- Email: [email protected]
Novel detection platform for insulin based on dual-cycle signal amplification by Exonuclease III
Talanta 199 (2019) 596–602
Contents lists available at ScienceDirect
Talanta journal homepage: www.elsevier.com/locate/talanta
Novel detection platform for insulin based on dual-cycle signal amplification by Exonuclease III Chen Liu, Jialun Han, Jingjing Zhang, Jie Du
T
⁎
State Key Laboratory of Marine Resource Utilization in South China Sea, College of Materials and Chemical Engineering, Hainan University, Haikou 570228, PR China
ARTICLE INFO
ABSTRACT
Keywords: Insulin Graphene oxide Exonuclease III Fluorescence Signal amplification
A novel detection platform based on Exonuclease III dual-cycle signal amplification with graphene oxide as quenching agent and DNA labelling as recognition element has been developed for the fluorometric determination of insulin. Specific DNA sequences were cut by Exo III to control the fluorescence recovery of the system. Fluorescence intensity analysis was carried out by fluorescence spectrophotometer to obtain the fluorescence intensity corresponding to different concentrations of insulin. When insulin is added to the system, insulin binds to the adaptor and the fluorescence is quenched, whereas in the absence of insulin the fluorescence is restored. The sensor platform achieved multiple signal amplification affording rapid and sensitive detection of insulin with a detection range of 0.048–2.15 U/ml. The methodology is rapid, sensitive, of low cost and convenient to perform and has potential for routine screening of insulin in blood, and also has prospects for the detection of other proteins and biomolecules.
1. Introduction Insulin is a hormonal protein secreted by the insulin beta-cells in the pancreas and its release is stimulated by endogenous or exogenous substances such as glucose, ribose and glucagon [1,2]. The protein plays an important role in the control and regulation of blood glucose levels and is the only hormone in the body that lowers blood sugar and promotes the synthesis of glycogen, fat and protein. The number of diabetic patients in China (144.4 million) came top of the world's countries in 2017. The prevalence of diabetes in Chinese adults has risen from less than 1% in 1979 to 9.7% in 2010, a dramatic increase that has serious health and socio-economic consequences [3]. Exogenous insulin is used mainly to treat diabetics, and when insulin is deficient or lacking in the human body, the deficiency can lead to high blood glucose levels and even diabetes. Therefore, accurate determination of insulin in blood is of great value for early diagnosis, patient care and basic research on hyperglycemia and diabetes [4]. Nucleic acid adaptors are widely used in the field of biosensors due to their high specificity and selectivity. It has become an ideal recognition element for preparation of biosensors. Insulin binds the aptamer to form an anti-parallel G-quadruplex chain, some anti-parallel G-quadruplex bind hemin and show peroxidase activity. Izumi Kubo et al., the aptamer immobilized onto a gold electrode, observed the current change and obtained the insulin concentration value, with the
⁎
detection range of 0–5 μM [5]. A. Verdian-Doghaei et al. studied the combination of insulin and insulin aptamer (IBA) through different spectral techniques, and used the combination of donor and receptor to form a non-fluorescent complex, and proposed a simple and sensitive biosensor in the range of 2–70 nM based on insulin aptamer [6]. Ying et al., using GO as quenching agent, obtained a fluorescence sensor with detection limit of 500 nM and detection range of 0.5–50 mol/L based on nucleic acid aptamer fluorescence detection method. GO protects DNA from being lysed by nucleases, but aptamers can be separated from the go surface by specific target binding, and a cyclic amplification detection platform can be constructed based on this property [1]. Methods for detection of insulin can be summarized into two general categories: immunological detection methods and non-immunological methods [7,8]. However, these methods tend to be laborious and can be difficult to adapt to on-site and/or in real-time situations. At present, much research is being performed on the use of electrochemical and fluorescence methods in clinical analysis. The merits of fluorescence detection include relatively simple instrumentation and operation, rapid detection, good selectivity, and low detection limit [8]. In the present work, a new sensor platform has been designed to facilitate dual-cycle signal amplification using unlabeled adaptive ligands, GO, Exo III, stem-loop DNA (sl-DNA), and complementary strands. The experimental design is based on the fact that slDNA2 is generated by the reaction between fitness and sl-DNA1, and
Corresponding author. E-mail address: [email protected] (J. Du).
https://doi.org/10.1016/j.talanta.2019.03.013 Received 17 December 2018; Received in revised form 21 February 2019; Accepted 2 March 2019 Available online 02 March 2019 0039-9140/ © 2019 Elsevier B.V. All rights reserved.
Talanta 199 (2019) 596–602
C. Liu, et al.
DNA3 is generated by adding shear enzymes to release fluorescent DNA on GO, thus forming a dual cycle. Fluorescence quenching is used as a tool for detecting insulin. The method is simple and the cost is low; moreover, given that Exo III is widely used in biological testing and because of the potential for digestion, the basic approach can also be adapted to other proteins or small molecules. Also according to first principles, the concentration range for detection of insulin can be altered by changing the concentration of FAM-DNA4 and sl-DNA1. That is, the analytical range of the method can be adjusted depending on the approximate concentration range of the target species. Exonuclease III (Exo III) degrades dsDNA from blunt ends, 5′-overhangs or nicks; releases 5′-mononucleotides from the 3′-ends of DNA strands and produces stretches of single-stranded DNA (ss-DNA). It is not active on the 3′-overhang ends of DNA that are at least four-bases long and do not carry a 3′-terminal C-residue on the ss-DNA, or on phosphorothiolate-linked nucleotides. Based on these advantages, Exo III is a common platform for developing various detection strategies based on cyclic signal amplification [9–15]. Graphene oxide (GO) can interact strongly with DNA bases resulting in stable adsorption of ssDNA and quenching of fluorophores. The quenching efficiency is far higher than that of common organic quenching agents [16–18]. Moreover, in the context of using GO as a substrate for biosensing, it has low production cost and is simple to prepare.
detection parameters used were an emission wavelength of 522 nm and a scanning range of 494–700 nm. The reaction time program detection parameters used were an emission wavelength of 494 nm and an excitation wavelength of 521 nm. The peak of fluorescence intensity was at 521 nm, so the fluorescence values of the following experiments were all obtained at 521 nm. The Gel Document System of BIO-RAD was used for display of molecular separations following agarose gel electrophoresis. 2.3. Materials and reagents for construction of the detection platform Solutions of all oligonucleotides (10 μM) were prepared in tris-HCl buffer (10 mM) and stored in a refrigerator at 4 °C. Tris-HCl buffer (pH 7.43, 100 mM NaCl, 2.0 mM MgCl2) was used for the binding reaction between the aptamer and the sl-DNA1. Before the enzyme reaction, all DNA samples were pretreated as follows: samples were heated to 90 °C and incubated for 5 min, then cooled quickly by placing in refrigerator (4 °C); 20 μl of Exo III (200 U/μl) was diluted to 980 μl with reaction buffer (reaction buffer, 66 mM tris-HCl, pH 8.0 at 30 °C, 0.66 mM MgCl2). The enzyme incubation reaction was carried out in a water bath at 37 °C for 30 min, followed by inactivation by placing the sample tube in the middle of the water bath at 70 °C for 5 min. Insulin was diluted with dilute HCl (pH 2.4) to give a 1 mg/ml test solution and stored in a refrigerator at −20 °C before use. 0.02 g of GO gel (20 μl of 1% w/w 25 g) were added to 1980 μl of the tris-HCl buffer and the mixture was homogenized and then stored at room temperature in the dark. Given that the experimental conditions may change depending on the analytical requirements, this study focused on the detection performance of the aptamer-conjugated GO platform with final concentrations of the aptamer, sl-DNA1 and FAM-DNA4 of 3.3 nM.
