Novel gene isolated from Caligus rogercresseyi: A promising target for vaccine development against sea lice

Vaccine 29 (2011) 2810–2820

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Novel gene isolated from Caligus rogercresseyi: A promising target for vaccine development against sea lice Yamila Carpio a , Liliana Basabe a , Jannel Acosta a , Alina Rodríguez a , Adriana Mendoza b , Angélica Lisperger b , Eugenio Zamorano c , Margarita González c , Mario Rivas c , Sergio Contreras c , Denise Haussmann d , Jaime Figueroa d , Verónica N. Osorio e , Gladys Asencio e , Jorge Mancilla b , Gordon Ritchie f , Carlos Borroto a , Mario Pablo Estrada a,∗ a

Animal Biotechnology Division, Center for Genetic Engineering and Biotechnology, Havana 10600, Cuba Marine Harvest, Chile c Instituto de Fomento Pesquero, Chile d Universidad Austral, Chile e Universidad de los Lagos, Chile f Marine Harvest ASA, Norway b

a r t i c l e

i n f o

Article history: Received 26 November 2010 Received in revised form 27 January 2011 Accepted 28 January 2011 Available online 12 February 2011 Keywords: Akirin Caligus my32 Salmonids Sea lice Vaccine

a b s t r a c t Sea lice (Copepoda, Caligidae) are the most widely distributed marine pathogens in the salmon industry in the last 30 years. Caligus rogercresseyi is the most important species affecting Chile’s salmon industry. Vaccines against caligid copepods have the potential to be a cost-effective means of controlling the infestation and avoid many of the disadvantages of medicine treatments. However, research in the development of such vaccines has begun only recently and approaches used thus far have met with little or no success. In the present study, we characterized a novel gene (denoted as my32) from C. rogercresseyi which has the highest identity with the Lepeophtheirus salmonis gene akirin-2. To assess the function of the gene an RNA interference experiment was developed and a reduction in the number of ectoparasites on fish in the my32-dsRNA treated group was observed. The recombinant my32 protein was used in a vaccinationchallenge trial to evaluate its ability to protect against sea lice infestations. A significant reduction in the number of parasites per fish was observed at 24 days post-challenge. These results, together with the delay observed in the development of parasites from the vaccinated group suggest that the major effect of immunization was on the second parasite generation. The results of these experiments suggest that the my32 protein may be a promising target for vaccine development to control sea lice infestations in fish. © 2011 Elsevier Ltd. All rights reserved.

1. Introduction Sea lice (Copepoda, Caligidae) are the most widely distributed marine pathogens in the salmon industry in the last 30 years. During the last 15 years of that period, they also spread to other cultured species and to wild salmonid populations. There are three major genera of sea lice: Pseudocaligus, Caligus and Lepeophtheirus [1]. Considering salmon production throughout northern hemisphere, one of these species, the salmon louse Lepeophtheirus salmonis, is responsible for the main disease outbreaks on salmon farms. In 2004 alone, this parasite was responsible for direct and

∗ Corresponding author. Tel.: +53 7 2716022x5154; fax: +53 7 2731779. E-mail address: [email protected] (M.P. Estrada). 0264-410X/$ – see front matter © 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2011.01.109

indirect losses in worldwide aquaculture, of $100 M USD [2]. In the southern hemisphere, Caligus rogercresseyi is the most important species affecting Chile’s salmon industry [2–5]. A wide range of medicines has been used to control sea lice infestations, e.g. hydrogen peroxide, organophosphates, ivermectin, emamectin benzoate, molting regulators and pyrethroids [6,7]. However, as only a few chemicals are currently available, the potential for lice to develop resistance is high and has been reported several times in both salmon louse and C. rogercresseyi [8–10]. This fact, together with the necessity of reducing costs and threats to the environment make the development of new approaches, such as vaccination, imperative. To date, there are no commercial vaccines available against sea lice. Vaccines against L. salmonis derived from whole extracts of sea lice were not protective since their administration resulted in only minor changes in L. salmonis fecundity [11]. The identification of

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

good vaccine targets for prevention and treatment of sea lice has not yet been successful, partly as a result of the limited existing knowledge about the mechanisms involved in the pathology of sea lice infestations in salmons. This difficulty handicaps the progress of research related to recombinant vaccine development. Parasite immunomodulatory proteins, trypsins, vitellogenin-like proteins and host adhesion proteins are some of the molecules studied as potential antigens [2,12,13]. In recent times, it was developed the RNA interference (RNAi) procedure for systemic gene silencing in the salmon louse larvae by immersion [14] or in adults by microinjection [15,16]. The methods developed allow studying the function of novel genes in the different stadia which made them very useful to potentiate the finding of new vaccine targets. Akirins constitute a recently renamed group of evolutionarily conserved proteins in insects and vertebrates that were proposed to function as transcription factors required for NF-k␤-dependent gene expression in Drosophila and mice [17]. Using RNAi gene knockdown and immunization trials with a recombinant protein, subolesin (the ortholog of akirin in ticks) was shown to protect hosts against tick infestations reducing tick survival and reproduction, causing degeneration of guts, salivary glands, reproductive tissues and embryos [18–21]. Recent evidence has also shown a reduction in the survival and/or fertility of mosquitoes, sand flies and poultry red mites fed in vitro with antibodies against the recombinant Aedes albopictus akirin [22,23]. Vaccination with recombinant A. albopictus akirin also reduced tick infestations [22,24]. The results suggest that these genes might be good candidates for vaccine development. Until now, the akirin-2 gene has not been characterized in crustaceans. Taking into account all this information, the aim of this study is to isolate a C. rogercresseyi novel gene using degenerated oligonucleotides based on protein sequences coding for akirin-2 from eight tick species and four insects. The present work also aims to characterize gene expression by RT-PCR and immunohistochemistry. To further assess its function, an RNAi experiment was developed. We also investigated the capacity of the recombinant my32 protein to protect Salmo salar against sea lice infestations in a vaccination-challenge trial. 2. Materials and methods 2.1. Biological material and RNA isolation Adult female C. rogercresseyi were collected with forceps from anaesthetized fish and stored in RNA-later (Ambion) at 25 ◦ C until RNA extraction. For RNA extraction, the RNA-later solution was discarded and the Tri-reagent (Promega) was added. Then, the tissue was homogenized by means of mortar and pestle. RNA isolation was performed according to the manufacturer’s instructions. Total RNA concentration and quality were determined by UV absorbance at 260 nm, the A260 /A280 ratio and by denaturing gel electrophoresis. Contaminating genomic DNA was eliminated by DNase I digestion (Invitrogen). 2.2. cDNA cloning of my32 Five micrograms of RNA was reverse-transcribed into cDNA using Reverse Transcription System (Promega), according to the manufacturer’s instructions. The primers used to obtain the cDNA sequence of my32 are described in Table 1. Six degenerate primers (equivalent to 8 different combinations) were designed from highly conserved regions in other akirin genes found in the GenBank database (http://www.ncbi.nlm.nih.gov). The analysis for primer design included the protein sequences from

