determination of the XOS and COS mixture, the elution profile

involving mobile phase flowing at 0.3 mL/min using the program: 0-9 min, 100 mM

-p

NaOH; 9-26 min, 100-92 mM NaOH (linear gradient) and 0-40 mM NaOAc-NaOH

(linear gradient); 26-40 min, 50 mM NaOH and 250 mM NaOAc-NaOH; 40-50 min,

re

50 mM NaOH [26]. External calibration standards were used in. Calibration was

lP

performed with a series of standard sugar solutions of xylose to xylohexaose and glucose to cellohexaose. All data was collected and processed using computers

na

equipped with Dionex Chromeleon 6.7 software. The formula for calculating the yield of each component is as follows:

ur

𝑇ℎ𝑒 𝑦𝑖𝑒𝑙𝑑 𝑜𝑓 𝑒𝑎𝑐ℎ 𝑐𝑜𝑚𝑝𝑜𝑛𝑒𝑛𝑡 (𝑥𝑦𝑙𝑜𝑠𝑒 𝑡𝑜 𝑥𝑦𝑙𝑜ℎ𝑒𝑥𝑎𝑜𝑠𝑒) (%)

Jo

=

𝑇ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 (𝑥𝑦𝑙𝑜𝑠𝑒 𝑡𝑜 𝑥𝑦𝑙𝑜ℎ𝑒𝑥𝑎𝑜𝑠𝑒) (𝑔/𝐿) × 100% 𝑇ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 𝑥𝑦𝑙𝑎𝑛 𝑖𝑛 𝑠𝑢𝑏𝑠𝑡𝑟𝑎𝑡𝑒 (𝑔/𝐿)

𝑇ℎ𝑒 𝑦𝑖𝑒𝑙𝑑 𝑜𝑓 𝑒𝑎𝑐ℎ 𝑐𝑜𝑚𝑝𝑜𝑛𝑒𝑛𝑡 (𝑔𝑙𝑢𝑐𝑜𝑠𝑒 𝑡𝑜 𝑐𝑒𝑙𝑙𝑜ℎ𝑒𝑥𝑎𝑜𝑠𝑒) (%) =

𝑇ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 (𝑔𝑙𝑢𝑐𝑜𝑠𝑒 𝑡𝑜 𝑐𝑒𝑙𝑙𝑜ℎ𝑒𝑥𝑎𝑜𝑠𝑒) (𝑔/𝐿) × 100% 𝑇ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 𝑐𝑒𝑙𝑙𝑢𝑙𝑜𝑠𝑒 𝑖𝑛 𝑠𝑢𝑏𝑠𝑡𝑟𝑎𝑡𝑒 (𝑔/𝐿)

The yield of XOS is the sum of the yields of xylobiose to xylohexaose, and the calculation of COS yield is the same. Finally, calculation of enzyme selectivity for

production of XOS and COS was as follows. 𝑇ℎ𝑒 𝑒𝑛𝑧𝑦𝑚𝑒 𝑠𝑒𝑙𝑒𝑐𝑡𝑖𝑣𝑖𝑡𝑦 𝑜𝑓 𝑋𝑂𝑆 (%) =

𝑇ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 𝑋𝑂𝑆 (𝑔/𝐿) × 100% 𝑇ℎ𝑒 𝑠𝑢𝑚 𝑜𝑓 𝑡ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 𝑋𝑂𝑆 𝑎𝑛𝑑 𝑥𝑦𝑙𝑜𝑠𝑒 (𝑔/𝐿)

𝑇ℎ𝑒 𝑒𝑛𝑧𝑦𝑚𝑒 𝑠𝑒𝑙𝑒𝑐𝑡𝑖𝑣𝑖𝑡𝑦 𝑜𝑓 𝐶𝑂𝑆 (%) =

𝑇ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 𝐶𝑂𝑆 (𝑔/𝐿) × 100% 𝑇ℎ𝑒 𝑠𝑢𝑚 𝑜𝑓 𝑡ℎ𝑒 𝑐𝑜𝑛𝑡𝑒𝑛𝑡 𝑜𝑓 𝐶𝑂𝑆 𝑎𝑛𝑑 𝑔𝑙𝑢𝑐𝑜𝑠𝑒 (𝑔/𝐿)

ro of

Results Expression and characterization of recombinant endoglucanase in Pichia pastoris In this work, the gene egl1 amplified from Trichoderma reesei’s genome and