2. Experimental 2.1. Materials and chemicals The insulin aptamers, sl-DNA1 (primer), DNA3 and FAM-DNA4 were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The DNA sequences were listed in Table 1. Exonuclease III was purchased from Sangon Biotech Co. Graphene oxide gel was purchased from Aladdin Industrial Corporation (Shanghai. China). Fetal bovine serum was purchased from EVERY GREEN (ZHEJIANG TIANHANG BIOTECHNOLOGY Co., LTD). The water used in the experiments was ultra-pure water. The paragraph of insulin aptamer used in the experiment is 5′-GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC-3′ and it was obtained by Systematic Evolution of Ligands by Exponential enrichment (SELEX) in vitro [19]. The ligand, composed of DNA or RNA (mainly DNA), and smaller than proteins, has a sensitivity comparable to that of an antigen-antibody response. The aptamer is easy to synthesize and is relatively stable. It is expected that aptamers will increasingly replace the enzyme-linked immune response in many bioanalytical applications and become a powerful detection tool for various biomolecules [20,21]. Nucleic acid adaptors are widely used in the field of biosensors due to their high specificity and selectivity [6,22]. However, fluorescent labelling of the aptamer may reduce the binding affinity of the aptamer to its target. In the present work, the aptamer does not require fluorescence modification.
2.4. Analytical procedure The experiment first determines the concentration of graphene oxide. Different concentrations of graphene oxide and 3.3 nM FAMDNA4 undergo strong π-π interaction leading to fluorescence quenching. Different fluorescence intensities are obtained by spectral analysis, and the quenching efficiency is analyzed to find the optimal concentration. Secondly, agarose gel electrophoresis was used to isolate DNA fragments in the microcirculation to determine the concentration of Exo III, aptamer, sl-DNA1, the mixture of adaptor and sl-DNA1 and the mixture of aptamer, sl-DNA1 and Exo III with different concentrations for electrophoresis and analysis. In electrophoresis, the DNA displacement of small molecular weight is much larger than that of large molecular weight, so we can identify the type of DNA. The optimum amount of Exo III was determined according to the different strip obtained in different sample swimlanes. The optimal system obtained from the above experiments was combined with the scheme to determine the concentration of Exo III in the second cycle. Different concentrations of DNA3 were obtained by adding different concentrations of Exo III, and then the FAM-DNA4 was substituted from GO. Fluorescence spectrophotometer was used to detect fluorescence changes in the system, find the optimal Exo III concentration. The resulting scheme is used to measure insulin concentration and obtain fluorescence spectra.
2.2. Instrumentation Fluorescence measurements were made with a fluorescence spectrophotometer (RF-6000, Shimadzu, Kyoto, Japan). The spectral Table 1 DNA sequences. Name
Sequence (5′-3′)
Aptamer sl-DNA1 DNA3 FAM-DNA4
GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC TTTCGAGGGTGGGTGAATTACGACCCACCCTCGAAAACCCCCCCCACCACC TTTCGAGGGTGGGTGAATTACG FAM-TTCACCCACCCTCGAAA
597
Talanta 199 (2019) 596–602
C. Liu, et al.
2.5. Gel electrophoresis
amplification platform was constructed to monitor insulin fluorescence.
Gel electrophoresis was performed on 3% (w/w) agarose gel containing 2 μl of GoldView. The gel was run in 1 x TBE buffer (1.998 M Tris-base, 0.8 M ethylenediamine tetraacetic acid disodium salt (EDTA), PH= 8.0) and then scanned by UV transilluminator 90 min after 80 V electrophoresis.
3.2. Optimization of the concentration of graphene oxide The concentration of the GO substrate affected the fluorescence quenching and signal recovery. The fluorescence spectra were recorded for seven samples prepared with the same concentrations of FAMDNA4, but with different concentrations of GO (0, 0.017, 0.018, 0.021, 0.025, 0.033, 0.0375 g/l). Fig. 1 (A) shows that as the concentration of GO increased, the fluorescence quenching efficiency increased, and, as revealed in Fig. 1 (B), the quenching efficiency for 0.025 g/l of GO reached 93%; and for a 0.033 g/l addition the fluorescence intensity was effectively zero. Due to the high quenching efficiency of GO, it is easy to overdose samples and this would lead to a low fluorescence recovery. In further work, a dosing level of 0.025 g/l of GO was selected as the optimal reaction dose. (Graphene oxide and FAM-DNA4 concentration ratio: 0.025 g/l: 3.3 nM) Fig. 1 (C) shows the degree of fluorescence quenching for FAMDNA4 at different times based on dosing by GO. It can be seen that the fluorescence was rapidly quenched and there was still a downward trend after 20 min. After about 30 min, the downward trend was greatly reduced and almost stabilized. On the basis of this data the optimal time for sample incubation was judged to be 30 min. (Fluorescence intensity at 521 nm)
3. Results and discussion 3.1. Design strategy for insulin detection As shown in Scheme 1, in the absence of insulin, the aptamer can hybridize with the 3´-protruding terminus of sl-DNA1 to form a flat terminal stem-loop DNA2, which can be cleaved along the 3′ to 5′ direction by Exo III to release DNA3. In the first small signal cycle, by adding a small number of aptamers, most of the sl-DNA1 is consumed, resulting in an increasing efficiency of DNA3 production, which in turn can hybridize with FAM-DNA4 to form DNA5. Then, DNA5 leaves the surface of the GO giving an increase in fluorescence signal. Moreover, DNA5 is dsDNA hybridized by DNA4 and DNA3, and has five more bases than DNA4. Thus, on addition of Exo III, only FAM-DNA4 is digested and this leads to the release of DNA3. The released DNA3 again interacts with FAM-DNA4 on the surface of the GO to form a circular signal amplification pathway as shown. This is the second signal amplification. Thus, the two catalytic recycling processes by Exo III could, in theory, realize infinite amplification of fluorescence. In the presence of insulin, the aptamer reacts with insulin and thus cannot bind to sl-DNA1 to form sl-DNA2. As the aptamer-insulin complex is very stable, the addition of sl-DNA1, Exo III and GO with adsorbed FAM-DNA4 has no effect on the complex; therefore, fluorescence is not realized. Thus, through this strategy, the circulating signal
3.3. Viability of signal amplification To verify the viability of the experiment, two samples containing the same concentration of sl-DNA1, aptamer and Exo III in two sample tubes (S1, S2) were incubated at 37 °C for 20 min. and then inactivated at 70 °C, thus ensuring conditions for the two samples were the same for the first cycle. Then GO-FAM-DNA4 was added to S1 and GO-FAM-DNA4
Scheme 1. Schematic of the Exonuclease III aided amplification assay for insulin detection.
598
Talanta 199 (2019) 596–602
C. Liu, et al.
Fig. 2. Fluorescence spectra for signal amplification (Fluorescence intensity at 521 nm): (a) Signal response in the presence of Exonuclease III (the second cycle includes the action of Exonuclease III); (b) Signal response in the absence of Exonuclease III (there is no Exonuclease III in the second cycle).