2811

eight tick species and four insects, (i) ticks: (a) Ixodes scapularis (GenBank EEC18158), (b) Ixodes ricinus (GenBank ABA62325), (c) Rhipicephalus sanguineus (GenBank ABA62332), (d) Rhipicephalus microplus (GenBank ABA62330), (e) Dermacentor variabilis (GenBank AAV67034), (f) Haemaphysalis qinghaiensis (GenBank ACA09712), (g) Amblyoma americanum (GenBank ABA62326) and (h) Hyaloma marginatum (GenBank ABA62335); (ii) insects: (a) Apis mellifera (GenBank XP 395252), (b) Drosophila pseudoobscura (GenBank EAL30734), (c) Drosophila melanogaster (GenBank AAN12062) and (d) Aedes aegypti (GenBank XP 001662294). PCR amplifications using the above degenerate primers were performed under the following conditions: initial denaturation at 95 ◦ C for 2 min, 35 amplification cycles (denaturing at 95 ◦ C for 30 s, annealing temperature at 42 ◦ C for 30 s and extension at 72 ◦ C for 1 min), and a final extension step at 72 ◦ C for 5 min. Master Mix PCR (Promega) was used for amplifications. The PCR products were separated using 0.8% agarose gel electrophoresis, and purified from gel slices using a QIAquick Gel Extraction mini kit (Qiagen). The purified PCR products were cloned into pGEM-Teasy vector (Promega) following the manufacturer’s instructions and the recombinant plasmids was isolated using the Minipreps DNA purification system (Promega). The nucleotide sequences were then determined by the standard dye terminator chemistry using the Big Dye Terminator v.3.1 Cycle Sequencing kit (Applied Biosystems) in an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). The ClustalW software (http://www.ebi.ac.uk/Tools/msa/ clustalw2) was used for the alignment of the deduced amino acid sequences. Analysis of protein structure was done by the PredictProtein server (http://www.predictprotein.org) [25]. Protein topology was analyzed using TMpred and TMHMM v.2.0 algorithms for the prediction of transmembrane helices in proteins [26,27]. The TargetP v.1.01 algorithm was used to predict the localization of protein in cells [28]. 2.3. Transcription profiling by RT-PCR For this analysis, the different developmental stages were sampled: nauplius and copepodids (n ∼ 1000 each one), chalimus I–IV (n ∼ 100), male, females and eggs (n ∼ 50 each one). The my32 transcription profile was determined by RT-PCR using ˇ-actin as a reference gene. Specific-gene primers (Fmy-Rmy) (Table 1) were designed according to the my32 sequence obtained in this study to amplify a 422 bp fragment. The primers for ˇ-actin amplification (Fact-Ract) (Table 1) were designed based on C. rogercresseyi ˇ-actin cDNA (GenBank BT076643) and used to amplify a 493 bp fragment. PCR amplifications using the my32 and actin specific primers were performed under the following conditions: initial denaturation at 95 ◦ C for 2 min, 40 amplification cycles (denaturing at 95 ◦ C for 30 s, annealing temperature at 57 ◦ C, and extension at 72 ◦ C for 1 min), and a final extension step at 72 ◦ C for 5 min. Master Mix PCR (Promega) was used for amplifications. The PCR products were separated using 0.8% agarose gel electrophoresis. 2.4. Production and characterization of the my32 2.4.1. Cloning and expression in Escherichia coli For expression of my32 cDNAs in E. coli, the coding region was amplified from plasmid DNA by PCR using specific primers (pETFmy-pETRmy) (Table 1). These primers contain Nco I and Xho I restriction sites to insert the amplified fragments into the corresponding cloning sites in the pET28a expression vector (Novagen). The final vector (pET28a-my32) was tested by restriction endonuclease site analysis and DNA sequencing. In this construct, the inserted gene was under the control of the inducible T7 promoter and yielded the polypeptide with a C-terminal fusion His tail.

2812

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

Table 1 Degenerate and specific primers used to amplify Caligus rogercresseyi my32 and actin. Primers

Sequence 5 –3 a

bp

Direction

degFmy1 degFmy2 degFmy3 degFmy4 degRmy5 degRmy5 Fmy Rmy Fact Ract pET-Fmy pET-Rmy qFmy qRmy qFact qRact

ATGGC(T/C)TG(T/C)GC(T/C/G/A)AC(T/C/A/G)(T/C)T(T/C)AA(A/G) ATGGC(T/C)TG(T/C)GC(T/C/G/A)AC(T/C/A/G)(T/C)T(A/G)AA(A/G) ATGGC(G/A)TG(T/C)GC(T/C/G/A)AC(T/C/A/G)(T/C)T(T/C)AA(A/G) ATGGC(G/A)TG(T/C)GC(T/C/G/A)AC(T/C/A/G)(T/C)T(A/G)AA(A/G) TT(A/C)AC(A/G)AA(A/C/G/T)G(T/C)(A/G)TC(A/G)TA(C/T)TG(C/T)TC TT(G/T)AC(A/G)AA(A/C/G/T)G(T/C)(A/G)TC(A/G)TA(C/T)TG(C/T)TC GGCTTCACCAACACATTCACAAAG AGCTTTTGATGGAGGATCTTATCGTAC CTCTCCCCCACGCCATTCTTCG TCAGGGGGAGCAATAATCTTGATC CCATGGCTTGCGCGACGTTG CTCGAGAACAAAGGCGTCGTATTGT ACTTTGACCCCCTTCACTCC AAGGAGACTCACGGAACACG GTAGCCCTGGACTTTGAGCA CCTAGGAAGGAAGGCTGGAA

21 21 21 21 23 23 24 27 22 24 20 25 20 20 20 20

Forward Forward Forward Forward Reverse Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

a

Restriction endonuclease sites are underlined; nucleotide degenerations are in parenthesis.