-p

expressed in P. pastoris using pPICZαA. Preliminarily validation that recombinant

re

yeast was cultured in MM-CMC-agar plates and stained with Congo red indicated the

lP

endoglucanase activity of recombinant yeast. Eventually, the selected recombinant strain was placed on BMMY medium to obtain recombinant endoglucanase I (ReEG

na

I). Compared with the other two recombinant strains, P. pastoris GS115 and KM71H, X33 exhibited the best crude enzyme activity of 1.0 U/mL after 120 h induction.

ur

Afterward enzymatic secretion, the recombinant protein was purified by Ni2+ affinity

Jo

chromatography and detected by SDS-PAGE. Then the specific activity was measured. The specific activity of purified ReEG I was 34.3 U/mg, ~8-fold higher than the value of 6.8 U/mg recorded for the crude enzyme. Furthermore, the purified ReEG I gave a band similar to the expected molecular mass (~45 kDa) on SDSPAGE. Kinetic constants of ReEG I towards xylan and cellulose substrates

To verify whether the recombinant endoglucanase can degrade both xylan and cellulose as reported in previous studies, the apparent kinetic constants of the recombinant endoglucanase were determined on two typical xylan and glucan sources (birchwood xylan and carboxymethylated cellulose (CMC)). The kcat /Km of the ReEG I towards CMC and birchwood xylan was 2.0 mL min-1mg-1 and 4.9 mL min-1mg-1, respectively (Table 1). Comparing the magnitudes of both kcat /Km ratios indicated that

ro of

birchwood xylan is obviously a more favorable substrate for ReEG I than CMC.

To further examine the performance of ReEG I on oligosaccharide production,

-p

two xylans (birchwood xylan and oat spelt xylan) and two glucans (CMC and paper pulp) were used as substrates respectively. As shown in Fig. 1, the four substrates

re

were capable of being degraded by ReEG I to produce corresponding

lP

oligosaccharides. However, a large difference in the yield was found when comparing cello-oligosaccharide (COS) and xylo-oligosaccharide (XOS) production. Among the

na

four substrates, birchwood xylan was the most digestible substrate for ReEG I, rendering an XOS and xylose yield of 52.3% and 2.0%, respectively. And the COS

ur

and glucose yield of CMC were 12.6% and 0.6%, respectively. Similar results were

Jo

found with paper pulp as substrate, which resulted in oligosaccharide and monosaccharide yield of 8.2% and 2.9%, respectively. In addition, the XOS yield of birchwood xylan was higher than that of oat spelt xylan. In enzymatic hydrolysis, the enzymatic selectivity of oligosaccharides is generally defined as the proportion of oligosaccharides in the degradation products of

a polysaccharide, which reflects whether the enzyme has an advantage for obtaining oligosaccharides. In the enzymatic hydrolysis process of the four substrates, the enzyme selectivity is high, except that the enzyme selectivity of paper pulp (74.1%), and the others are higher than 85.0%. However, when using CMC as a substrate, although the enzyme selectivity of COS was high (95.4%), the final COS yield was low. In general, it can be predicted that the ReEG I have an advantage in the

ro of

preparation of oligosaccharide products containing low monosaccharides. More

importantly, this demonstrated that ReEG I has a greater tendency towards degrading

-p

xylan to obtain XOS, an enzymatic activity that appears to be robust regardless of xylan source.

re

Optimization of conditions for the production of XOS from birchwood xylan by

lP

ReEG I

In order to obtain higher oligosaccharide yield, the optimal enzymatic conditions

na

for COS and XOS should be investigated separately previously to the simultaneous production of COS and XOS. The conditions for the production of COS from T. reesei

ur

EG I (TrEG I) has been reported[27,28], yet there is no report on the optimal

Jo

conditions for the XOS production by TrEG I. Therefore, to achieve a high XOS yield, enzymatic hydrolysis conditions around birchwood xylan using ReEG I were optimized. First, the influence of pH on enzymatic hydrolysis was evaluated over the range of pH 3 to 8. After hydrolysis for 72 h (Fig. 2A), the highest XOS yield achieved was 40.0% at pH 5.0. To optimize hydrolysis temperature, the reaction was

carried out at different temperatures and the optimum pH of 5.0. As shown in Fig 2B, the highest yield of XOS was 40.8% obtained at 50°C. Besides the effect of pH and temperature, it was observed that XOS yield decreases (at pH 5.0 and 50°C) as substrate concentration increases (Fig. 2C). Specifically, XOS yield decreased from 52.7% to 32.5% when substrate concentration increased from 2 g/L to 20 g/L. As seen from Fig 2D, when enzyme dosage was elevated from 5 U/g to 20 U/g, XOS yield

ro of

sharply increased from 46.9% to 65.4%. However, when the enzyme dosage increased to 40 U/g, the yield of XOS did not increase proportionally, resulting in the paltry