3.4. Small signal amplification The first small cycle is the key to the whole experiment, the Exo III does not work, and the latter experiment cannot be performed, so the amount of enzyme used is critical. There is no fluorescence change in the microcirculation, so we can separate the samples by agarose gel electrophoresis, obtain electrophoresis diagram, and determine the concentration of Exo III. The DNA molecule in agarose gel swimming sometimes charge effect and the effect of the molecular sieve, and the separation of charged particles depends on the molecular size, so the size of different molecular weight DNA, ran out of the stripe distance are also different, determine the type of DNA by the distance of the stripe, and observe whether DNA3 production and sl-DNA2 consumption to determine the amount of enzyme. As shown in Fig. 3 (A) (from left to right), in connection with movement of the DNA band, which is of relatively low molecular weight, runs, the aptamer has a blurred band and is at a lower position than that of sl-DNA1, because the aptamer has more bases than sl-DNA1; for instance, aptamer+ sl-DNA1 displays two bands with one strip having moved further while the other strip is at the same position as slDNA1. This indicates that the aptamer combined with sl-DNA1 to form sl-DNA2, and that the aptamer was consumed while sl-DNA1 was in excess. In the fourth lane, where 8 U of Exo III was added to the mixture of the adaptor and sl-DNA1, sl-DNA1 and sl-DNA2 were consumed, resulting in DNA3 bands (lane 4 and lane 5), and more Exo III (20U) strips to make them darker. Thus the five groups of experiments were compared to find the optimal shear enzyme concentration. As shown in Fig. 3 (B), in the second and third lanes, in addition to the DNA3 bands, there were also blurred bands for sl-DNA2. This indicated that the amount of enzyme used was too small and the reaction was incomplete. The sl-DNA2 bands in lane 4 were barely visible, while sl-DNA2 in lane 5 was not visible and the DNA3 band was the most intense. This indicates that the reaction had been optimized in terms of the reaction conditions for an enzyme dosage of 8 U.
Fig. 1. Fluorescence response as a function of graphene oxide concentration: (A) Fluorescence spectra (From a to g: 0, 0.017, 0.018, 0.021, 0.025, 0.033, 0.0375 g/l); (B) Quenching efficiency for various amounts of graphene oxide; (C) Optimization of quenching time.
and 20 U of Exo III were added to S2. The two samples were then incubated at 37 °C for 30 min, and inactivated at 70 °C. The fluorescence spectra were then measured and the results are shown in Fig. 2. In the case of curve (a), the second cycle included the action of Exo III while for curve (b) Exo III was not involved in the second cycle. It can be seen that the fluorescence intensity recorded for the second cycle through the action of Exo III was increased by about fifty percent compared to the experiment without Exo III. Also from inspection of curve (e) in Fig. 1 (A) and curve (b) in Fig. 2, it can be seen that the fluorescence intensity increased only when the enzyme had a role in the first cycle to produce DNA3. This demonstrates that enzymes play a key role in the whole signal amplification system, thus confirming the viability of the scheme.
3.5. Optimization of the concentration of Exo III To control the amount of Exo III in the second cycle, different concentrations of Exo III were added to observe the fluorescence intensity after the reaction, which resulted in different fluorescence recoveries. The results are shown in Fig. 4. Addition of Exo III resulted in digestion of the fluorophore-modified strand in DNA5 along the 3′ end to give ss-DNA3 and the fluorophore. DNA3 became bound to FAM599
Talanta 199 (2019) 596–602
C. Liu, et al.
Fig. 3. Gel electrophoresis of samples (Voltage: 90 V Current: 396 mA): (A) From left to right, lane 1: aptamer, lane 2: sl-DNA1, lane 3: aptamer+ sl-DNA1, lane 4: aptamer+ sl-DNA1 +8U Exo III, lane 5: aptamer+ sl-DNA1 + 20 U Exo III; (B) From left to right, lane 1: aptamer+ sl-DNA1, lane 2: aptamer+ sl-DNA1 + 2 U Exo III, lane 3: aptamer+ sl-DNA1 + 4 U Exo III, lane 4: aptamer+ sl-DNA1 + 6 U Exo III, lane 5: aptamer+ sl-DNA1 + 8 U Exo III.
Fig. 5. Percentage fluorescence recovery values at various Exonuclease III concentrations.
was chosen as the most appropriate concentration for the enzyme in the second cycle. 3.6. Signal amplification and quantitation of insulin To obtain the standard curve for insulin, 90 U of Exo III was used together with different concentrations of insulin to check on the fluorescence recovery levels. As stated previously, with addition of insulin, sl-DNA1 cannot react with the aptamer, be digested by the enzyme, and generate DNA3; hence the amplification cycle cannot proceed. As shown in Fig. 6 (A), the fluorescence intensity responses decreased progressively for increasing additions (0.048, 0.198, 0.483, 0.676, 0.965 U/ml insulin) of insulin. Since the fluorescence signal after the addition of 0.198 U/ml insulin could not be distinguished from the fluorescence signal of 0.048 U/ml, the detection limit of the detection platform was 0.048 U/ml. In the abstract, the fluorescence recovery intensity will not be lower than g line. △F= line a – line g= 874.117 = 266.88034 × + 299.6488, so x = 2.15U/ml. The standard, as shown in Fig. 6 (B), was linear (equation: y = 266.88034 ×+ 299.6488) with a detection range of 0.048–12.8μmol/l. Correlation coefficient R= 0.99172, it shows that the two variables have a strong linear correlation. The above fluorescence data confirm that the detection scheme based on Exo III dual amplification and GO fluorescence quenching provides a viable approach to the determination of insulin.
Fig. 4. (A) Fluorescence spectra for different concentrations of Exo III added to the circulation system to restore the different fluorescence intensities (From a to h: FAM-DNA4, 90, 80, 70, 60, 40, 0 U Exo III, GO+FAM-DNA4). (B) The fluorescence intensity of the samples at 520 nm wavelength.
DNA4 on GO, which then separated from GO to form ds-DNA5. Therefore, within a specific concentration range, the greater the enzyme concentration, the higher the fluorescence intensity. Based on fluorescence recovery values of 0, 40, 60, 70, 80, and 90 U relative to the amount of fluorescence quenched, the percentage fluorescence recovery values obtained are indicated in Fig. 5. The percentage fluorescence recovery values at 0, 40, 60, 70, and 80 u were 12.2%, 21.8%, 37.8%, 45.5%, and 60.4%, respectively. For an enzyme concentration of 90 U; the fluorescence recovery value reached 70%. However, for enzyme concentrations greater than 80 U, the rate of increase in fluorescence started to decline; therefore, 90 U 600
Talanta 199 (2019) 596–602
C. Liu, et al.
Fig. 6. (A) Fluorescence spectra as a function of Insulin concentration (a to g: sensor system base line, 0.048, 0.198, 0.483, 0.676, 0.965 U/ml insulin, 30 μl GO+1 μl FAM-DNA4); (B) Standard curve for insulin.