For expression of the recombinant polypeptide, the pET28amy32 expression plasmid was transformed into E. coli BL21(DE3). Single clones of BL21(DE3) transformed with pET28a-my32 and pET28a plasmids, respectively, were grown overnight at 37 ◦ C in Luria Bertani (LB) medium containing 50 ␮g/mL of kanamycin. Cultures were then diluted (1:20) in fresh LB medium and grown at 37 ◦ C until the OD600 reached approximately 0.5. The expression of recombinant proteins was initiated by the addition of isopropyl-␤d-thiogalactoside (IPTG) (Sigma) to a final concentration of 0.5 mM and incubation continued during 5 h for induction of recombinant protein expression. After induction, the bacterial cells were harvested by centrifugation at 10,000 × g for 10 min at 4 ◦ C. The inclusion bodies were purified as described by Promdonkoy et al. [29]. 2.4.2. Protein purification The cell pellet was resuspended in 100 mM NaH2 PO4 , 10 mM Tris–HCl pH 8 containing 8 M urea and left for 1 h at 37 ◦ C. Afterward, the lysate was clarified by centrifugation at 10,000 × g for 10 min at 4 ◦ C. The affinity chromatography was performed under denaturing conditions employing Ni-NTA resin (Qiagen) according the manufacturer’s instructions. Briefly, the clarified lysate was loaded into the column. Then, two washes with 4 bed-volume of 100 mM NaH2 PO4 , 10 mM Tris–HCl pH 6.2, 8 M urea were performed. Protein elution was done 4 times with 0.5 bed-volume of 100 mM NaH2 PO4 , 10 mM Tris–HCl pH 4.5, 8 M urea. Each fraction was checked by 15% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis under reducing conditions. For refolding, the my32 fraction purified by affinity chromatography was dialyzed in a number of steps, ending with 100 mM NaH2 PO4 , 10 mM Tris–HCl, pH 5.5. The purity of recombinant proteins was assayed by densitometry scanning of protein gels. 2.4.3. Protein gel electrophoresis and Western blot analysis Expression and purification of the recombinant protein was confirmed by SDS–PAGE and immunoblotting. Protein samples were loaded on 15% polyacrylamide gels that were stained with Coomassie Brilliant Blue or transferred to nitrocellulose membranes. Membranes were blocked with 5% skim milk for 60 min at 25 ◦ C. Western blot analysis was performed using anti-His monoclonal antibody (Sigma) for detection of recombinant fusion my32 or specific rabbit serum. The rabbit serum was prepared in New Zealand White rabbits that were immunized subcutaneously with three doses (weeks 0, 3 and 7) containing 100 ␮g of purified my32 per dose in Freund’s complete adjuvant (Sigma) at week 0 and 200 ␮g of purified my32 per dose in Freund’s incomplete adjuvant

(Sigma) at weeks 3 and 7. After washing with PBS (16 mM Na2 HPO4 , 4 mM NaH2 PO4 , 120 mM NaCl, pH 7.4) plus 0.05% Tween 20 (PBST) once and with PBS twice, the membrane was incubated with a 1:5000 dilution of anti-rabbit polyclonal antibody HRP conjugate (Amersham Biosciences) as secondary antibody, with gentle shaking for 1 h at 25 ◦ C. Chromogenic detection was carried out using 3,3 -diaminobenzidine as an HRP detection substrate. 2.4.4. Mass spectrometry analysis of the secreted recombinant protein The Coomassie Blue-stained protein band corresponding to recombinant my32 was treated with 250 mM ammonium bicarbonate in 50% acetonitrile (v/v). Gel bands were cut in 1 mm3 cubes and dehydrated with acetonitrile. Gels were rehydrated with 50 mM ammonium bicarbonate, containing 12.5 ng/1 L of trypsin, and incubated overnight at 37 ◦ C in a thermomixer (Millipore). Tryptic peptides from selected spots were obtained and processed as described by González et al. [30]. Data acquisition and processing were performed using Mass-Lynx v.3.5 (Micromass). The ESI-MS/MS spectra were manually interpreted and the sequences of the peptides were successfully aligned with the deduced amino acid sequence obtained from the ADNc, using the ClustalW software. 2.4.5. Immunohistochemistry of C. rogercresseyi tissue sections Adult C. rogercresseyi were fixed in 0.25 M of sucrose in Bouin solution and embedded in paraffin. Sections (3 ␮m) were prepared and mounted on microscope slides that were stored at 4 ◦ C. For immunohistochemistry studies, tissue sections were deparaffinized and dehydrated twice for 20 min in xylene, and 10 min in 100%, 95%, 90%, 80%, 70% and 50% ethanol series. Afterward, slides were incubated for 10 min in 3% H2 O2 in methanol and 5 min in PBS for 3 repetitions. The slides were incubated 90 min in blocking solution (1% bovine serum albumin (BSA), 5% skimmed milk, 0.3% Triton X-100) and then overnight with rabbit my32 antisera prepared as described previously. A preimmune rabbit serum was used as negative control. Later, three washing steps were performed with TNT (0.1 M Tris–HCl pH 7.5, 0.15 M NaCl, 0.05% Tween 20). Afterward, the LSAB + System-HRP (DAKO, Code K0690) was used: the reaction was incubated for 30 min with the BIOTINYLATED LINK UNIVERSAL, three washes with TNT was performed and they were incubated for 30 min with STREPTAVIDIN-HRP. After a further three washes with TNT, the reaction was developed after incubation with 1 mL of the substrate 3 ,3 -diaminobenzidine tetrahydrochloride (Sigma) 10 mg/mL and 15 ␮L of H2 O2 in 20 mL of PBS; followed by staining with hematoxylin for 1 min, incubation in sodium borate for 1 min and finally water. All incubations were done at 25 ◦ C.

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

For microscopic examination, the slides were mounted in Canada balsam. 2.4.6. Immunofluorescence of C. rogercresseyi tissue sections Animals and sections were prepared as above in xylene and ethanol series. Slides were fixed for 10 min in 4% paraformaldehyde in PBS. After two washing steps in PBS, they were incubated in blocking solution (1% BSA, 5% skim milk, 0.3% Triton X-100) for 1 h at 25 ◦ C. Afterward, the primary my32 antiserum was diluted 1:100 in blocking solution and incubated overnight at 25 ◦ C. After a further three washes with TNT, the slides were incubated for 1 h with Alexa 488 conjugated goat-anti rabbit antibody (Molecular probes, Invitrogen) diluted 1:500 as a secondary antibody. After a further three washes with TNT, the samples were mounted in fluorescence mounting medium (DAKO, Code S3023). Fluorescence imaging was performed with an OLYMPUS BX51 microscope. 2.5. my32 knock down by RNAi 2.5.1. dsRNA synthesis Single-stranded RNAs were produced from opposing strands of a 579 bp my32 cDNA introduced into pGEM-Teasy vector (Promega), by in vitro transcription using the Ribo-MAX Large Scale RNA Production Systems (Promega). Prior to in vitro transcription the plasmid DNA was linearized and purified with a QIAGEN gel extraction kit (Qiagen). Afterward, the reaction mixture was treated with RNase free DNase I, to remove the DNA template. Then, the mixture was extracted once with phenol/chloroform and once with chloroform. The RNA was precipitated with 2-propanol and dissolved in RNase-free water. Single-stranded RNAs were allowed to anneal by mixing equal amounts of each strand, heating to 100 ◦ C for 1 min, and cooling gradually to 25 ◦ C for 3–4 h. Single-stranded RNAs and the annealed RNA (dsRNA) were checked on denaturing agarose gels. To produce a non-target dsRNA to use as a control, a 800 bp LacZ dsRNA was also generated by in vitro transcription. 2.5.2. Protocol of dsRNA soaking for copepodids As the copepodid stage is too small and fragile for microinjection, they were soaked in dsRNA to achieve gene silencing according the protocol proposed by Campbell et al. [14] with some modifications. Copepodids (500 individuals) were removed from aerated beakers and placed in two 1 mL microfuge tubes (250 each one) in sterile sea water along with 0.1 ␮g/␮L of either my32-dsRNA or LacZ-dsRNA and left at 12 ◦ C for 5 h. After that, lice were then removed and placed into 100 mL of aerated sea water in universal tubes and kept for 2 h at 12 ◦ C for recovery. After this time period, live parasites (positive phototaxis, active migration toward a source of light) from each group were counted and 100 copepodids was added to 50 L tanks. Each tank contained three Eleginops maclovinus (Chilean rock cod), one of the natural C. rogercresseyi hosts, with an average weight of 136 g. Five days after experimental infestation, fish was anesthetized and the parasites were counted. In parallel, to quantify gene silencing, two replicas per group of 100 individuals in the same conditions were settled and after 5 h, total RNA was extracted using a Mini RNA Isolation II Kit (Zymo Research). After DNase-treatment and reverse transcription, quantitative real time PCR was carried out on cDNA from either my32-dsRNA or LacZ-dsRNA treated samples. Samples were analyzed using specific primers for my32 (qFmy-qRmy) which amplified a 150 bp fragment (Table 1). C. rogercresseyi ␤-actin was included as a control and used for normalization. A 149 bp was amplified using specific primers qFact and qRact (Table 1). Realtime PCRs were performed in 12.5 ␮L using the Quantitect SYBR green PCR kit in accordance with the manufacturer’s protocol (Qia-

