Novel compound heterozygous SLC4A1 mutations in Thai patients with autosomal recessive distal renal tubular acidosis

Novel Compound Heterozygous SLC4A1 Mutations in Thai Patients With Autosomal Recessive Distal Renal Tubular Acidosis Suchai Sritippayawan, MD, Achra Sumboonnanonda, MD, Somkiat Vasuvattakul, MD, Thitima Keskanokwong, MSc, Nunghathai Sawasdee, BSc, Atchara Paemanee, MSc, Peti Thuwajit, MD, PhD, Prapon Wilairat, PhD, Sumalee Nimmannit, MD, Prida Malasit, MD, and Pa-thai Yenchitsomanus, PhD ● Background: Mutations in the SLC4A1 gene have been found to cause either autosomal dominant (AD) or autosomal recessive (AR) distal renal tubular acidosis (dRTA). The SLC4A1 mutations causing AD dRTA were reported in white patients, whereas those associated with AR dRTA were often found in Southeast Asia. Here, the authors report additional novel SLC4A1 mutations in 3 patients with AR dRTA from 2 unrelated Thai families. Methods: The patients and members of their families were clinically studied. Red cell morphology and sulfate influx were examined. The SLC4A1 gene was screened, analyzed, and confirmed for mutations by molecular genetic techniques. Results: In the first family, the patient had dRTA, rickets, failure to thrive, nephrocalcinosis, and hypokalemic-hyperchloremic metabolic acidosis with a urine pH level of 7.00. He had novel compound heterozygous SLC4A1 G701D/S773P mutations, inherited from clinically normal heterozygous mother and father. In the second family, the patient and his sister had dRTA and Southeast Asian ovalocytosis (SAO) with different clinical severity. The patient had proximal muscle weakness, rickets, nephrocalcinosis, hypokalemia, normal anion gap metabolic acidosis, and urine pH level of 6.80. His sister was asymptomatic but the urine pH level could not be lowered to below 5.50 after a short acid load. Both siblings had compound heterozygous SLC4A1 SAO/R602H mutations. Conclusion: Two novel compound heterozygous SLC4A1 G701D/S773P and SAO/R602H mutations were identified in Thai patients with AR dRTA. Am J Kidney Dis 44:64-70. © 2004 by the National Kidney Foundation, Inc. INDEX WORDS: SLC4A1; anion exchanger 1 (AE1); band 3; Southeast Asian ovalocytosis (SAO); distal renal tubular acidosis (dRTA); Thai.

A

NION EXCHANGER 1 (AE1 or band 3), a chloride/bicarbonate (Cl⫺/HCO3⫺) exchanger, is encoded by the SLC4A1 (MIM109270) gene located on chromosome 17q21-22 and is

From the Division of Nephrology, Department of Medicine; Division of Nephrology, Department of Pediatrics; and Division of Medical Molecular Biology, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok; the Medical Biotechnology Unit, National Center for Biotechnology and Genetic Engineering (BIOTEC), National Science and Technology Development Agency (NSTDA) Bangkok; the Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen; and the Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok, Thailand. Received December 1, 2003; accepted in revised form March 24, 2004. Supported by Siriraj Research Development Grant, BIOTEC Grant (No. BT-B-07-MG-B4-4501), and Thailand Research Fund (TRF). P.W. and P.M. are recipients of the Senior Research Scholar Award of the TRF. Address reprint requests to Pa-thai Yenchitsomanus, PhD, Division of Medical Molecular Biology, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand. E-mail: [email protected] © 2004 by the National Kidney Foundation, Inc. 0272-6386/04/4401-0013$30.00/0 doi:10.1053/j.ajkd.2004.03.033 64

expressed at high levels on red cell membrane and basolateral membrane of mammalian renal ␣-intercalated cells.1-3 The kidney AE1 isoform (kAE1) is truncated at the amino terminus attributable to the transcription of kAE1 messenger RNA (mRNA) from a promoter in intron 3 of the human SLC4A1 gene,4 lacking exons 1-3 sequences that are present in the erythroid AE1 (eAE1) transcript. SLC4A1 mutations have been found to cause red cell abnormality, eg, hereditary spherocytosis (HS) and Southeast Asian ovalocytosis (SAO) or distal renal tubular acidosis (dRTA). Although the red cell disorder being attributable to SLC4A1 mutation is usually inherited in autosomal dominant (AD) mode, dRTA resulting from mutation of this gene can be inherited in either AD5-9 or autosomal recessive (AR)10-13 fashion. The mutations reported to be associated with AD dRTA are R589H, R589S, R589C, S613F, and R901X.5-7,9 Our group11,13,14 and others10,12,15,16 have recently reported novel homozygous and compound heterozygous SLC4A1 mutations causing AR dRTA with or without red cell abnormality. The genotypes found in AR dRTA include G701D/ G701D, SAO/G701D, SAO/⌬V850, SAO/A858D, ⌬V850/␦V850, ⌬V850/A858D, and V488M/ V488M. It has been noted that heterozygous A858D mutation resulted in an incomplete form of dRTA,