-p

yield of 67.3%. Moreover, in the optimization of the four factors (pH 5, 50 oC, 2 g/L

birchwood xylan, enzyme dosage: 40 U/g substrate), it was observed that the yield of

lP

I has high selectivity for XOS.

re

xylose is always kept at a low level, both below 2.0%, which further veried that ReEG

A time course of XOS production from birchwood xylan by ReEG I was

na

performed under the discovered optimal conditions. As shown in Fig. 3, the initial rate of XOS formation was quick within the first 24 hours, followed by a decrease to the

ur

turnover rate. After 36 hours, the yield of XOS stabilized linearly, reaching 69.5% at

Jo

72 hours. Xylose formation was low with a maximum of 2.2%, and the enzyme selectivity was at about 95% during the hydrolysis process. Further analysis of the hydrolysate at 36 h found that xylotetraose was the major product from birchwood xylan by ReEG I (Table 2), followed by xylotriose and xylobiose. After 36 h, the concentration of xylopentaose and xylohexaose decreased (Table 2), leading to the

increased yield of xylobiose, xylotriose, xylotetraose. Finally, it should be noted that the optimal pH and temperature for XOS production are consistent with the COS production conditions (pH 5.0, 50 oC) reported in the literature[27,28], which provides an important guarantee for the simultaneous production of XOS and COS by ReEG I. Preparation of oligosaccharides from alkali-extracted corncob residues by ReEG

ro of

I

To further confirm the possibility of producing XOS and COS simultaneously by

-p

ReEG I, enzymatic hydrolysis of alkali-extracted corncob was performed. The time

course of the selective hydrolysis of alkali-extracted corncob residues by ReEG I was

re

showed in Fig. 4. As seen from Fig. 4, the yield of XOS increased rapidly to 35.3%

lP

within the first 36 h of digestion. After 36 h, the yield slowly increased up to 37.2%. The yield of COS was found to be much lower than that of XOS, and the 72 h yield

na

were only 2.7%. Fortunately, the yield of xylose and glucose were both at a low level, with 72 h yield of 1.4 % and 0.08 %, respectively. With increasing reaction time, the

ur

enzymatic selectivity of XOS decreased to 70.3% and the enzymatic selectivity of

Jo

COS increased to 22.9% at 72h. Consistent with the previous results, the yield of XOS was much higher than that of COS, due to the higher kcat /Km of the ReEG I towards xylan (Table 1). Meanwhile, the oligosaccharides in the products were mainly xylobiose and xylotriose and xylotetraose. The results indicated that the cellulose and xylan in alkali-extracted corncob residues could be converted to COS and XOS

simultaneously. Discussion With the increasing understanding on functional oligosaccharides, functional differences between oligosaccharides have been confirmed. For example, COS had a significant effect on the proliferation of Lactobacillus[8], while the effect of XOS on the proliferation of Bifidobacteria was obvious[29]. Based on these facts, as the

ro of

physiological functions of various oligosaccharides are gradually reported, a new focus is whether the mixture of various oligosaccharides can show unique

-p

characteristics of various oligosaccharides, thereby having a better role in promoting physiological health. This has been reported in a few articles[30,31]. Kurdi et al

re

prepared rice bran oligosaccharide mixture consisted of FOS and manno-

lP

oligosaccharides by acid hydrolysis[30]. From the two tested Bacteriodes strains grew better on rice bran oligosaccharide mixture than on inulin. Furthermore, the mixture

na

was abler to withstand exposure to simulated human gastric juice (pH 1-5) compared to inulin. Inspired by this, since the TrEG I has bond specificity[22], TrEG I was

ur

successfully expressed in P. pastoris for the sake of producing XOS and COS

Jo

simultaneously.