3.7. Selectivity of insulin detection In order to investigate the selectivity of biosensors, we selected Bovine serum albumin, Thrombin, and VEGF with the same insulin concentration as in Fig. 6(g) under the same conditions. (Fluorescence intensity at 521 nm) As shown in Fig. 7, the ratio of quenching fluorescence intensity of BSA, Thrombin, VEGF and Insulin is 2.44: 1: 1.33: 5.33. The degree of fluorescence quenching of insulin is significantly different from that of other proteins. Therefore, this method has a good selectivity specificity for insulin. 3.8. Analysis of insulin in real samples In order to evaluate the feasibility and reliability of the sensing system in practical applications, insulin was added to buffer-diluted fetal bovine serum, and the fluorescence intensity was measured by this experimental method. As shown in Fig. 8, the real sample has a smaller slope than the standard curve of the experimental sample. In a serum environment, the sensitivity of the sensor becomes higher, the fluorescence intensity of the same concentration of insulin quenching becomes smaller, and the measurable range increases, which is the same as the trend of the standard curve obtained in the buffer. The sensing system can be applied to real samples with good sensitivity.
Fig. 8. Comparison of standard curve of experimental samples and real samples (Red line: in buffer; black line: in serum).
4. Conclusions A novel insulin detection platform, based on Exo III dual-cycle signal amplification with GO quenching, has been developed. The sensor platforms achieved multiple signal amplification with Exo III and GO providing rapid and sensitive detection of insulin with a detection range of 0.048–2.15 U/ml. A feature of the method is that no specific recognition sequence is required for the enzymatic hydrolysis compared to traditional immunoassay-based methods. The present design affords rapid, precise and sensitive detection of insulin with good selectivity. On the basis of these initial studies, it is projected that the approach has potential application in the clinic and also prospects for detection of other protein molecules by replacement of the adaptor/target species moieties. The graphene oxide used in the experiment has good biocompatibility, and the size of graphene oxide of 10–800 nm is relatively stable in the human blood environment. Therefore, the detection platform in the prediction experiment can be applied to the determination of insulin in human blood samples. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (Grant No. 21763009, 21404028), and Graduate Students Innovation Research Project of Hainan Province (Hys2018-59, Hys2018-60).
Fig. 7. Selectivity of the assay for insulin over other control proteins: BSA, Thrombin, VEGF (each at 0.965 U/ml). 601
Talanta 199 (2019) 596–602
C. Liu, et al.
References
carbon nanotube induced quenching, Chem. Commun. 48 (2) (2012) 269–271. [12] M. Zhang, Y.M. Guan, B.C. Ye, Ultrasensitive fluorescence polarization DNA detection by target assisted exonuclease III-catalyzed signal amplification, Chem. Commun. 47 (12) (2011) 3478–3480. [13] H. Wu, R. Liu, X. Kang, C. Liang, L. Lv, Z. Guo, Fluorometric aptamer assay for ochratoxin A based on the use of single walled carbon nanohorns and exonuclease III-aided amplification, MikrochimActa 185 (1) (2017) 27. [14] Y. He, B. Jiao, Detection of biotin-streptavidin interactions based on poly(thymine)templated copper nanoparticles coupled with Exo III-aided DNA recycling amplification, Sens. Actuators B: Chem. 265 (2018) 387–393. [15] Q. Xue, Y. Lv, H. Cui, X. Gu, S. Zhang, J. Liu, A. DNA, nanomachine based on rolling circle amplification-bridged two-stage exonuclease III-assisted recycling strategy for label-free multi-amplified biosensing of nucleic acid, Anal. Chim. Acta 856 (2015) 103–109. [16] S.S. Nanda, G.C. Papaefthymiou, D.K. Yi, Functionalization of graphene oxide and its biomedical applications, Crit. Rev. Solid State Mater. Sci. 40 (5) (2015) 291–315. [17] S. Stankovich, D.A. Dikin, G.H. Dommett, K.M. Kohlhaas, E.J. Zimney, E.A. Stach, R.D. Piner, S.T. Nguyen, R.S. Ruoff, Graphene-based composite materials, Nature 442 (7100) (2006) 282–286. [18] Y. Wang, Z. Li, J. Wang, J. Li, Y. Lin, Graphene and graphene oxide: biofunctionalization and applications in biotechnology, Trends Biotechnol. 29 (5) (2011) 205–212. [19] L. Lv, C. Cui, C. Liang, Aptamer-based single-walled carbon nanohorn sensors for ochratoxin A detection, Food Control (2015) 296–301. [20] Y. Zhao, R. Liu, W. Sun, L. Lv, Z. Guo, Ochratoxin A detection platform based on signal amplification by Exonuclease III and fluorescence quenching by gold nanoparticles, Sens. Actuators B: Chem. 255 (2018) 1640–1645. [21] L. Wang, J. Zhang, X. Wang, Gold nanoparticlebased optical probes for target-responsive DNA structures, Gold Bull. (2008) 37–41. [22] S.M. Taghdisi, N.M. Danesh, P. Lavaee, A. Sarreshtehdar Emrani, M. Ramezani, K. Abnous, Aptamer biosensor for selective and rapid determination of insulin, Anal. Lett. 48 (4) (2014) 672–681.
[1] Y. Pu, Z. Zhu, D. Han, H. Liu, J. Liu, J. Liao, K. Zhang, W. Tan, Insulin-binding aptamer-conjugated graphene oxide for insulin detection, Analyst 136 (20) (2011) 4138–4140. [2] T.L. van Belle, K.T. Coppieters, M.G. von Herrath, Type 1 diabetes: etiology, immunology, and therapeutic strategies, Physiol. Rev. 91 (1) (2011) 79–118. [3] C. Patterson, L. Guariguata, G. Dahlquist, G. Soltesz, G. Ogle, M. Silink, Diabetes in the young - a global view and worldwide estimates of numbers of children with type 1 diabetes, Diabetes Res. Clin. Pract. 103 (2) (2014) 161–175. [4] B. Preethi, G. Jaisri, K.M. Prasanna Kumar, Assessment of insulin resistance in normoglycemic young adults, Hum. Physiol. (2010) 118–125. [5] I. Kubo, T. Eguchi, Study on electrochemical insulin sensing utilizing a DNA aptamer-immobilized gold electrode, Materials 8 (8) (2015) 4710–4719. [6] A. Verdian-Doghaei, M.R. Housaindokht, Spectroscopic study of the interaction of insulin and its aptamer – sensitive optical detection of insulin, J. Lumin. 159 (2015) 1–8. [7] C. Hess, A. Thomas, M. Thevis, B. Stratmann, W. Quester, D. Tschoepe, B. Madea, F. Musshoff, Simultaneous determination and validated quantification of human insulin and its synthetic analogues in human blood serum by immunoaffinity purification and liquid chromatography-mass spectrometry, Anal. Bioanal. Chem. 404 (6–7) (2012) 1813–1822. [8] Y. Xiong, C. Deng, X. Zhang, P. Yang, Designed synthesis of aptamer-immobilized magnetic mesoporous silica/Au nanocomposites for highly selective enrichment and detection of insulin, ACS Appl. Mater. Interfaces 7 (16) (2015) 8451–8456. [9] Y. Tang, M. Liu, L. Xu, J. Tian, X. Yang, Y. Zhao, S. Zhao, A simple and rapid dualcycle amplification strategy for microRNA based on graphene oxide and exonuclease III-assisted fluorescence recovery, Anal. Methods 10 (30) (2018) 3777–3782. [10] C. Chen, J. Zhao, J. Jiang, R. Yu, A novel exonuclease III-aided amplification assay for lysozyme based on graphene oxide platform, Talanta 101 (2012) 357–361. [11] H. Chen, J. Wang, G. Liang, P. Zhang, J. Kong, A novel exonuclease III aided amplification method for sensitive nucleic acid detection based on single walled
602
Contents lists available at ScienceDirect
Talanta journal homepage: www.elsevier.com/locate/talanta
Novel detection platform for insulin based on dual-cycle signal amplification by Exonuclease III Chen Liu, Jialun Han, Jingjing Zhang, Jie Du
T
⁎
State Key Laboratory of Marine Resource Utilization in South China Sea, College of Materials and Chemical Engineering, Hainan University, Haikou 570228, PR China
ARTICLE INFO
ABSTRACT
Keywords: Insulin Graphene oxide Exonuclease III Fluorescence Signal amplification
A novel detection platform based on Exonuclease III dual-cycle signal amplification with graphene oxide as quenching agent and DNA labelling as recognition element has been developed for the fluorometric determination of insulin. Specific DNA sequences were cut by Exo III to control the fluorescence recovery of the system. Fluorescence intensity analysis was carried out by fluorescence spectrophotometer to obtain the fluorescence intensity corresponding to different concentrations of insulin. When insulin is added to the system, insulin binds to the adaptor and the fluorescence is quenched, whereas in the absence of insulin the fluorescence is restored. The sensor platform achieved multiple signal amplification affording rapid and sensitive detection of insulin with a detection range of 0.048–2.15 U/ml. The methodology is rapid, sensitive, of low cost and convenient to perform and has potential for routine screening of insulin in blood, and also has prospects for the detection of other proteins and biomolecules.