American Journal of Kidney Diseases, Vol 44, No 1 (July), 2004: pp 64-70

NOVEL SLC4A1 MUTATIONS IN AR DRTA

although a full-blown dRTA was caused by compound heterozygous conditions.12,16 We describe here 2 additional novel genotypes of compound heterozygous SLC4A1 mutations associated with AR dRTA in 3 patients from 2 unrelated Thai families. METHODS

Subjects Family 1. A 5-year-old Thai male originally from Mukdahan, a province located on the bank of Mekong River in the Northeast of Thailand, was admitted into our hospital because of seizure. Laboratory investigation showed hypokalemia and normal anion gap metabolic acidosis, with serum sodium ion (Na⫹) of 138 mEq/L, potassium ion (K⫹) of 2.2, chloride ion (Cl⫺) of 96, and bicarbonate ion (HCO3⫺) of 19 mmol/L, whereas his urine pH and urine K⫹ were 7.0 and 40 mmol/d, respectively. The urine partial pressure of carbon dioxide (pCO2) was 57 mm Hg, during which the urine pH was 7.64 after bicarbonate loading test, indicating acid or hydrogen ion (H⫹) secretion defect. The serum creatinine level was 0.7 mg/dL (62 ␮mol/L) and his serum calcium (Ca) and magnesium (Mg) levels were normal. The patient’s hemoglobin level was 13.8 g/dL (138 g/L), and red cell morphology was normal. Plain kidney, ureter, and bladder (KUB) x-ray film showed bilateral nephrocalcinosis, and long bone study showed ricket appearance. He also had failure to thrive (body weight, 15.5 kg; height, 98 cm; less than the third percentile of normal Thai children). The seizure was well controlled with carbamazipine, although the cause was unknown. His parents had no symptoms, normal red cell morphology, and normal values of serum electrolytes with urine pH level less than 5.50 during 6 hours of a short acid loading test by intake 0.1 g/kg of ammonium chloride (NH4CL),17 indicating their normal urine acidification. Blood samples were collected from the patient and parents with informed consent. Family 2. A 19-year-old Thai male originally from Trang, a coastal province on the Indian Ocean in the South of Thailand, had a history of proximal muscle weakness for 4 years. On medical record, he had failure to thrive and rickets when he was 5 years old. His height was 154.5 cm, which was 9 cm less than the mean of age- and sex-adjusted height. Plain KUB film showed bilateral nephrocalcinosis. His serum Ca and Mg levels were normal. Hematologic examination found ovalocytosis, and the hemoglobin level was 15.7 g/dL (157 g/L). Blood and urine analyses showed serum Na⫹, 140; K⫹, 1.6; Cl⫺, 112; HCO3⫺, 14 mmol/L; serum creatinine, 1.0 mg/dL (88 ␮mol/L); and urine pH, 6.8. His urine pCO2 was 34 mm Hg, whereas the urine pH level was 7.71 after bicarbonate loading test. The patient’s father died as a result of an accident. His mother, brother, and sister were asymptomatic. The mother had SAO but could lower the urine pH to below 5.50 after a short acid loading test. The 17-year-old brother had normal red cell morphology and renal acidification function and development. The 15-yearold sister had SAO with mild metabolic acidosis (serum Na⫹, 137; K⫹, 3.8; Cl⫺, 108; HCO3⫺, 20 mmol/L) and could not acidify urine after a short acid loading test (urine pH,

65

6.60). She had normal serum Ca, phosphorus (P), and Mg. No nephrocalcinosis or any bone diseases were detected. Her height was normal (154 cm). Blood samples were collected from all members of this family with informed consent.