2813

gen) on a Rotor-gene 3000 real-time detection system (Corbett Life Sciences). Real-time PCR data were analyzed by Rotor-gene 6000 series software version 1.7. Control reactions were performed using the same procedures but without RT as control for DNA contamination in the RNA preparations and without cDNA added, as control contamination of the PCR. All the amplifications were performed in triplicate. Standard curves (10, 102 , 103 , 104 , 105 , 106 , 107 molecules of linearized pGEM-Teasy vector containing the target) were performed for both, actin and my32 gene. Based on this curves, the total number of molecules were calculated for actin and my32 in my32-dsRNA and LacZ-dsRNA treated samples. Relative expression was determined as number of my32 molecules/number of actin molecules. 2.6. Challenge experiment 2.6.1. Experimental groups For the challenge experiment, S. salar with an average body weight of 80 g from a sanitary standards certified commercial stock was used. Fish were injected intraperitoneally with 150 ␮L of purified my32 formulated in oil adjuvant Montanide 888 Vg (Seppic) at the dose of 1 ␮g of my32 per gram of body weight (1 ␮g/g bw) (Vaccine group) or with 150 ␮L of PBS formulated in the same adjuvant (Placebo group). 2.6.2. Acclimatizing After 500 degree days, two groups of twenty-five salmons were placed into two 0.75 m3 glass-fiber tanks. They were kept in fresh water for 24 h. Salinity was increased first to 15 ppt and kept for 24 h. Afterward, the salinity was increase again to 30 ppt. They were kept at 30 ppt for 10 days in adaptation before receiving booster injection. Then, the water flow was re-established to 1–1.5 changes per hour. This water was flow-through natural sea water, filtered and UV sterilized. The temperature was maintained with electrical heaters. Fish were fed 1% of their average body weight with commercial feed twice a day. Physicochemical parameters (temperature, salinity and oxygen concentration) were recorded daily. 2.6.3. Booster administration Ten days after sea water transfer, fish were anesthetized using benzocaine (80 ␮g/mL) and received a booster consisting of 150 ␮L of 1 ␮g/g bw of my32 adjuvated in Montanide 888 Vg (Seppic). The control group was injected with PBS formulated in the same adjuvant. Before booster administration, fish were starved for 24 h. 2.6.4. Challenge Two weeks after booster administration, 2000 ± 200 copepodids were added to each tank. This day was defined as day 0 in the challenge experiment. The fish were kept in darkness with other physicochemical conditions according procedures suggested by Stone et al. [7] (average water temperature of 16.5 (14–19 ◦ C), salinity of 30 ppt and an oxygen concentration of 7.5–9.5 mg/L). The water flow was stopped after challenge. Every 48 h, the water was manually changed and filtered, first through 1400 ␮ to retain organic material and then 220 ␮ to avoid the loss of added copepodids. The filter contents were placed in a beaker and after decantation; the live copepodids were recovered and added back to the tank. These challenge conditions were maintained for 24 days. Fish feeding was performed twice a day at a rate of 0.3% of g bw. Sampling was performed at days 10 and 24 after copepodid addition and parasites were counted under the microscope. 2.7. Statistical analysis The statistical analyses were done using GraphPad Prism Statistical Software version 4.00.255 (GraphPad Software Inc., San Diego,

2814

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

Fig. 1. (A) Comparison of deduced amino acid sequences of Caligus rogercresseyi my32 and Lepeophtheirus salmonis akirin-2 (GenBank ADD38399; 58% identity without primer regions). Asterisk (*) indicates identical aminoacids. The sequences in boxes were the sequences used to design degenerate oligonucleotides. The sequence underlined is a predicted nuclear localization signal. (B) Expression of my32 mRNAs in C. rogercresseyi developmental stages and eggs. Upper panel: RT-PCR with specific primers for my32; lower panel: RT-PCR with specific primers for actin. C- No cDNA added as a control for contamination of the PCR. N: nauplius, C: copepodids, Ch: chalimus I–IV, AM: adult male, AF: adult female, OF: ovigerous female, E: eggs, MW: molecular weight marker.