Through the apparent kinetic constants calculated, the higher kcat /Km value of

recombinant endoglucanase towards birchwood xylan indicated the greater enzyme specificity with the birchwood xylan. This was consistent with the conclusion of Lawoko, who claimed that TrEG I showed a ~2-fold higher activity on xylan than that

of CMC [23]. It has been previously reported that activity towards xylan was a common feature shared by endoglucanases (EGs) of GH7 family, and TrEG I belongs to the GH7 family. This can be ascribed to the structural homology between the GH7 EGs and xylanases. GH7 EGs and xylanases might originate from a diverged ancestral gene, and its remnants could be responsible for enabling EG I’s hydrolysis activity towards xylan [32]. These results are obviously positive with respect to the

ro of

goal of the present work, which seeks to produce XOS and COS simultaneously from lignocellulosic biomass. Regarding production of COS, the results from this enzyme

-p

towards CMC are not fully discouraging given the obvious substrate differences between a derivatized cellulose (CMC) and highly crystalline native cellulose.

re

Subsequently, the oligosaccharides yield through the enzymatic hydrolysis of

lP

four substrates were similar to the previous results. The results confirmed that the ReEG I has a greater tendency to degrade xylan to obtain XOS, regardless of the

na

source of xylan. Encouragingly, the enzymatic selectivity of oligosaccharide in the enzymatic hydrolysis results of the four substrates was all very high. One possible

ur

explanation for this observation might be attributable to substrate inhibition. It has

Jo

been reported that cellobiose can inhibit the binding of cellulases by forming enzyme– saccharides complexes [33] which negatively affect hydrolysis yield. At the same time, the crystallinity of CMC and paper pulp is a huge variable that cannot be ignored. High degree of crystallinity of substrates does not usually favor their enzymatic digestibility [34]. However, ReEG I might split loose ends, thus the low

activity of ReEG I for CMC and paper pulp is probably mainly due to substrate limitation. Additionally, the birchwood xylan was a better substrate than oat spelt xylan for ReEG I. Kui et al. reported a similar conclusion with a different enzyme (xylanase), showing that birchwood xylan exhibit a lower Km value than that of oat spelt xylan for the enzyme [35]. These differences are most likely related to differences between molecular composition and the distribution of branching. Oat

ro of

spelt xylan is composed of arabinoxylan with trace glucose substituents, while

birchwood xylan is mainly an unsubstituted xylan polymer with traces of uronic acid

-p

side groups[36].

Previously to the simultaneous production of COS and XOS, we explored the

re

optimal enzymatic conditions for XOS. After the optimization of conditions for the

lP

production of XOS from birchwood xylan by ReEG I, the highest XOS yield was 69.5% and the enzyme selectivity was at about 95% during the hydrolysis process.

na

Furthermore, in the hydrolysate of 36 h, xylotetraose, xylotriose and xylobiose were the major product from birchwood xylan by ReEG I (Table 2). A similar result

ur

appeared in the article of Liu et al., the total content of xylobiose, xylotriose and

Jo

xylotetraose was high up to 90% of the product [37]. Moreover, compared with the reports in the literature, the performance of ReEG I reached the level of XOS production by xylanase on birchwood xylan[38]. This suggests that ReEGI can be a better alternative to xylanase in XOS production. More importantly, the optimal pH and temperature for XOS production are the same as COS production conditions in

the cited literature[28]. This can be a foundation for the simultaneous production of XOS and COS by ReEG I on alkali-extracted corncob residue. Alkali-extracted corn cob residue, containing 60-70% cellulose and 15-20% xylan, is the residue of the corn cob after extraction of xylan during XOS preparation. The alkaline extraction process is thought to have a positive effect on cellulose’s digestibility [39]. Due to lack of effective utilization, the alkali-extracted corncob

ro of

residues are abandoned in the open field, leading to serious environmental pollution.

Utilization of these materials not only addresses the proper disposal of waste, but also

-p

provides an attractive opportunity for the sustainable development of agricultural

resources. Similar to the previous results, this enzymatic hydrolysis results once again

re

confirmed that ReEG I may have bond specificity and is more active on xylan than

lP

cellulose. Different from the previous explanation, in this enzymatic hydrolysis system, xylan and cellulose are in a competitive adsorption for ReEG I, resulting in

na

ReEG I’s affinity for xylan effectively halting any significant hydrolysis of cellulose. In addition, The XOS and COS in hydrolysate are competitive inhibitors of

ur

endoglucanases [33,40] .