1. Introduction Insulin is a hormonal protein secreted by the insulin beta-cells in the pancreas and its release is stimulated by endogenous or exogenous substances such as glucose, ribose and glucagon [1,2]. The protein plays an important role in the control and regulation of blood glucose levels and is the only hormone in the body that lowers blood sugar and promotes the synthesis of glycogen, fat and protein. The number of diabetic patients in China (144.4 million) came top of the world's countries in 2017. The prevalence of diabetes in Chinese adults has risen from less than 1% in 1979 to 9.7% in 2010, a dramatic increase that has serious health and socio-economic consequences [3]. Exogenous insulin is used mainly to treat diabetics, and when insulin is deficient or lacking in the human body, the deficiency can lead to high blood glucose levels and even diabetes. Therefore, accurate determination of insulin in blood is of great value for early diagnosis, patient care and basic research on hyperglycemia and diabetes [4]. Nucleic acid adaptors are widely used in the field of biosensors due to their high specificity and selectivity. It has become an ideal recognition element for preparation of biosensors. Insulin binds the aptamer to form an anti-parallel G-quadruplex chain, some anti-parallel G-quadruplex bind hemin and show peroxidase activity. Izumi Kubo et al., the aptamer immobilized onto a gold electrode, observed the current change and obtained the insulin concentration value, with the
⁎
detection range of 0–5 μM [5]. A. Verdian-Doghaei et al. studied the combination of insulin and insulin aptamer (IBA) through different spectral techniques, and used the combination of donor and receptor to form a non-fluorescent complex, and proposed a simple and sensitive biosensor in the range of 2–70 nM based on insulin aptamer [6]. Ying et al., using GO as quenching agent, obtained a fluorescence sensor with detection limit of 500 nM and detection range of 0.5–50 mol/L based on nucleic acid aptamer fluorescence detection method. GO protects DNA from being lysed by nucleases, but aptamers can be separated from the go surface by specific target binding, and a cyclic amplification detection platform can be constructed based on this property [1]. Methods for detection of insulin can be summarized into two general categories: immunological detection methods and non-immunological methods [7,8]. However, these methods tend to be laborious and can be difficult to adapt to on-site and/or in real-time situations. At present, much research is being performed on the use of electrochemical and fluorescence methods in clinical analysis. The merits of fluorescence detection include relatively simple instrumentation and operation, rapid detection, good selectivity, and low detection limit [8]. In the present work, a new sensor platform has been designed to facilitate dual-cycle signal amplification using unlabeled adaptive ligands, GO, Exo III, stem-loop DNA (sl-DNA), and complementary strands. The experimental design is based on the fact that slDNA2 is generated by the reaction between fitness and sl-DNA1, and
Corresponding author. E-mail address: [email protected] (J. Du).
https://doi.org/10.1016/j.talanta.2019.03.013 Received 17 December 2018; Received in revised form 21 February 2019; Accepted 2 March 2019 Available online 02 March 2019 0039-9140/ © 2019 Elsevier B.V. All rights reserved.
Talanta 199 (2019) 596–602
C. Liu, et al.
DNA3 is generated by adding shear enzymes to release fluorescent DNA on GO, thus forming a dual cycle. Fluorescence quenching is used as a tool for detecting insulin. The method is simple and the cost is low; moreover, given that Exo III is widely used in biological testing and because of the potential for digestion, the basic approach can also be adapted to other proteins or small molecules. Also according to first principles, the concentration range for detection of insulin can be altered by changing the concentration of FAM-DNA4 and sl-DNA1. That is, the analytical range of the method can be adjusted depending on the approximate concentration range of the target species. Exonuclease III (Exo III) degrades dsDNA from blunt ends, 5′-overhangs or nicks; releases 5′-mononucleotides from the 3′-ends of DNA strands and produces stretches of single-stranded DNA (ss-DNA). It is not active on the 3′-overhang ends of DNA that are at least four-bases long and do not carry a 3′-terminal C-residue on the ss-DNA, or on phosphorothiolate-linked nucleotides. Based on these advantages, Exo III is a common platform for developing various detection strategies based on cyclic signal amplification [9–15]. Graphene oxide (GO) can interact strongly with DNA bases resulting in stable adsorption of ssDNA and quenching of fluorophores. The quenching efficiency is far higher than that of common organic quenching agents [16–18]. Moreover, in the context of using GO as a substrate for biosensing, it has low production cost and is simple to prepare.
detection parameters used were an emission wavelength of 522 nm and a scanning range of 494–700 nm. The reaction time program detection parameters used were an emission wavelength of 494 nm and an excitation wavelength of 521 nm. The peak of fluorescence intensity was at 521 nm, so the fluorescence values of the following experiments were all obtained at 521 nm. The Gel Document System of BIO-RAD was used for display of molecular separations following agarose gel electrophoresis. 2.3. Materials and reagents for construction of the detection platform Solutions of all oligonucleotides (10 μM) were prepared in tris-HCl buffer (10 mM) and stored in a refrigerator at 4 °C. Tris-HCl buffer (pH 7.43, 100 mM NaCl, 2.0 mM MgCl2) was used for the binding reaction between the aptamer and the sl-DNA1. Before the enzyme reaction, all DNA samples were pretreated as follows: samples were heated to 90 °C and incubated for 5 min, then cooled quickly by placing in refrigerator (4 °C); 20 μl of Exo III (200 U/μl) was diluted to 980 μl with reaction buffer (reaction buffer, 66 mM tris-HCl, pH 8.0 at 30 °C, 0.66 mM MgCl2). The enzyme incubation reaction was carried out in a water bath at 37 °C for 30 min, followed by inactivation by placing the sample tube in the middle of the water bath at 70 °C for 5 min. Insulin was diluted with dilute HCl (pH 2.4) to give a 1 mg/ml test solution and stored in a refrigerator at −20 °C before use. 0.02 g of GO gel (20 μl of 1% w/w 25 g) were added to 1980 μl of the tris-HCl buffer and the mixture was homogenized and then stored at room temperature in the dark. Given that the experimental conditions may change depending on the analytical requirements, this study focused on the detection performance of the aptamer-conjugated GO platform with final concentrations of the aptamer, sl-DNA1 and FAM-DNA4 of 3.3 nM.