California, USA). Data were expressed as mean ± standard deviation (S.D.). An unpaired two-tailed Student’s t-test was used to compare the two groups in the RNAi and vaccination trial experiments. A two-tailed Mann–Whitney test was performed in each developmental stage to compare vaccine and placebo groups. Treatments were considered to be significantly different if p < 0.05. 3. Results 3.1. Isolation of my32 cDNA A 579 bp cDNA was isolated from adult C. rogercresseyi (GenBank HM581682) by RT-PCR using degenerate primers based on arthropod sequences encoding akirin-2 proteins. A BLASTP search performed without including primer regions showed that my32 has the highest identity with an akirin-2 sequence from salmon

louse L. salmonis (GenBank ADD38399; 58% identity) (Fig. 1A) followed by other arthropod akirin-2 sequences: H. qinghaiensis (ACA09712; 38% identity), Haemaphysalis punctata (ABA62336; 38%), D. variabilis (AAV67034; 37%), I. scapularis (XP 002414493; 33%) and A. mellifera (XP 395252; 34%). The sequence identity with salmonid reported sequences was between 30 and 33% [Salmo trutta (ACV49715; 33%), S. salar (NP 001165957; 32%), Oncorhynchus mykiss (ACV49724; 30%)]. A nuclear localization signal (NLS) was predicted at position 74 of the deduced amino acid sequence by bioinformatics analysis (Fig. 1A). Preliminary analysis of protein structure suggested that my32 is an intracellular protein. 3.2. Expression of my32 cDNA in C. rogercresseyi developmental stages Expression of the gene encoding my32 was analyzed at the mRNA level by RT-PCR. Expression of my32 mRNA was detected in

Fig. 2. Recombinant expression in Escherichia coli, immune identification, and purification of the my32 from C. rogercresseyi. (A) SDS–PAGE 15%, (B) Western blot using anti-His monoclonal antibody (Sigma) and (C) Western blot using a polyclonal serum against my32 generated in rabbits (diluted 1/100). Lane 1: BL21(DE3), lane 2: BL21(DE3)-my32 cell extract, lane 3: recombinant my32 purified by affinity chromatography and lane 4: molecular weight marker.

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

2815

Fig. 3. ESI-MS/MS spectra and sequences of the peptides obtained after tryptic digestion of recombinant my32 polypeptide expressed in E. coli. (A) ESI-MS/MS spectra at m/z 539.80 (4+), (B) ESI-MS/MS spectra at m/z 649.60 (3+) and (C) peptide sequences.

all C. rogercresseyi developmental stages and eggs (Fig. 1B). To corroborate the quality of samples, actin was used as a reference gene (Fig. 1B). Control reactions were performed using the same procedures but without addition of the reverse transcriptase enzyme as control for DNA contamination in the RNA preparations (data not shown) and without cDNA added as control contamination of the PCR (Fig. 1B). 3.3. Recombinant expression of my32 in E. coli Target cDNA was amplified by PCR to be cloned into the pET28a expression vector. The correct insertion was corroborated through restriction endonuclease site and DNA sequencing analysis. The expression analysis of my32 by SDS–PAGE and Western blot showed two bands between 20 and 28 kDa in the lane corresponding to BL21(DE3)-pET28a-my32 E. coli cell extracts (Fig. 2). The estimated size based on amino acid sequence is 22 kDa. These bands

were absent in pTE28a-tranformed BL21(DE3) cells. The maximum level of expression of the target protein was observed 5 h after IPTG addition at 37 ◦ C. The presence of the histidine tag was corroborated using an anti-His monoclonal antibody (Fig. 2B). Rabbit immune sera were prepared with the purified recombinant protein. Rabbit sera specifically recognized my32 protein in induced E. coli protein extracts and in the purified protein preparation (Fig. 2C). Combined analysis of Western blots of extracts from induced E. coli and purified proteins with the anti-His monoclonal antibody and the rabbit immune sera indicated the presence of higher molecular weight proteins in the my32 fraction (Fig. 2B and C) that was also present in the PAGE (Fig. 2A), as well as lower molecular weight products. The higher molecular weight products corresponded in size to protein dimers and lower molecular weight polypeptides could represent degradation products. The recombinant my32 was detected in the pellet of broken BL21(DE3)-pET28a-my32 transformed E. coli cells. After the wash-

2816

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

Fig. 4. Localization of my32 by immunohistochemistry. (A) Hematoxilin-eosin staining (magnification 4×). (B, C, G, H) Immunohistochemistry developed after incubation with the substrate 3 ,3 -diaminobenzidine tetrahydrochloride (10×). (B, C) Ovaries (ov). (G, H) Mature oocytes (mo) and oviducts (o) in the genital segment. (B, G) Reacted with pre-immune rabbit serum. (C, H) Reacted with rabbit my32 antisera. (D–F) Immunofluorescence. (D) Reacted with pre-immune rabbit serum (4×). (E, F) Reacted with rabbit my32 antisera. (E) Mature female (4×), cuticle (c), (F) ovary (40×).

ing steps, the protein was solubilized in urea and purified by affinity chromatography under denaturing conditions. After purification, the purity of the recombinant protein was estimated to be ≥95% based on densitometry scanning of protein gels considering all products specifically recognized in Western blot analyses (Fig. 2). Bands between 20 and 28 kDa were sequenced by MS. Signals at m/z 539.80 (4+) and 649.60 (3+) were observed after tryptic digestion of my32 upper band. ESI-MS/MS analyses of these peptides are shown in Fig. 3A and B. Both spectra were manually analyzed and very reliable extracted sequences were used to confirm the identity of the characterized protein. The extracted peptide sequences corresponded to the N-terminal end of the my32 polypeptide. The lower band appears to be protein degraded at the N-terminus, since only the peptide of m/z 649.60 was detected. Fig. 3C shows all signals obtained and their respective sequences assigned by ESIMS/MS analysis. Differences between m/z observed and calculated were associated with the internal error of the mass spectrometer (below 50 ppm).

3.4. Characterization of protein expression in C. rogercresseyi adults by immunohistochemistry my32 protein expression was characterized in mature C. rogercresseyi females by immunohistochemistry. Positive signals were detected mostly in cuticle, ovaries, oviducts and mature oocytes in the genital segment (Fig. 4). Labeling was not seen in sections reacted with the negative control rabbit preimmune serum (Fig. 4). 3.5. RNA interference experiment To further assess the function of my32, we performed an RNAibased gene knock down technique. The procedure was carried out by soaking copepodids in sea water containing dsRNA. Five days after addition of the parasites, they were counted. Significantly fewer parasites were found in the my32-dsRNA treated group as compared to LacZ-dsRNA treated group (p < 0.05) (Fig. 5). After the 5 h of incubation with dsRNA, the parasites were screened by quantitative real time PCR to determine transcript lev-

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

2817

Table 2 Results of vaccination with recombinant my32 in Salmo salar and challenge with Caligus rogercresseyi. Sampling day post-challenge

Sample size

10

5

24

20

a b c d e f

Experimental groups

Average number of parasites per fishc

Placeboa Vaccineb Placeboa Vaccineb

13 23 37 16

± ± ± ±

3 5 10 7

Number of fish per groupd 25 25 20 20

Inhibition of infestatione – – – 57%

Statistical analysis p < 0.01f p < 0.0001f

Placebo: Salmo salar injected with PBS formulated in oil adjuvant Montanide 888 Vg (Seppic). Vaccine group: Salmo salar injected with purified my32 formulated in oil adjuvant Montanide 888 Vg (Seppic). Average number of parasites per fish ± standard deviation. Total number of fish at the time of sampling. Percent of inhibition of infestation calculated as (1 − T/C) × 100 (T: parasite number per fish in vaccinated group, C: parasite number per fish in placebo group). Statistical significant differences were determined using a two-tailed unpaired Student’s t-test.