Red Cell Sulfate Uptake and Membrane Protein Studies Red cell sulfate uptake was determined by using radioactive sulfate (35SO4) in isotonic citrate buffer, pH 7.4, and the uptake rate was compared with that of normal control red cells. Inhibition of the red cell sulfate uptake by 4,4⬘diisothiocyanatostilbene-2,2-disulfonic acid (DIDS) was also assayed. Red cell membrane proteins were studied by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie blue staining. The ratio between band 3 and spectrin was determined by densitometric scanning.

Analysis of SLC4A1 Gene Genomic DNA was prepared from peripheral leukocytes by the standard phenol-chloroform extraction method. DNA samples from patients and family members were amplified in the regions of kidney promoter in intron 3 and exons 4 through 20 of the SLC4A1 gene by polymerase chain reaction (PCR) as described in our previous reports.11,13 In addition, the regions in exons 1 through 3 were also amplified for analysis of polymorphisms in the SLC4A1 gene by sequencing. PCR products of intron 3 and exons 4 through 20 were screened for nucleotide variation by single-strand conformational polymorphism (SSCP) method. PCR product with mobility shift detected on the SSCP gel was reamplified for purification using Qiaquick Gel Extraction Kit (Qiagen, Valencia, CA). The purified PCR product was then sequenced using ABI-PRISM BigDyeTerminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and an automated sequencer ABI-PRISMTM 310 (Applied Biosystems).

Detection of SLC4A1 Mutations The SLC4A1 mutations identified in the patients were detected in other family members by PCR method specific for each mutation. The methods and PCR primers used are listed in Table 1.

RESULTS

We screened for SLC4A1 mutation in the patient of the first family by the PCR-SSCP method and found mobility shifts of the PCR products from both exons 17 and 18 on the SSCP gel (data not shown). The results of DNA sequencing of the 2 exons showed the presence of a nucleotide substitution at codon 701 (GGC⬎GAC) resulting in a replacement of glycine by aspartic acid (G701D) in exon 17, a known mutation (band 3 Bangkok 1)10 frequently observed in Thai patients with AR dRTA13 and a novel nucleotide

66

SRITIPPAYAWAN ET AL Table 1.

Methods and PCR Primers for Analyses of SLC4A1 Mutations

Mutation

Method

PCR Primer

G701D

PCR-RED

S773P SAO

PCR-created RE site PCR and size differentiation

R602H

ASA

5⬘TACCCCTCACCTTCCCCTAC 3⬘ 5⬘GGGGCAGGAGGATGGTGAAG 3⬘ 5⬘GCGGCTCCCCCACAGGCATG 3⬘ 5⬘TGCCTATCACACCCCAGCAC 3⬘ 5⬘CCTCACCTCCTCCAGCTACTCC 3⬘ 5⬘CAGAAGTTGGGGCTGAGACAGAG 3⬘ 5⬘GTCCTTTCACCTGCCCACAGCTACG 3⬘ 5⬘GTCCTTTCACCTGCCCACAGCTACA 3⬘ 5⬘GGAAATGAGGACCTGGGGGGTATC 3⬘ Control primers 5⬘TGGGAGGAGAGAAGGGAGTCT 3⬘ 5⬘CGGTGTCGTGAGCTGAAAACC 3⬘

substitution at codon 773 (TCC⬎CCC) giving rise to a replacement of serine by proline (S773P) in exon 18 (Fig 1A). This S773P mutant is named band 3 Siriraj I. From DNA sequencing analysis, the G701D and S773P mutation was found to be inherited from the patient’s mother and father, respectively (Fig 1A). Similarly,10,12,16 the G701D mutation was also found to link to M31T (ATG⬎ACG) in exon 3 and K56E (AAG⬎GAG or band 3 Memphis I) in exon 4, whereas the S773P mutation was not seen to link to these 2 polymorphisms. The G701D mutation could be detected readily by PCR and restriction endonuclease digestion (PCR-RED) method using restriction endonuclease HpaII (Table 1).11,13 The mutant allele could not be cleaved by this enzyme, generating a diagnostic fragment of 321 base pair. The S773P mutation was analyzed by PCR with artificial creation of a restriction endonuclease SphI site, which was created in amplification of the mutant allele. Thus, the digested fragment indicating the mutant allele was 228 bp (Fig 2A). Using these methods, compound heterozygosity for G701D/ S773P in the patient and heterozygosity for G701D and S773P in the parents were confirmed (Fig 2A). The compound heterozygous G701D/ S773P mutations were not observed in the DNA samples randomly collected from 100 Thai individuals analyzed. This family was not available for red cell sulfate uptake and membrane protein studies. The second family lived in the South of Thailand where SAO is prevalent,18 and 3 of 4 members (the patient, mother, and his sister) were