2. Experimental 2.1. Materials and chemicals The insulin aptamers, sl-DNA1 (primer), DNA3 and FAM-DNA4 were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The DNA sequences were listed in Table 1. Exonuclease III was purchased from Sangon Biotech Co. Graphene oxide gel was purchased from Aladdin Industrial Corporation (Shanghai. China). Fetal bovine serum was purchased from EVERY GREEN (ZHEJIANG TIANHANG BIOTECHNOLOGY Co., LTD). The water used in the experiments was ultra-pure water. The paragraph of insulin aptamer used in the experiment is 5′-GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC-3′ and it was obtained by Systematic Evolution of Ligands by Exponential enrichment (SELEX) in vitro [19]. The ligand, composed of DNA or RNA (mainly DNA), and smaller than proteins, has a sensitivity comparable to that of an antigen-antibody response. The aptamer is easy to synthesize and is relatively stable. It is expected that aptamers will increasingly replace the enzyme-linked immune response in many bioanalytical applications and become a powerful detection tool for various biomolecules [20,21]. Nucleic acid adaptors are widely used in the field of biosensors due to their high specificity and selectivity [6,22]. However, fluorescent labelling of the aptamer may reduce the binding affinity of the aptamer to its target. In the present work, the aptamer does not require fluorescence modification.
2.4. Analytical procedure The experiment first determines the concentration of graphene oxide. Different concentrations of graphene oxide and 3.3 nM FAMDNA4 undergo strong π-π interaction leading to fluorescence quenching. Different fluorescence intensities are obtained by spectral analysis, and the quenching efficiency is analyzed to find the optimal concentration. Secondly, agarose gel electrophoresis was used to isolate DNA fragments in the microcirculation to determine the concentration of Exo III, aptamer, sl-DNA1, the mixture of adaptor and sl-DNA1 and the mixture of aptamer, sl-DNA1 and Exo III with different concentrations for electrophoresis and analysis. In electrophoresis, the DNA displacement of small molecular weight is much larger than that of large molecular weight, so we can identify the type of DNA. The optimum amount of Exo III was determined according to the different strip obtained in different sample swimlanes. The optimal system obtained from the above experiments was combined with the scheme to determine the concentration of Exo III in the second cycle. Different concentrations of DNA3 were obtained by adding different concentrations of Exo III, and then the FAM-DNA4 was substituted from GO. Fluorescence spectrophotometer was used to detect fluorescence changes in the system, find the optimal Exo III concentration. The resulting scheme is used to measure insulin concentration and obtain fluorescence spectra.
2.2. Instrumentation Fluorescence measurements were made with a fluorescence spectrophotometer (RF-6000, Shimadzu, Kyoto, Japan). The spectral Table 1 DNA sequences. Name
Sequence (5′-3′)
Aptamer sl-DNA1 DNA3 FAM-DNA4
GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC TTTCGAGGGTGGGTGAATTACGACCCACCCTCGAAAACCCCCCCCACCACC TTTCGAGGGTGGGTGAATTACG FAM-TTCACCCACCCTCGAAA
597
Talanta 199 (2019) 596–602
C. Liu, et al.
2.5. Gel electrophoresis
amplification platform was constructed to monitor insulin fluorescence.
Gel electrophoresis was performed on 3% (w/w) agarose gel containing 2 μl of GoldView. The gel was run in 1 x TBE buffer (1.998 M Tris-base, 0.8 M ethylenediamine tetraacetic acid disodium salt (EDTA), PH= 8.0) and then scanned by UV transilluminator 90 min after 80 V electrophoresis.
3.2. Optimization of the concentration of graphene oxide The concentration of the GO substrate affected the fluorescence quenching and signal recovery. The fluorescence spectra were recorded for seven samples prepared with the same concentrations of FAMDNA4, but with different concentrations of GO (0, 0.017, 0.018, 0.021, 0.025, 0.033, 0.0375 g/l). Fig. 1 (A) shows that as the concentration of GO increased, the fluorescence quenching efficiency increased, and, as revealed in Fig. 1 (B), the quenching efficiency for 0.025 g/l of GO reached 93%; and for a 0.033 g/l addition the fluorescence intensity was effectively zero. Due to the high quenching efficiency of GO, it is easy to overdose samples and this would lead to a low fluorescence recovery. In further work, a dosing level of 0.025 g/l of GO was selected as the optimal reaction dose. (Graphene oxide and FAM-DNA4 concentration ratio: 0.025 g/l: 3.3 nM) Fig. 1 (C) shows the degree of fluorescence quenching for FAMDNA4 at different times based on dosing by GO. It can be seen that the fluorescence was rapidly quenched and there was still a downward trend after 20 min. After about 30 min, the downward trend was greatly reduced and almost stabilized. On the basis of this data the optimal time for sample incubation was judged to be 30 min. (Fluorescence intensity at 521 nm)
3. Results and discussion 3.1. Design strategy for insulin detection As shown in Scheme 1, in the absence of insulin, the aptamer can hybridize with the 3´-protruding terminus of sl-DNA1 to form a flat terminal stem-loop DNA2, which can be cleaved along the 3′ to 5′ direction by Exo III to release DNA3. In the first small signal cycle, by adding a small number of aptamers, most of the sl-DNA1 is consumed, resulting in an increasing efficiency of DNA3 production, which in turn can hybridize with FAM-DNA4 to form DNA5. Then, DNA5 leaves the surface of the GO giving an increase in fluorescence signal. Moreover, DNA5 is dsDNA hybridized by DNA4 and DNA3, and has five more bases than DNA4. Thus, on addition of Exo III, only FAM-DNA4 is digested and this leads to the release of DNA3. The released DNA3 again interacts with FAM-DNA4 on the surface of the GO to form a circular signal amplification pathway as shown. This is the second signal amplification. Thus, the two catalytic recycling processes by Exo III could, in theory, realize infinite amplification of fluorescence. In the presence of insulin, the aptamer reacts with insulin and thus cannot bind to sl-DNA1 to form sl-DNA2. As the aptamer-insulin complex is very stable, the addition of sl-DNA1, Exo III and GO with adsorbed FAM-DNA4 has no effect on the complex; therefore, fluorescence is not realized. Thus, through this strategy, the circulating signal
3.3. Viability of signal amplification To verify the viability of the experiment, two samples containing the same concentration of sl-DNA1, aptamer and Exo III in two sample tubes (S1, S2) were incubated at 37 °C for 20 min. and then inactivated at 70 °C, thus ensuring conditions for the two samples were the same for the first cycle. Then GO-FAM-DNA4 was added to S1 and GO-FAM-DNA4
Scheme 1. Schematic of the Exonuclease III aided amplification assay for insulin detection.
598
Talanta 199 (2019) 596–602
C. Liu, et al.
Fig. 2. Fluorescence spectra for signal amplification (Fluorescence intensity at 521 nm): (a) Signal response in the presence of Exonuclease III (the second cycle includes the action of Exonuclease III); (b) Signal response in the absence of Exonuclease III (there is no Exonuclease III in the second cycle).