Fig. 5. RNA interference experiment. Caligus rogercresseyi copepodids were incubated in sterile sea water along with 0.1 ␮g/␮L of either my32-dsRNA or LacZ-dsRNA and left at 12 ◦ C for 5 h. After 5 h, lice were removed and recovered in aerated seawater for 2 h. Then, 100 copepodids were added to 50 L tanks containing three Chilean rock cod in each group. Left axis: parasites per fish counted five days after the experimental infestation. Asterisk (*) denotes the difference compared with the LacZ-dsRNA immersed group is significant as determined by unpaired two tailed Student’s t-test (p < 0.05). Right axis: quantitative real time PCR was carried out using either my32-dsRNA or LacZ-dsRNA treated sample cDNA from 100 soaked lice in conjunction with primers specific for actin or my32. Relative expression was determined as number of my32 molecules/number of actin molecules. The graphic represents the average of two independent pools. The line indicates the reduction in my32 transcript.

els of my32. In accordance with the observation related to parasite number per fish, the average amount of my32 transcript normalized versus ˇ-actin, determined by two independent replicates, was 70% less in lice soaked in my32-dsRNA as compared to the LacZ-dsRNA treated group (Fig. 5).

Fig. 6. Percent of parasites at each developmental stage at (A) 10 days and (B) 24 days post-challenge, calculated for each fish as [(parasite in stage X) × 100/(total number of parasites)]. A two-tailed Mann–Whitney test was performed to compare experimental groups for each stage. Asterisks (***) indicates p < 0.001. Vaccine group: fish received my32 adjuvated in Montanide 888 (Vg). Placebo group: fish received PBS adjuvated in Montanide 888. AF: adult female, AM: adult male, C: copepodids, ChI: chalimus I, ChII: chalimus II, ChIII: chalimus III, ChIV: chalimus IV.

3.6. Challenge experiment 3.6.1. Level of infestation (number of parasites per fish) No fish mortalities were recorded after parasite addition. At day 10 post-challenge, 5 animals per group were anesthetized with benzocaine and sacrificed to count parasites under a microscope. More parasites were found in the vaccinated group as compared to the placebo (p < 0.01) (Table 2). At day 24 post-challenge, when the second parasite generation was produced based on the water temperature, all animals were anesthetized and sacrificed for parasite counts. The statistical analysis showed a significant decrease in the number of parasites in vaccinated fish (p < 0.0001) as compared to the placebo (Table 2). This result showed that the vaccination was effective against the second parasite generation.

3.6.2. Vaccination effect in sea louse life cycle At the sampling performed at day 10 post-challenge, a delay in the parasite development was observed in the vaccinated group as compared to the placebo (Fig. 6A), although no statistical differences were found, perhaps due to low sample size (N = 5). At sampling performed at day 24 post-challenge, the delay in the parasite development was sustained in the vaccinated group as compared to the placebo (Fig. 6B). In the second generation of parasites (at day 24), there are more chalimus II and III in placebo group as compared with vaccine group (p < 0.001). At the same time there are more adults from the first parasite generation in vaccinated group (p < 0.001) (Fig. 6B).

2818

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

4. Discussion In the early 1990s, the first vaccines inducing immunological protection in vertebrate hosts against ectoparasite infestations were developed and commercialized. The commercial vaccines, Gavac and TickGARD, contained the recombinant R. microplus (formerly Boophilus microplus) Bm86 gut antigen [31–34]. These vaccines reduce the number of engorging female ticks, their weight and reproductive capacity. Thus the greatest vaccine effect was the reduction of larval infestations in subsequent generations. Controlled field trials of vaccine in combination with acaricide treatments demonstrated that an integrated approach resulted in control of tick infestations while reducing the use of acaricides [34]. The feasibility of controlling sea lice infestations through immunization of hosts with sea lice antigens has not been demonstrated yet. Vaccines against the caligid copepods have the potential to be a cost-effective means of controlling the infestation and avoiding many of the disadvantages of medicine treatments. However, research toward such vaccines is at an early stage and approaches thus far have met with little or no success. Most strategies for sea lice vaccines have adopted methods used for vaccines against other ectoparasites but the assumption that arachnid and insect physiology are directly comparable with that of sea lice is not proven [35]. Here we have described a novel gene named my32 isolated from C. rogercresseyi using degenerate primers based on arthropod sequences encoding akirin-2 proteins. This oligonucleotide design was performed before the L. salmonis expressed sequence tag (GenBank ADD38399) was reported; thus this sequence was not included in the first alignments. The new gene has the highest identity with this akirin-2 sequence from salmon louse L. salmonis followed by other arthropods akirin-2 protein sequences. Akirins constitute a group of evolutionarily conserved proteins that were proposed to function as transcription factors required for NF-k␤-dependent gene expression in Drosophila and mice. The higher conserved regions are the putative C- and N-terminal domains. The predicted NLS found in the my32 protein sequence is in agreement with the fact that akirins are ubiquitously expressed nuclear proteins [17]. Prior to gaining this knowledge, tick subolesin or 4D8 was discovered as a tick protective antigen in I. scapularis [18]. Subolesin was shown by both, RNAi gene knockdown and immunization trials using the recombinant protein, to protect hosts against tick infestations by reducing tick survival and reproduction [19,20,36–39]. Lately, Galindo et al. [40] demonstrated that tick subolesin is an ortholog of insect and vertebrate akirins and suggested that these proteins may affect the expression of signal transduction and innate immune response genes as well as positive and negative transcriptional regulators. Additionally, recent results support the role of mosquito akirin as a protective antigen for the control of mosquito and sand fly infestations [22–24]. The presumed intracellular localization for my32 agrees also with the putative localization for 4D8 in ticks [36]. Immunization with intracellular proteins also has been proposed for use against other pathogens such as Trichophyton verrucosum [41] and Brucella melitensis [42]. All the above-mentioned evidence encourages further investigations on the use of recombinant akirin-2, alone or in combination with other antigens for the control of fish sea lice infestations. The my32 cDNA expression was corroborated in all C. rogercresseyi developmental stages. This result suggested that this gene is constitutively expressed throughout the life cycle. Similar results were obtained in Caenorhabditis elegans [43] and ticks [20]. The expression of this gene was detected as well in the eggs at the mRNA level and it was confirmed in the females’ ovaries, oviducts and eggs at the protein level by immunohistochemistry.