Jo

To be honest, the best method for preparing a mixture of oligosaccharides is a one-step process, which can be achieved by acid hydrolysis or enzymatic hydrolysis. However, the major problem of the acid hydrolysis method is the presence of many by-products, and the main difficulty of the enzymatic hydrolysis method is the enzyme having bond specificity. The bond specificity of TrEG I has been reported, but

this property has not been exploited. Here, we obtained the recombinant enzyme ReEG I by genetic engineering and applied it to an industrial process residue to obtain a mixture of XOS and COS. However, in the obtained oligosaccharide mixture, the COS content is too low and further research is demanded. This method enables high value-added application of industrial process residues, and the physiological functions of this oligosaccharide mixture deserves further study.

ro of

In summary, the T. reesei endoglucanase I expressed by P. pastoris was found to have a particular proclivity to xylan rather than cellulose, which can release

-p

oligosaccharides from various substrates. Consequently, the XOS yield with

birchwood xylan as substrate was ~4 times higher than the COS yield with CMC as

re

substrate, and there was no substantial monosaccharide production. Finally, ReEG I

lP

was tested to convert the cellulose and xylan of alkali-extracted corncob residues to

of COS.

na

COS and XOS simultaneously, however, the yield of XOS was much higher than that

ur

Author agreement

Jo

No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. I would like to declare on behalf of my coauthors that the work described was original research that has not been published previously, and not under consideration for publication elsewhere, in whole or in part.

Author Contribution Statement

Yuheng Tao: Conceptualization, Methodology, Software, Formal analysis, WritingOriginal Draft, Writing-Review&Editing Lei Yang: Investigation Limin Yin: Validation Chenhuan Lai: Data curation

ro of

Caoxing Huang: Visualization Xin Li: Resources

re

-p

Qiang Yong: Supervision, Project administration; Funding acquisition

Acknowledgements

lP

The study was supported by the Key Research and Development Program of Jiangsu Province (BF2015007). The authors thank the Priority Academic Program

na

Development of Jiangsu Higher Education Institution (PAPD) for supporting the

Jo

ur

work.

REFERENCES [1]

Y. Guigoz, F. Rochat, G. Perruisseau-Carrier, I. Rochat, E.J. Schiffrin, Effects of oligosaccharide on the faecal flora and non-specific immune system in elderly people, Nutr. Res. 22 (2002) 13–25.

[2]

K. Manderson, M. Pinart, K.M. Tuohy, W.E. Grace, A.T. Hotchkiss, W. Widmer, M.P. Yadhav, G.R. Gibson, R.A. Rastall, In vitro determination of

ro of

prebiotic properties of oligosaccharides derived from an orange juice

manufacturing by-product stream, Appl. Environ. Microbiol. 71 (2005) 8383-

[3]

-p

8389.

L.F. Jiao, Y.L. Ke, K. Xiao, Z.H. Song, C.H. Hu, B. Shi, Effects of cello-

re

oligosaccharide on intestinal microbiota and epithelial barrier function of

[4]

lP

weanling pigs, J. Anim. Sci. 93 (2015) 1157–1164. T. Watanabe, K. Ohokuma, M. Satouchi, T. Koshijima, M. Kuwahara, S.

na

Wakabayashi, Digestibility, absorptivity and physiological effects of cellooligosaccharides in human and rat, Nippon Eiyo Shokuryo Gakkaishi. 49

J.L. Ravn, J.C. Thøgersen, J. Eklöf, D. Pettersson, R. Ducatelle, F. van

Jo

[5]

ur

(2011) 143–148.

Immerseel, N.R. Pedersen, GH11 xylanase increases prebiotic oligosaccharides from wheat bran favouring butyrate-producing bacteria in vitro, Anim. Feed Sci. Technol. 226 (2017) 113–123.

[6]

C.H.F. Hansen, H. Frøkiær, A.G. Christensen, A. Bergström, T.R. Licht, A.K.