3.4. Small signal amplification The first small cycle is the key to the whole experiment, the Exo III does not work, and the latter experiment cannot be performed, so the amount of enzyme used is critical. There is no fluorescence change in the microcirculation, so we can separate the samples by agarose gel electrophoresis, obtain electrophoresis diagram, and determine the concentration of Exo III. The DNA molecule in agarose gel swimming sometimes charge effect and the effect of the molecular sieve, and the separation of charged particles depends on the molecular size, so the size of different molecular weight DNA, ran out of the stripe distance are also different, determine the type of DNA by the distance of the stripe, and observe whether DNA3 production and sl-DNA2 consumption to determine the amount of enzyme. As shown in Fig. 3 (A) (from left to right), in connection with movement of the DNA band, which is of relatively low molecular weight, runs, the aptamer has a blurred band and is at a lower position than that of sl-DNA1, because the aptamer has more bases than sl-DNA1; for instance, aptamer+ sl-DNA1 displays two bands with one strip having moved further while the other strip is at the same position as slDNA1. This indicates that the aptamer combined with sl-DNA1 to form sl-DNA2, and that the aptamer was consumed while sl-DNA1 was in excess. In the fourth lane, where 8 U of Exo III was added to the mixture of the adaptor and sl-DNA1, sl-DNA1 and sl-DNA2 were consumed, resulting in DNA3 bands (lane 4 and lane 5), and more Exo III (20U) strips to make them darker. Thus the five groups of experiments were compared to find the optimal shear enzyme concentration. As shown in Fig. 3 (B), in the second and third lanes, in addition to the DNA3 bands, there were also blurred bands for sl-DNA2. This indicated that the amount of enzyme used was too small and the reaction was incomplete. The sl-DNA2 bands in lane 4 were barely visible, while sl-DNA2 in lane 5 was not visible and the DNA3 band was the most intense. This indicates that the reaction had been optimized in terms of the reaction conditions for an enzyme dosage of 8 U.
Fig. 1. Fluorescence response as a function of graphene oxide concentration: (A) Fluorescence spectra (From a to g: 0, 0.017, 0.018, 0.021, 0.025, 0.033, 0.0375 g/l); (B) Quenching efficiency for various amounts of graphene oxide; (C) Optimization of quenching time.
and 20 U of Exo III were added to S2. The two samples were then incubated at 37 °C for 30 min, and inactivated at 70 °C. The fluorescence spectra were then measured and the results are shown in Fig. 2. In the case of curve (a), the second cycle included the action of Exo III while for curve (b) Exo III was not involved in the second cycle. It can be seen that the fluorescence intensity recorded for the second cycle through the action of Exo III was increased by about fifty percent compared to the experiment without Exo III. Also from inspection of curve (e) in Fig. 1 (A) and curve (b) in Fig. 2, it can be seen that the fluorescence intensity increased only when the enzyme had a role in the first cycle to produce DNA3. This demonstrates that enzymes play a key role in the whole signal amplification system, thus confirming the viability of the scheme.
3.5. Optimization of the concentration of Exo III To control the amount of Exo III in the second cycle, different concentrations of Exo III were added to observe the fluorescence intensity after the reaction, which resulted in different fluorescence recoveries. The results are shown in Fig. 4. Addition of Exo III resulted in digestion of the fluorophore-modified strand in DNA5 along the 3′ end to give ss-DNA3 and the fluorophore. DNA3 became bound to FAM599
Talanta 199 (2019) 596–602
C. Liu, et al.
Fig. 3. Gel electrophoresis of samples (Voltage: 90 V Current: 396 mA): (A) From left to right, lane 1: aptamer, lane 2: sl-DNA1, lane 3: aptamer+ sl-DNA1, lane 4: aptamer+ sl-DNA1 +8U Exo III, lane 5: aptamer+ sl-DNA1 + 20 U Exo III; (B) From left to right, lane 1: aptamer+ sl-DNA1, lane 2: aptamer+ sl-DNA1 + 2 U Exo III, lane 3: aptamer+ sl-DNA1 + 4 U Exo III, lane 4: aptamer+ sl-DNA1 + 6 U Exo III, lane 5: aptamer+ sl-DNA1 + 8 U Exo III.
Fig. 5. Percentage fluorescence recovery values at various Exonuclease III concentrations.
was chosen as the most appropriate concentration for the enzyme in the second cycle. 3.6. Signal amplification and quantitation of insulin To obtain the standard curve for insulin, 90 U of Exo III was used together with different concentrations of insulin to check on the fluorescence recovery levels. As stated previously, with addition of insulin, sl-DNA1 cannot react with the aptamer, be digested by the enzyme, and generate DNA3; hence the amplification cycle cannot proceed. As shown in Fig. 6 (A), the fluorescence intensity responses decreased progressively for increasing additions (0.048, 0.198, 0.483, 0.676, 0.965 U/ml insulin) of insulin. Since the fluorescence signal after the addition of 0.198 U/ml insulin could not be distinguished from the fluorescence signal of 0.048 U/ml, the detection limit of the detection platform was 0.048 U/ml. In the abstract, the fluorescence recovery intensity will not be lower than g line. △F= line a – line g= 874.117 = 266.88034 × + 299.6488, so x = 2.15U/ml. The standard, as shown in Fig. 6 (B), was linear (equation: y = 266.88034 ×+ 299.6488) with a detection range of 0.048–12.8μmol/l. Correlation coefficient R= 0.99172, it shows that the two variables have a strong linear correlation. The above fluorescence data confirm that the detection scheme based on Exo III dual amplification and GO fluorescence quenching provides a viable approach to the determination of insulin.
Fig. 4. (A) Fluorescence spectra for different concentrations of Exo III added to the circulation system to restore the different fluorescence intensities (From a to h: FAM-DNA4, 90, 80, 70, 60, 40, 0 U Exo III, GO+FAM-DNA4). (B) The fluorescence intensity of the samples at 520 nm wavelength.
DNA4 on GO, which then separated from GO to form ds-DNA5. Therefore, within a specific concentration range, the greater the enzyme concentration, the higher the fluorescence intensity. Based on fluorescence recovery values of 0, 40, 60, 70, 80, and 90 U relative to the amount of fluorescence quenched, the percentage fluorescence recovery values obtained are indicated in Fig. 5. The percentage fluorescence recovery values at 0, 40, 60, 70, and 80 u were 12.2%, 21.8%, 37.8%, 45.5%, and 60.4%, respectively. For an enzyme concentration of 90 U; the fluorescence recovery value reached 70%. However, for enzyme concentrations greater than 80 U, the rate of increase in fluorescence started to decline; therefore, 90 U 600
Talanta 199 (2019) 596–602
C. Liu, et al.
Fig. 6. (A) Fluorescence spectra as a function of Insulin concentration (a to g: sensor system base line, 0.048, 0.198, 0.483, 0.676, 0.965 U/ml insulin, 30 μl GO+1 μl FAM-DNA4); (B) Standard curve for insulin.