Size of PCR Product (bp)

321 248 318 (wt) 291 (mt) 163

420

found to have SAO. The patient and his sister had both SAO and dRTA, a phenotype that had previously been reported.11,12 His brother had normal red cell morphologly and renal acidification function. Both the patient and his sister had 32% of red cell sulfate uptake of the normal control level, whereas his mother and brother had the levels of 60% and 70%, respectively. The red cell sulfate uptakes in the mother, patient, and sister who had SAO alone or SAO and dRTA were inhibited by DIDS to maintain the levels of 1% to 14%, whereas the uptake levels in the brother and normal control after DIDS inhibition were 49% and 59%, respectively. The ratios of band 3 to spectrin on red cells from all members of this family were not different from that of normal control, indicating that band 3 levels on the red cell membrane were not reduced. The results of SLC4A1 mutation screening by PCR-SSCP showed that the patient had mobility shifts of PCR products from exon 11, the typical of SAO mutation, and from exon 15 (data not shown). DNA sequencing analysis showed a deletion of 27 nucleotides in exon 11 (Ex11⌬27), the SAO mutation. A novel nucleotide substitution (CGT⬎CAT) at codon 602 in exon 15, causing a change of amino acid from arginine to histidine (R602H), was also found in the patient (Fig 1B). This R602H mutant is named band 3 Songkla 1. The SAO mutation was found to link to K56E (band 3 Memphis I) in exon 4 but not to M31T in exon 3, whereas the R602H does not either link to M31T or K56E polymorphism. The SAO mutation could simply be detected by PCR amplification of exon 11, producing a

Fig 1. (A) Sequencing analysis of SLC4A1 exon 17 (upper row) and exon 18 (lower row) in the members of family 1. A nucleotide substitution at codon 701 (GGC>GAC) in exon 17 resulting in G701D mutation was found in the mother, whereas a nucleotide substitution at codon 773 (TCC>CCC) in exon 18 causing S773P mutation was observed in the father. The 2 mutations were found in the patient. Both DNA strands in each exon were determined in the patient, but the anti-sense strands with mutations are shown. (B) Sequencing analysis of SLC4A1 exon 11 (upper row) and exon 15 (lower row) in the members of family 2. A deletion of 27 nucleotides in exon 11 (Ex11⌬27) or SAO mutation was found in the mother, the patient, and his sister. A nucleotide substitution (CGT>CAT) at codon 602 in exon 15 causing R602H mutation was also observed in the patient and his sister. The nucleotide substitution at this position was confirmed by repeated DNA sequencing and also by sequencing in the opposite direction.

68

SRITIPPAYAWAN ET AL

Using these 2 methods, compound heterozygous SAO/R602H mutations were detected in both the patient and his sister, whereas his mother and brother were heterozygous for SAO and R602H, respectively (Fig 2B). Analysis of 200 DNA samples from Thai persons in the southern region of the country showed neither compound heterozygous SAO/R602H nor heterozygous R602 mutation.18 DISCUSSION

Fig 2. (A) Analysis of SLC4A1 mutations in family 1. The G701D mutation in exon 17 was detected by PCRRED (upper gel). The father carried the wild-type allele, whereas the mother and patient carried heterozygous G701D mutation. The S773P mutation in exon 18 was analyzed by PCR with artificial creation of a restriction endonuclease-SphI site (lower gel). The father and patient carried heterozygous S773P mutation, but the mother carried the wild-type allele. In both gels, the first lane is standard DNA marker, and a normal female sample was also included in the second lane. (B) Analysis of SLC4A1 mutations in family 2. The SAO mutation owing to 27-bp deletion in exon 11 (Ex11⌬27) was detected by PCR method (upper gel). The mother, the patient, and his sister were heterozygous for SAO mutation. Two upper bands (Hd) were heteroduplex DNA molecules. Lane 1 is standard DNA marker. The R602H mutation in exon 15 was analyzed by ASA technique (lower gel). The R602H mutation was identified in all siblings, whereas the mother did not carry this mutation.

fragment 27 bp shorter than that from the normal allele. The product of normal allele was 318 bp, whereas that of SAO allele was 291 bp (Table 1). The R602H mutation could be examined by allele specific amplification (ASA) technique.