These findings suggest a role for this protein in reproduction. In ticks, the function of 4D8 was characterized by RNAi in five species and its critical role in oviposition was demonstrated through a reduction of over 90% in all the species studied [36]. The spermatogonia in the testes of the male ticks injected with 4D8 dsRNA were necrotic as compared with the controls and spermiophores were not observed. On the other hand, the ovaries from the 4D8 dsRNA injected ticks were underdeveloped, with no evidence of maturing oocytes [36]. my32 RNAi knockdown experiments in C. rogercresseyi adults should be carried out to evaluate whether similar damages to that observed in the tick reproductive tissues are produced. As the small size of lice at the copepodid stage made microinjection technically impractical, gene-silencing was achieved by “soaking” this stage in sea water and target dsRNA for 5 h. Recently, the feasibility of applying the RNAi technique by soaking to nauplius and copepodids of L. salmonis was demonstrated [14]. In the present work we achieved for the first time, gene knockdown by RNAi in a copepod species different from L. salmonis. As a result, a decrease was observed in my32 transcript and in the number of parasites per fish in the my32 treated group as compared to the control. The biological function of akirin-2 is not fully understood. Akirin is critically required during Drosophila, mice [17] and C. elegans embryonic development [43]. In ticks, after dsRNA injection, degeneration of gut, salivary glands and reproductive tissues was observed. Also, tick survival, weight and oviposition were significantly reduced [36]. Additionally, a decrease in the molting of tick larvae to nymphs was found in ticks that fed on mice immunized with 4D8 [20]. The detection of my32 in the sea lice cuticle suggests that this protein could be involved in the molting process also in these marine ectoparasites. The pleiotropic effects on tick organs of subolesin silencing, together with the high conservation of subolesin protein sequences among invertebrates and vertebrates organisms suggest a highly specialized and conserved biological function for 4D8, which affects different physiological processes. Thus, the disruption of these developmental processes regulated by my32 could explain the reduction of ectoparasite number per fish observed in my32-dsRNA treated group. The life cycle of C. rogercresseyi comprises eight developmental stages, three planktonic (nauplius I and II, copepodid) and five parasitic (chalimus I–IV and adults). There are no preadult stages. The life cycle depends on water temperature: at 10 ◦ C it is about 45 days and it is completed in 26 days at 15 ◦ C [44]. The duration of the challenge experiment was 24 days, in order to evaluate the progeny from the females of the first generation. The vaccination/challenge experiment with my32 recombinant protein showed more parasites in the vaccinated group at day 10 post-challenge. At day 24 post-challenge, a 57% inhibition of infestation was obtained in the vaccinated group. This result is similar to the 61% inhibition of tick infestation in mice after immunization with recombinant 4D8 [20]. The fish immunization produces a delay in the parasite development in agreement with the proposed functions of akirins as proteins involved in the control of critical developmental processes. The results obtained at day 10 post challenge were similar to those obtained by our research group previously in another challenge experiment (data not shown) and by Grayson et al. [11]. However, these authors did not provide a convincing explanation for this phenomenon. Thus, It will be necessary future studies to elucidate the real cause of these findings. The ability to vaccinate Atlantic salmon against sea lice would be of great value to salmon farmers but vaccination against ectoparasites is at an early stage. Vaccination offers many advantages over the administration of anti-sea-louse drugs. These advantages include sustained action and no withdrawal period or residual drugs within the flesh. A generic approach to the development

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

of effective vaccines against ectoparasites arthropods has been described previously [12,31,35]. The range of target antigens mentioned included a variety of components associated with the gut, parasite attachment, feeding, hormonal regulation and reproduction. Despite the difficulties associated with the design and performance of an effective challenge of fish with ectoparasites, the preliminary vaccination/challenge results reported in this paper suggest for first time that immunization against C. rogercresseyi akirin could be a feasible approach. In this case, the results obtained with the vaccine may be due to a combination of several factors such as inhibiting feeding, digestion, metabolism, immune response, tissue development and function, reproduction and embryo development. These speculations are based on the evidences obtained from other arthropods species related to akirin function [17–24] together with the results of protein expression analysis, RNAi and parasites development obtained in the present study. The work is continuing on the deeper characterization of my32 biological function in sea lice, salmon immune response in immunization trials against this protein and the dose–response effect after vaccination. The future of research on development of sea lice vaccines appears exciting, considering the new emerging technologies for gene discovery that facilitate the rapid identification of candidate vaccine antigens. In this context, this new vaccine candidate my32 would play a key role in future integrated sea lice control strategies in wild and cultivated fish. Acknowledgements The authors would like to thank Marine Harvest for providing financial support to develop this investigation. Additionally, we would like to thanks to Dr. John van der Meer (former President of PAMBA) for his valuable assistance and review of this manuscript, to Geraldine Larroquette and Soledad Villoreal and all the people from Marine Harvest Chile laboratory in Puerto Montt and to students of Professor Gladys Asencio for their precious help. References [1] Pike AW, Wadsworth SL. Sea lice on salmonids: their biology and control. Adv Parasitol 2000;44:233–7. [2] Johnson SC, Fast MD. Interactions between sea lice and their hosts. Symp Soc Exp Biol 2004:131–59. [3] Rozas M, Asencio G. Assessment of epidemiologic situation of Caligiasis in Chile: toward to effective control strategy. Salmo Ciencia, Instituto Tecnológico del Salmón 2007;2:43–59. [4] Costello MJ. The global economic cost of sea lice to the salmonid farming industry. J Fish Dis 2009;32:115–8. [5] Bravo S. The reproductive output of sea lice Caligus rogercresseyi under controlled conditions. Exp Parasitol 2010;125:51–4. [6] MacKinnon BM. Sea lice: a review. World Aquacult 1997;28:5–10. [7] Stone J, Sutherland IH, Sommerville C, Richards RH, Varma KJ. Commercial trials using emamectin benzoate to control sea lice Lepeophtheirus salmonis infestations in Atlantic salmon Salmo salar. Dis Aquat Organ 2000;41:141–9. [8] Denholm I, Devine GJ, Horsberg TE, Sevatdal S, Fallang A, Nolan DV, et al. Analysis and management of resistance to chemotherapeutants in salmon lice, Lepeophtheirus salmonis (Copepoda: Caligidae). Pest Manag Sci 2002;58:528–36. [9] Bravo S, Sevatdal S, Horsberg TE. Sensitivity assessment of Caligus rogercresseyi to emamectin benzoate in Chile. Aquaculture 2008;282:7–12. [10] Lees F, Baillie M, Gettinby G, Revie CW. Factors associated with changing efficacy of emamectin benzoate against infestations of Lepeophtheirus salmonis on Scottish salmon farms. J Fish Dis 2008;31:947–51. [11] Grayson TH, John RJ, Wadsworth S, Greaves K, Cox D, Roper J, et al. Immunization of Atlantic salmon against the salmon louse: identification of antigens and effects on louse fecundity. J Fish Biol 1995;47:85–94. [12] Boxaspen K. A review of the biology and genetics of sea lice. ICES J Mar Sci 2006;63:1304–16. [13] Eichner Ch, Frost P, Dysvik B, Jonassen I, Kristiansen B, Nilsen F. Salmon louse (Lepeophtheirus salmonis) transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis. BMC Genomics 2008;9:126.