3.7. Selectivity of insulin detection In order to investigate the selectivity of biosensors, we selected Bovine serum albumin, Thrombin, and VEGF with the same insulin concentration as in Fig. 6(g) under the same conditions. (Fluorescence intensity at 521 nm) As shown in Fig. 7, the ratio of quenching fluorescence intensity of BSA, Thrombin, VEGF and Insulin is 2.44: 1: 1.33: 5.33. The degree of fluorescence quenching of insulin is significantly different from that of other proteins. Therefore, this method has a good selectivity specificity for insulin. 3.8. Analysis of insulin in real samples In order to evaluate the feasibility and reliability of the sensing system in practical applications, insulin was added to buffer-diluted fetal bovine serum, and the fluorescence intensity was measured by this experimental method. As shown in Fig. 8, the real sample has a smaller slope than the standard curve of the experimental sample. In a serum environment, the sensitivity of the sensor becomes higher, the fluorescence intensity of the same concentration of insulin quenching becomes smaller, and the measurable range increases, which is the same as the trend of the standard curve obtained in the buffer. The sensing system can be applied to real samples with good sensitivity.
Fig. 8. Comparison of standard curve of experimental samples and real samples (Red line: in buffer; black line: in serum).
4. Conclusions A novel insulin detection platform, based on Exo III dual-cycle signal amplification with GO quenching, has been developed. The sensor platforms achieved multiple signal amplification with Exo III and GO providing rapid and sensitive detection of insulin with a detection range of 0.048–2.15 U/ml. A feature of the method is that no specific recognition sequence is required for the enzymatic hydrolysis compared to traditional immunoassay-based methods. The present design affords rapid, precise and sensitive detection of insulin with good selectivity. On the basis of these initial studies, it is projected that the approach has potential application in the clinic and also prospects for detection of other protein molecules by replacement of the adaptor/target species moieties. The graphene oxide used in the experiment has good biocompatibility, and the size of graphene oxide of 10–800 nm is relatively stable in the human blood environment. Therefore, the detection platform in the prediction experiment can be applied to the determination of insulin in human blood samples. Acknowledgments This work was financially supported by the National Natural Science Foundation of China (Grant No. 21763009, 21404028), and Graduate Students Innovation Research Project of Hainan Province (Hys2018-59, Hys2018-60).
Fig. 7. Selectivity of the assay for insulin over other control proteins: BSA, Thrombin, VEGF (each at 0.965 U/ml). 601
Talanta 199 (2019) 596–602
C. Liu, et al.
References
carbon nanotube induced quenching, Chem. Commun. 48 (2) (2012) 269–271. [12] M. Zhang, Y.M. Guan, B.C. Ye, Ultrasensitive fluorescence polarization DNA detection by target assisted exonuclease III-catalyzed signal amplification, Chem. Commun. 47 (12) (2011) 3478–3480. [13] H. Wu, R. Liu, X. Kang, C. Liang, L. Lv, Z. Guo, Fluorometric aptamer assay for ochratoxin A based on the use of single walled carbon nanohorns and exonuclease III-aided amplification, MikrochimActa 185 (1) (2017) 27. [14] Y. He, B. Jiao, Detection of biotin-streptavidin interactions based on poly(thymine)templated copper nanoparticles coupled with Exo III-aided DNA recycling amplification, Sens. Actuators B: Chem. 265 (2018) 387–393. [15] Q. Xue, Y. Lv, H. Cui, X. Gu, S. Zhang, J. Liu, A. DNA, nanomachine based on rolling circle amplification-bridged two-stage exonuclease III-assisted recycling strategy for label-free multi-amplified biosensing of nucleic acid, Anal. Chim. Acta 856 (2015) 103–109. [16] S.S. Nanda, G.C. Papaefthymiou, D.K. Yi, Functionalization of graphene oxide and its biomedical applications, Crit. Rev. Solid State Mater. Sci. 40 (5) (2015) 291–315. [17] S. Stankovich, D.A. Dikin, G.H. Dommett, K.M. Kohlhaas, E.J. Zimney, E.A. Stach, R.D. Piner, S.T. Nguyen, R.S. Ruoff, Graphene-based composite materials, Nature 442 (7100) (2006) 282–286. [18] Y. Wang, Z. Li, J. Wang, J. Li, Y. Lin, Graphene and graphene oxide: biofunctionalization and applications in biotechnology, Trends Biotechnol. 29 (5) (2011) 205–212. [19] L. Lv, C. Cui, C. Liang, Aptamer-based single-walled carbon nanohorn sensors for ochratoxin A detection, Food Control (2015) 296–301. [20] Y. Zhao, R. Liu, W. Sun, L. Lv, Z. Guo, Ochratoxin A detection platform based on signal amplification by Exonuclease III and fluorescence quenching by gold nanoparticles, Sens. Actuators B: Chem. 255 (2018) 1640–1645. [21] L. Wang, J. Zhang, X. Wang, Gold nanoparticlebased optical probes for target-responsive DNA structures, Gold Bull. (2008) 37–41. [22] S.M. Taghdisi, N.M. Danesh, P. Lavaee, A. Sarreshtehdar Emrani, M. Ramezani, K. Abnous, Aptamer biosensor for selective and rapid determination of insulin, Anal. Lett. 48 (4) (2014) 672–681.
[1] Y. Pu, Z. Zhu, D. Han, H. Liu, J. Liu, J. Liao, K. Zhang, W. Tan, Insulin-binding aptamer-conjugated graphene oxide for insulin detection, Analyst 136 (20) (2011) 4138–4140. [2] T.L. van Belle, K.T. Coppieters, M.G. von Herrath, Type 1 diabetes: etiology, immunology, and therapeutic strategies, Physiol. Rev. 91 (1) (2011) 79–118. [3] C. Patterson, L. Guariguata, G. Dahlquist, G. Soltesz, G. Ogle, M. Silink, Diabetes in the young - a global view and worldwide estimates of numbers of children with type 1 diabetes, Diabetes Res. Clin. Pract. 103 (2) (2014) 161–175. [4] B. Preethi, G. Jaisri, K.M. Prasanna Kumar, Assessment of insulin resistance in normoglycemic young adults, Hum. Physiol. (2010) 118–125. [5] I. Kubo, T. Eguchi, Study on electrochemical insulin sensing utilizing a DNA aptamer-immobilized gold electrode, Materials 8 (8) (2015) 4710–4719. [6] A. Verdian-Doghaei, M.R. Housaindokht, Spectroscopic study of the interaction of insulin and its aptamer – sensitive optical detection of insulin, J. Lumin. 159 (2015) 1–8. [7] C. Hess, A. Thomas, M. Thevis, B. Stratmann, W. Quester, D. Tschoepe, B. Madea, F. Musshoff, Simultaneous determination and validated quantification of human insulin and its synthetic analogues in human blood serum by immunoaffinity purification and liquid chromatography-mass spectrometry, Anal. Bioanal. Chem. 404 (6–7) (2012) 1813–1822. [8] Y. Xiong, C. Deng, X. Zhang, P. Yang, Designed synthesis of aptamer-immobilized magnetic mesoporous silica/Au nanocomposites for highly selective enrichment and detection of insulin, ACS Appl. Mater. Interfaces 7 (16) (2015) 8451–8456. [9] Y. Tang, M. Liu, L. Xu, J. Tian, X. Yang, Y. Zhao, S. Zhao, A simple and rapid dualcycle amplification strategy for microRNA based on graphene oxide and exonuclease III-assisted fluorescence recovery, Anal. Methods 10 (30) (2018) 3777–3782. [10] C. Chen, J. Zhao, J. Jiang, R. Yu, A novel exonuclease III-aided amplification assay for lysozyme based on graphene oxide platform, Talanta 101 (2012) 357–361. [11] H. Chen, J. Wang, G. Liang, P. Zhang, J. Kong, A novel exonuclease III aided amplification method for sensitive nucleic acid detection based on single walled
602