We have investigated 3 patients with dRTA in 2 unrelated Thai families, 2 patients with fullblown and 1 with asymptomatic dRTA. The 2 patients had severe disease, as shown by the early onset commencing in childhood and the presence of hypokalemic metabolic acidosis, failure to thrive, rickets, and bilateral nephrocalcinosis. Although several SLC4A1 mutations have been reported to result in AD dRTA in whites, the mutations associated with AR dRTA have also been documented in families of Southeast Asian origin. The mutations reported to result in AR dRTA in Thai, Malaysian, and Papua New Guinean populations include G701D, ⌬V850, and A858D in homozygous or compound heterozygous conditions with each other or with SAO. The heterozygous A858D mutation was also found to cause incomplete form of dRTA. However, the A858D and ⌬V850 mutations have not been observed in the southern Thai population.18 In the current report, 2 novel SLC4A1 mutations, S773P and R602H, were shown to coexist with the 2 documented mutations, G701D and SAO, respectively, generating compound heterozygous G701D/S773P and SAO/R602H mutations associated with AR dRTA in Thai patients. Previously, we and others have found that all patients with homozygous G701D mutation originated from the northeast of Thailand10,13 and patients with compound heterozygous SAO/ G701D resided in the south of the country.11,13 The highest allele frequency of the G701D mutation was found in the northeast, whereas that of SAO mutation was detected only in the south of Thailand.18 Thus, we suspect that G701D mutation might arise in the northeast and then drift to the south and other parts of Thailand.13,18 The presence of invariable linkage disequilibrium between G701D mutation and 2 polymorphisms (M31T and K56E) observed in Southeast Asian

NOVEL SLC4A1 MUTATIONS IN AR DRTA

populations supports its common origin and founder effect associated with its distribution in the region. Because the SAO mutation is prevalent in the south of Thailand and the southern neighboring countries, coexistence of SAO and other SLC4A1 mutations was frequently found in this region.11,12 Corresponding to the prevalence of G701D and SAO mutations, the families with G701D/S773P and SAO/R602H mutations were found to originate from the northeast (Mukdahan Province) and the south (Trang Province) of Thailand, respectively. It has been shown that the mutant G701D protein is defective in trafficking to the cell surface in Xenopus oocytes leading to a great decrease in anion transport activity; however, this trafficking defect could be rescued by coexpression with glycophorin A.10,12 Thus, the G701D mutation does not cause abnormal Cl⫺/ HCO3⫺ exchange function of the protein. The defect in the kidney ␣-intercalated cells that lack glycophorin A is probably similar to that found in the oocytes. It is likely that the mutant G701D protein is defective in trafficking from cytoplasm to basolateral membrane of the kidney ␣-intercalated cells. Unlike the mutant G701D protein, the mutant SAO protein is functionally inactive.19,20 Thus, coexistence of either G701D or SAO mutation with another SLC4A1 mutation that causes abnormality of protein in terms of expression, stability, intracellular trafficking, or anion transport function in the kidney ␣-intercalated cells will possibly result in dRTA. The mutant S773P protein was found to have a lower level of expression and a decreased halflife when compared with the expressed wild-type protein (Kittanakorm et al, manuscript submitted). The mutant R602H protein results in decreased red cell sulfate uptake; the remaining activities were 70% in the heterozygous (R602H/N) and 32% in the compound heterozygous (SAO/R602H) conditions. However, the red cell band 3 levels with reference to spectrin from the patient and other members of this family were not different from that of the normal control. The 2 siblings in the second family who had the SAO/R602H genotype presented with different clinical severity. The patient had a severe form of dRTA, whereas his sister had only mild metabolic acidosis with the renal acidification defect but without any other abnormality,

69

indicating that other modifying factors or genes might play a role in governing the severity of the disease; this requires further study. ACKNOWLEDGMENT The authors thank Duangporn Chuawatana and Sumitra Mingkum of the Division of Nephrology, Department of Medicine, Faculty of Medicine, Siriraj Hospital, for their technical and managerial assistance.