Hansen, S.B. Metzdorff, Dietary xylooligosaccharide downregulates IFN-γ and the low-grade inflammatory cytokine IL-1β systemically in mice, J. Nutr. 143 (2013) 533–40. [7]

X.M. Ding, D.D. Li, S.P. Bai, J.P. Wang, Q.F. Zeng, Z.W. Su, Y. Xuan, K.Y. Zhang, Effect of dietary xylooligosaccharides on intestinal characteristics, gut

laying hens, Poult. Sci. 97 (2018) 874–881. [8]

ro of

microbiota, cecal short-chain fatty acids, and plasma immune parameters of

J. Song L.F. Jiao K. Xiao Z.S. Luan C.H. Hu B. Shi X.A. Zhan, Cello-

-p

oligosaccharide ameliorates heat stress-induced impairment of intestinal

Technol. 185 (2013) 175–181.

L. Guo, X. Chen, L. Xu, M. Xiao, L. Lu, Enzymatic synthesis of 6’-

lP

[9]

re

microflora, morphology and barrier integrity in broilers, Anim. Feed Sci.

sialyllactose, a dominant sialylated human milk oligosaccharide, by a novel

na

exo-α-sialidase from Bacteroides fragilis NCTC9343, Appl. Environ. Microbiol. 84 (2018).

ur

[10] G. Placier, H. Watzlawick, C. Rabiller, R. Mattes, Evolved β-galactosidases

Jo

from Geobacillus stearothermophilus with improved transgalactosylation yield for galacto-oligosaccharide production, Appl. Environ. Microbiol. 75 (2009) 6312-6321.

[11] Á. Lafraya, J. Sanz-Aparicio, J. Polaina, J. Marín-Navarro, Fructooligosaccharide synthesis by mutant versions of Saccharomyces cerevisiae

invertase, Appl. Environ. Microbiol. 77 (2011) 6148-6157. [12] R.H. Chen, J.R. Chang, J.S. Shyur, Effects of ultrasonic conditions and storage in acidic solutions on changes in molecular weight and polydispersity of treated chitosan, Carbohydr. Res. 299 (1997) 287–294. [13] S. Zhu, Y. Wu, Z. Yu, X. Zhang, H. Li, M. Gao, The effect of microwave irradiation on enzymatic hydrolysis of rice straw, Bioresour. Technol. 97

ro of

(2006) 1964–1968.

[14] Z. Ai, Z. Jiang, L. Li, W. Deng, I. Kusakabe, H. Li, Immobilization of

-p

Streptomyces olivaceoviridis E-86 xylanase on Eudragit S-100 for xylooligosaccharide production, Process Biochem. 40 (2005) 2707–2714.

re

[15] Y. Kuba, Y. Kashiwagi, G. Okada, T. Sasaki, Production of cello-

lP

oligosaccharides by enzymatic hydrolysis in the presence of activated carbon, Enzyme Microb. Technol. 12 (1990) 72–75.

na

[16] A.B. Hemavathi, K.S.M.S. Raghavarao, Membrane processing for purification and concentration of β-glycosidases from barley (Hordeum vulgare),

ur

Biotechnol. Bioprocess Eng. 16 (2011) 282–290.

Jo

[17] M.E. Himmel, J.O. Baker, R.P. Overend, A review of:“ enzymatic conversion of biomass for fuels production ” , Fuel Sci. Technol. Int. 14 (2007) 339–339.

[18] S. Yamamoto, M. Okada, T. Usui, K. Sakata, Isolation and characterization of a β-Primeverosidase-like endo-manner β-Glycosidase from Aspergillus fumigatus AP-20 , Biosci. Biotechnol. Biochem. 66 (2003) 801–807.

[19] Z. Ding, X. Cao, Affinity precipitation of cellulase using pH-response polymer with Cibacron Blue F3GA, Sep. Purif. Technol. 102 (2013) 136–141. [20] S. Zhou, F.C. Davis, L.O. Ingram, Gene integration and expression and extracellular secretion of Erwinia chrysanthemi endoglucanase CelY (celY) and CelZ (celZ) in ethanologenic Klebsiella oxytoca P2, Appl. Environ. Microbiol. 67 (2001) 6-14.

ro of

[21] J.Y. Sun, M.Q. Liu, X.Y. Weng, L.C. Qian, S.H. Gu, Expression of

recombinant Thermomonospora fusca xylanase A in Pichia pastoris and

-p

xylooligosaccharides released from xylans by it, Food Chem. 104 (2007) 1055– 1064.

re

[22] M. Bailey, M. Siika‐ aho, A. Valkeajarvi, M. Penttila, Hydrolytic properties of

lP

two cellulases of Trichoderma reesei expressed in yeast, Biotechnol. Appl. Biochem. 17 (1993) 65-76.

na

[23] M. Lawoko, A. Nutt, H. Henriksson, G. Gellerstedt, G. Henriksson, Hemicellulase activity of aerobic fungal cellulases, Holzforschung. 54 (2000)

ur

497–500.