2819

[14] Campbell EM, Pert CC, Bowman AS. RNA-interference methods for geneknockdown in the sea louse, Lepeophtheirus salmonis: studies on a putative prostaglandin E synthase. Parasitology 2009;136:867–74. [15] Dalvin S, Frost P, Biering E, Hamre LA, Eichner C, Krossøy B, et al. Functional characterization of the maternal yolk-associated protein (LsYAP) utilising systemic RNA interference in the salmon louse (Lepeophtheirus salmonis) (Crustacea: Copepoda). Int J Parasitol 2009;39:1407–15. [16] Eichner C, Malde K, Dalvin S, Skern-Mauritzen R, Nilsen F. Knockdown of the nuclear receptor LsRXR1 in salmon louse (Lepeophtheirus salmonis Krøyer 1837). In: Sea lice 2010 proceedings; 2010. p. 24. Available at: http://sealice2010.com/resources/SeaLice2010 abstract booklet.pdf. [17] Goto A, Matsushita K, Gesellchen V, El Chamy L, Kuttenkeuler D, Takeuchi O, et al. Akirins are highly conserved nuclear proteins required for NF-kB dependent gene expression in drosophila and mice. Nat Immunol 2008;9: 97–104. [18] Almazán C, Kocan KM, Bergman DK, García-García JC, Blouin EF, de la Fuente J. Identification of protective antigens for the control of Ixodes scapularis infestations using cDNA expression library immunization. Vaccine 2003;21:1492–501. [19] De la Fuente J, Almazán C, Blouin EF, Naranjo V, Kocan KM. RNA interference screening in ticks for identification of protective antigens. Parasitol Res 2005;96:137–41. [20] Almazán C, Blas-Machado U, Kocan KM, Yoshioka JH, Blouin EF, Mangold AJ, et al. Characterization of three Ixodes scapularis cDNAs protective against tick infestations. Vaccine 2005;23:4403–16. [21] Almazán C, Kocan KM, Blouin EF, de la Fuente J. Vaccination with recombinant tick antigens for the control of Ixodes scapularis adult infestations. Vaccine 2005;23:5294–8. [22] Canales M, Naranjo V, Almazán C, Molina R, Tsuruta SA, Szabó MPJ, et al. Conservation and immunogenicity of the mosquito ortholog of the tick-protective antigen, subolesin. Parasitol Res 2009;105:97–111. [23] Harrington D, Canales M, de la Fuente J, de Luna C, Robinson K, Guy J, et al. Immunisation with recombinant proteins subolesin and Bm86 for the control of Dermanyssus gallinae in poultry. Vaccine 2009;27:4056–63. [24] Canales M, Labruna MB, Soares JF, Prudencio CR, de la Fuente J. Protective efficacy of bacterial membranes containing surface-exposed BM95 antigenic peptides for the control of cattle tick infestations. Vaccine 2009;27: 7244–8. [25] Rost B, Yachdav G, Liu J. The predict protein server. Nucl Acids Res 2004;32:W321–6. [26] Hofmann K, Stoffel W. TMbase – a database of membrane spanning proteins segments. Biol Chem 1994;374:166. [27] Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 2001;305:567–80. [28] Emanuelsson O, Nielsen H, Brunak S, von Heijne G. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 2000;300:1005–16. [29] Promdonkoy B, Warit S, Panyim S. Production of a biologically active growth hormone from giant catfish (Pangasianodon gigas) in Escherichia coli. Biotechnol Lett 2004;26:649–53. [30] González LJ, Castellanos-Serra L, Badock V, Díaz M, Moro A, Perea S, et al. Identification of nuclear proteins of small cell lung cancer cell line H82: an improved procedure for the analysis of silver-stained proteins. Electrophoresis 2003;24:237–52. [31] Willadsen P. A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Anim Health Res Rev 2007;8:23–8. [32] Rand KN, Moore T, Sriskantha A, Spring K, Tellam R, Willadsen P, et al. Cloning and expression of a protective antigen from the cattle tick Boophilus microplus. Proc Natl Acad Sci USA 1989;86:9657–61. [33] Rodríguez M, Rubiera R, Montesinos R, Cremata JA, Falcón V, Sanchez G, et al. High level expression of the B. microplus Bm86 antigen in the yeast P. pastoris forming highly inmunogenic particles for cattle. J Biotechnol 1994;33: 135–46. [34] Rodríguez Valle M, Méndez L, Valdez M, Redondo M, Espinosa CM, Vargas M, et al. Integrated control of Boophilus microplus ticks in Cuba based on vaccination with the antitick vaccine Gavac. Exp Appl Acarol 2004;34:375–82. [35] Raynard RS, Bricknell IR, Billingsley PF, Nisbet AJ, Vigneau A, Sommerville C. Development of vaccines against sea lice. Pest Manag Sci 2002;58: 569–75. [36] de la Fuente J, Almazán C, Blas-Machado U, Naranjo V, Mangold AT, Blouin EF, et al. The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood digestion and reproduction. Vaccine 2006;24:4082–95. [37] de la Fuente J, Almazán C, Naranjo V, Blouin EF, Meyer JM, Tocan KM. Autocidal control of ticks by silencing of a single gene by RNA interference. Biochem Biophys Res Commun 2006;344:332–8. [38] Nijhof AM, Taoufik A, de la Fuente J, Kocan KM, de Vries E, Jongejan F. Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one host tick Boophilus microplus by RNA interference. Int J Parasitol 2007;37:653–62. [39] Kocan KM, Manzano-Roman R, de la Fuente J. Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA. Parasitol Res 2007;100:1411–5. [40] Galindo RC, Doncel-Pérez E, Zivkovic Z, Naranjo V, Gortazar Ch, Mangold AJ, et al. Tick subolesin is an ortholog of the akirins described in insects and vertebrales. Dev Comp Immunol 2008;33:612–7.

2820

Y. Carpio et al. / Vaccine 29 (2011) 2810–2820

[41] Elad D, Segal E. Immunogenicity in calves of a crude ribosomal fraction of Trichophyton verrucosum: a field trial. Vaccine 1995;13:83–7. [42] Cassataro J, Velikovsky CA, Giambartolomei GH, Estein S, Bruno L, Cloeckaert A, et al. Immunogenicity of the Brucella melitensis recombinant ribosome recycling factor-homologous protein and its cDNA. Vaccine 2002;20:1660–9.

[43] Maeda I, Kohara Y, Yamamoto M, Sugimoto A. Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr Biol 2001;11:171–6. [44] González L, Carvajal J. Life cycle of Caligus rogercresseyi (Copepoda: Caligidae) parasite of Chilean reared salmonids. Aquaculture 2003;220:101–17.