REFERENCES 1. Alper SL, Darman RB, Chernova MN, Dahl NK: The AE gene family of Cl⫺/HCO3⫺ exchangers. J Nephrol 15: S41-S53, 2002 (suppl 5) 2. Kopito RR, Lodish HF: Primary structure and transmembrane orientation of the murine anion exchange protein. Nature 316:234-238, 1985 3. Schuster VL, Fejes-Toth G, Naray-Fejes-Toth A, Gluck S: Colocalization of H(⫹)-ATPase and band 3 anion exchanger in rabbit collecting duct intercalated cells. Am J Physiol 260:F506-517, 1991 4. Kollert-Jons A, Wagner S, Hubner S, Appelhans H, Drenckhahn D: Anion exchanger 1 in human kidney and oncocytoma differs from erythroid AE1 in its NH2 terminus. Am J Physiol 265:F813-821, 1993 5. Bruce LJ, Cope DL, Jones GK, et al: Familial distal renal tubular acidosis is associated with mutations in the red cell anion exchanger (Band 3, AE1) gene. J Clin Invest 100:1693-1707, 1997 6. Jarolim P, Shayakul C, Prabakaran D, et al: Autosomal dominant distal renal tubular acidosis is associated in three families with heterozygosity for the R589H mutation in the AE1 (band 3) Cl⫺/HCO3⫺ exchanger. J Biol Chem 273:63806388, 1998 7. Karet FE, Gainza FJ, Gyory AZ, et al: Mutations in the chloride-bicarbonate exchanger gene AE1 cause autosomal dominant but not autosomal recessive distal renal tubular acidosis. Proc Natl Acad Sci U S A 95:6337-6342, 1998 8. Weber S, Soergel M, Jeck N, Konrad M: Atypical distal renal tubular acidosis confirmed by mutation analysis. Pediatr Nephrol 15:201-204, 2000 9. Sritippayawan S, Kirdpon S, Vasuvattakul S, et al: A de novo R589C mutation of anion exchanger 1 causing distal renal tubular acidosis. Pediatr Nephrol 18:644-648, 2003 10. Tanphaichitr VS, Sumboonnanonda A, Ideguchi H, et al: Novel AE1 mutations in recessive distal renal tubular acidosis. Loss-of-function is rescued by glycophorin A. J Clin Invest 102:2173-2179, 1998 11. Vasuvattakul S, Yenchitsomanus PT, Vachuanichsanong P, et al: Autosomal recessive distal renal tubular acidosis associated with Southeast Asian ovalocytosis. Kidney Int 56:1674-1682, 1999 12. Bruce LJ, Wrong O, Toye AM, et al: Band 3 mutations, renal tubular acidosis and South-East Asian ovalocytosis in Malaysia and Papua New Guinea: Loss of up to 95% band 3 transport in red cells. Biochem J 350:41-51, 2000 13. Yenchitsomanus PT, Vasuvattakul S, Kirdpon S, et al: Autosomal recessive distal renal tubular acidosis caused by G701D mutation of anion exchanger 1 gene. Am J Kidney Dis 40:21-29, 2002

70

14. Yenchitsomanus P: Human anion exchanger1 mutations and distal renal tubular acidosis. Southeast Asian J Trop Med Public Health 34:651-658, 2003 15. Ribeiro ML, Alloisio N, Almeida H, et al: Severe hereditary spherocytosis and distal renal tubular acidosis associated with the total absence of band 3. Blood 96:16021604, 2000 16. Wrong O, Bruce LJ, Unwin RJ, Toye AM, Tanner MJ: Band 3 mutations, distal renal tubular acidosis, and Southeast Asian ovalocytosis. Kidney Int 62:10-19, 2002 17. Wrong O, Davies H: The excretion of acid in renal disease. Q J Med 28:259-313, 1959

SRITIPPAYAWAN ET AL

18. Yenchitsomanus PT, Sawasdee N, Paemanee A, et al: Anion exchanger 1 mutations associated with distal renal tubular acidosis in the Thai population. J Hum Genet 48:451-456, 2003 19. Tanner MJ, Bruce L, Groves JD, Martin PG, Schofield AE: The defective red cell anion transporter (band 3) in hereditary South East Asian ovalocytosis and the role of glycophorin A in the expression of band 3 anion transport activity in Xenopus oocytes. Biochem Soc Trans 20:542-546, 1992 20. Schofield AE, Reardon DM, Tanner MJ: Defective anion transport activity of the abnormal band 3 in hereditary ovalocytic red blood cells. Nature 355:836-838, 1992