Jo

[24] R.G. Taylor, D.C. Walker, R.R. Mclnnes, E.coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing, Nucleic Acids Res. 21 (1993) 1677-1678.

[25] G.L. Miller, Use of dinitrosalicylic acid reagent for determination of reducing sugar, Anal. Chem. 31 (1959) 426–428.

[26] Y. Xu, L. Fan, X. Wang, Q. Yong, S. Yu, Cello-oligosaccharides mixtures in lignocellulosics processing products on high-performance anion-exchange chromatography coupled with pulsed amperometric, BioResources. 8 (2013) 3247–3259. [27]

G.B. Akcapinar, A. Venturini, P.L. Martelli, R. Casadio, U.O. Sezerman, Modulating the thermostability of endoglucanase I from Trichoderma reesei

ro of

using computational approaches, Protein Eng. Des. Sel. 28 (2015) 127–135. [28] G.B. Akcapinar, O. Gul, U. Sezerman, Effect of codon optimization on the

Biotechnol. Prog. 27 (2011) 1257–1263.

K.M. Tuohy, G.C.M. Rouzaud, W.M. Brück, G.R. Gibson, Modulation of the

re

[29]

-p

expression of Trichoderma reesei endoglucanase 1 in Pichia pastoris,

lP

Human Gut Microflora Towards Improved Health Using Prebiotics – Assessment of Efficacy, Curr. Pharm. Des. 44 (2005) 75–90.

na

[30] P. Kurdi, C. Hansawasdi, Assessment of the prebiotic potential of oligosaccharide mixtures from rice bran and cassava pulp, LWT - Food Sci.

ur

Technol. 63 (2015) 1288–1293.

Jo

[31] A.P. Vos, B.C. van Esch, B. Stahl, L. M’Rabet, G. Folkerts, F.P. Nijkamp, J. Garssen, Dietary supplementation with specific oligosaccharide mixtures decreases parameters of allergic asthma in mice, Int. Immunopharmacol. 7 (2007) 1582–1587. [32] E. Vlasenko, M. Schülein, J. Cherry, F. Xu, Substrate specificity of family 5, 6,

7, 9, 12, and 45 endoglucanases, Bioresour. Technol. 101 (2010) 2405–2411. [33] R. Kumar, C.E. Wyman, An improved method to directly estimate cellulase adsorption on biomass solids, Enzyme Microb. Technol. 42 (2008) 426–433. [34] L.T. Fan, Y. ‐ H Lee, D.H. Beardmore, Mechanism of the enzymatic hydrolysis of cellulose: Effects of major structural features of cellulose on enzymatic hydrolysis, Biotechnol. Bioeng. 22 (1980) 177–199.

ro of

[35] H. Kui, H. Luo, P. Shi, Y. Bai, T. Yuan, Y. Wang, P. Yang, S. Dong, B. Yao,

Gene cloning, expression, and characterization of a thermostable xylanase from

-p

Nesterenkonia xinjiangensis CCTCC AA001025, Appl. Biochem. Biotechnol. 162 (2010) 953–965.

re

[36] K. Liab, P. Azadi, R. Collins, J. Tolan, J.S. Kim, K.E.L. Eriksson,

lP

Relationships between activities of xylanases and xylan structures, Enzyme Microb. Technol. 27 (2000) 89–94.

na

[37] X. Liu, Y. Liu, Z. Jiang, H. Liu, S. Yang, Q. Yan, Biochemical characterization of a novel xylanase from Paenibacillus barengoltzii and its application in

ur

xylooligosaccharides production from corncobs, Food Chem. 264 (2018) 310–

Jo

318.

[38] X.J. Dai, M.Q. Liu, H.X. Jin, M.Y. Jing, Optimisation of solid-state fermentation of Aspergillus niger JL-15 for xylanase production and xylooligosaccharides preparation, Czech J. Food Sci. 29 (2011) 557–567. [39] Q. Chu, X. Li, Y. Xu, Z. Wang, J. Huang, S. Yu, Q. Yong, Functional cello-

oligosaccharides production from the corncob residues of xylooligosaccharides manufacture, Process Biochem. 49 (2014) 1217–1222. [40] J. Zhang, L. Viikari, Xylo-oligosaccharides are competitive inhibitors of cellobiohydrolase I from Thermoascus aurantiacus, Bioresour. Technol. 117

Jo

ur

na

lP

re

-p

ro of

(2012) 286–291.

Figure captions

Fig. 1 The yield of oligosaccharide and monosaccharide and enzyme selectivity of oligosaccharide from four substrates (carboxymethyl cellulose (CMC), paper pulp, oat spelt xylan, birchwood xylan) using recombinant endoglucanase I (Assay condition: 10 g/L substrate, enzyme dosage: 20 U/g substrate, pH 5, 50 oC, 72 h).

ro of

Fig. 2 Optimization of enzymatic hydrolysis conditions of birchwood xylan hydrolyzed by recombinant endoglucanase I ((A) pH; (B) Temperature; (C)

-p

Birchwood xylan concentration; (D) Enzyme dosage).

Fig. 3 Time course of hydrolysis of birchwood xylan by recombinant endoglucanase I

lP

enzyme dosage: 40 U/g substrate).

re

under optimal conditions optimized previously (pH 5, 50 oC, 2 g/L birchwood xylan,

Fig. 4 Time course of the alkali-extracted corncob residues hydrolysis by recombinant

na

endoglucanase I under optimal conditions optimized previously (pH 5, 50 oC, 2 g/L

Jo

ur

alkali-extracted corncob residue, enzyme dosage: 40 U/g substrate)

Monosaccharide Oligosaccharide Enzyme selectivity of oligosaccharide

80

ro of

60

40

20

-p

Yield and enzyme selectivity (%)

100

0 CMC

Oat spelt xylan Birchwood xylan

lP

re

Paper pulp

Jo

ur

na

Fig. 1

B

100

Enzyme selectivity of XOS

80 60 40 20 0

3

4

5

pH

6

7

8

100 80 60 40 20 0

0

4

8

12

16

20

80 60 40 20 0

30

40

50

60

100 80 60 40 20 0

0

5

10

15

20

25

30

lP na ur

35

Enzyme dosage (U/g)

re

Fig. 2

Jo

70

Temperature (oC)

-p

Birchwood xylan concentration (g/L)

100

D Yield and enzyme selectivity (%)

C Yield and enzyme selectivity (%)

Xylose

ro of

XOS

Yield and enzyme selectivity (%)

Yield and enzyme selectivity (%)

A

40

45

Xylose

Enzyme selectivity of XOS

80

60

40

20

0 12

24

36

48

60

re

-p

Reaction time (h)

ro of

Yield and enzyme selectivity (%)

XOS 100

Jo

ur

na

lP

Fig. 3

72

Xylose Glucose

Enzyme selectivity of XOS Enzyme selectivity of COS

80

60

40

20

0 12

24

36

48

60

re

-p

Reaction time (h)

ro of

Yield and enzyme selectivity(%)

100

XOS COS

Jo

ur

na

lP

Fig. 4

72

Table 1 Apparent kinetic parameters of recombinant endoglucanase I on carboxymethylated cellulose (CMC) and birchwood xylan Vmax (μmol mL-1min-1) Km (mg/mL)

kcat (min-1)

kcat/Km (mL min-1mg-1)

CMC

0.05

5.1

10.3

2.0

Birchwood xylan

0.04

1.7

8.1

4.9

ro of

Substrate

Table 2 The yields of xylose and xylo-oligosaccharides in the hydrolysate of

-p

birchwood xylan The yield of xylose and xylo-oligosaccharides (%)

time (h)

Xylose

Xylobiose

Xylotriose

Xylotetraose

Xylopentaose

Xylohexaose

12

1.0

4.1

5.3

16.7

0.1

0.3

24

1.7

7.4

36

1.8

8.6

48

2.1

lP

32.8

0.1

0.6

13.4

38.4

0.9

3.6

14.3

41.3

0.3

1.0

na

11.0

2.2

9.3

15.0

41.7

0.1

0.3

2.2

9.5

15.3

41.9

0.1

0.1

Jo

72

ur

60

9.0

re

Reaction