Novel mating type-dependent transcripts at the mating type locus in Magnaporthe oryzae

Gene 403 (2007) 6 – 17 www.elsevier.com/locate/gene

Novel mating type-dependent transcripts at the mating type locus in Magnaporthe oryzae Masaki Kanamori a,b , Hana Kato a , Nobuko Yasuda c , Shinzo Koizumi c , Tobin L. Peever d , Takashi Kamakura e , Tohru Teraoka a,f , Tsutomu Arie a,f,⁎ a Laboratory of Plant Pathology, Tokyo University of Agriculture and Technology (TUAT), Fuchu, Tokyo 183-8509, Japan United Graduate School of Agriculture, Tokyo University of Agriculture and Technology (TUAT), Fuchu, Tokyo 183-8509, Japan c National Agricultural Research Center, Tsukuba, Ibaraki 305-8666, Japan d Department of Plant Pathology, Washington State University, Pulluman, WA 99164-1067, USA e Faculty of Science and Technology, Tokyo University of Science, Noda, Chiba 278-8510, Japan Institute of Symbiotic Science and Technology, Tokyo University of Agriculture and Technology (TUAT), Fuchu, Tokyo 183-8509, Japan b

f

Received 20 December 2006; received in revised form 19 June 2007; accepted 19 June 2007 Available online 3 July 2007 Received by M. Di Giulio

Abstract The mating type locus (MAT1) of Magnaporthe oryzae has similar structural organization to MAT in other ascomycetes and encodes the mating type genes MAT1-1-1 with an alpha-box motif and MAT1-2-1 with an HMG-box motif in the MAT1-1 and MAT1-2 idiomorphs, respectively. Sequence and expression analyses of the MAT1 locus indicated a second open reading frame (ORF), MAT1-1-2, in the MAT1-1 idiomorph, and novel mating-type dependent ORFs (MAT1-1-3 and MAT1-2-2) at the locus. The MAT1-1-3 ORF initiated within the MAT1-1 idiomorph while the MAT1-2-2 ORF initiated at the border of the MAT1-2 idiomorph with both ORFs sharing most of their reading frames in the MAT1 flanking region. This suggests that the encoded proteins (MAT1-1-3 and MAT1-2-2) should be similar in their primary structures but can be distinguished by distinct N-termini with amino acids of 1 and 32, respectively, in each mating type. A CT dinucleotide repeat, (CT)n, present in the upstream region of MAT1-1-3, was polymorphic among the isolates. © 2007 Elsevier B.V. All rights reserved. Keywords: Rice blast fungus; MAT; CT dinucleotide repeat (CT-box); Multiplex-PCR; Sexual; Asexual

1. Introduction The rice blast fungus, Magnaporthe oryzae Couch [anamorph, Pyricularia oryzae Cavara] (Couch and Kohn, 2002) is a heterothallic (self-incompatible) member of the Class Sordariomycetes (previously Pyrenomycetes) in the Phylum Ascomycota. The fungus reproduces asexually in Japan with no Abbreviations: MAT1-1; MAT1-1-1; MAT1-1-2; MAT1-1-3; MAT1-2; MAT1-2-1; MAT1-2-2; MAT; MAT1; MAT1-1; MAT1-1-1, MAT1-1-2; MAT11-3; MAT1-2; MAT1-2-1; MAT1-2-2; cDNA; dNTP; EDTA; DTT; EST; gDNA; HMG; mRNA; ORF; PCR; RACE; RT; RT-PCR; TAIL-PCR; tsp; UTR; YG. ⁎ Corresponding author. Laboratory of Plant Pathology, Faculty of Agriculture, Tokyo University of Agriculture and Technology (TUAT), Saiwaicho, Fuchu, Tokyo 183-8509, Japan. Tel./fax: +81 42 367 5691. E-mail address: [email protected] (T. Arie). 0378-1119/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2007.06.015

evidence of hybridization occurring in nature. In contrast, isolates from the Yunnan Province of the People's Republic of China, the Shan and Kachin States of Union of Myanmar, the northeastern and northern regions of Thailand, and several states of India exceptionally have demonstrated heterothallic fertility, producing perithecia with asci and viable ascospores (Meckwatanakarn et al., 1999; Dayakar et al., 2000; Hayashi and Kaku, 2004). An assumed signal transduction cascade controls sexual reproduction in ascomycetes and it is predicted that mating type (MAT) gene products should be the most upstream regulatory factors in the cascade (Turgeon, 1998; Montelone, 2002). We have already cloned the MAT1 locus from two asexual ascomycetes, Fusarium oxysporum and Alternaria alternata, and demonstrated that the genes at the MAT1 locus are expressed

M. Kanamori et al. / Gene 403 (2007) 6–17

(transcripted) similarly to their heterothallic sexual relatives, Gibberella fujikuroi and Cochliobolus heterostrophus, respectively (Arie et al., 2000; Yun et al., 2000). MAT genes of some heterothallic ascomycetes such as C. heterostrophus are solely or strongly expressed during mating conditions. Moreover, MAT1 products from asexual A. alternata were functional in C. heterostrophus by heterologous expression (Arie et al., 1999; Arie et al., 2000), similar to the previous report on Biporalis sacchari, an asexual relative of C. heterostrophus (Sharon et al., 1996). These findings suggest that MAT genes are indispensable for sexual reproduction, but the occurrence of functional MAT loci in asexual fungi may indicate other roles in addition to mating. Although the MAT1 locus was previously cloned from the sexual laboratory isolates of M. oryzae (Kang et al., 1994), little DNA sequence information for the MAT1 locus has been presented and the structure of this locus has not been characterized. Recently, we identified the MAT1-related DNA sequences and putative transcripts from both the genome sequence and expressed sequence tag (EST) databases of the M. oryzae isolate 70-15 (Mat1-1, fertile) (http://www.broad.mit. edu/annotation/fungi/magnaporthe/). In this report, we sequenced and compared the MAT1 loci from asexual Japanese isolates, sexual Chinese and laboratory isolates. Genes expressed at or adjacent to the MAT1 locus were determined by RT-PCR. In addition, we determined the mating type of M. oryzae field isolates sampled from Japan, China, and Bhutan using multiplex, mating type-specific PCR in order to better understand the distribution of mating types. 2. Materials and methods 2.1. M. oryzae isolates and culture conditions M. oryzae isolates used in this study are listed in Table 1. For cloning of the MAT1 locus, asexual Japanese isolates Hoku-1 and P2, sexual Chinese isolates Y93-164a-1 and Y93-165g-1, and sexual laboratory strains 70-6 and 70-14 were used. Strains 70-6 and 70-14, obtained from A. Ellingboe, University of Wisconsin, were developed through numerous backcrosses to the wild isolate Guy 11 (Chao and Ellingboe, 1991). All of the isolates and strains were maintained on oat agar medium (5% (w/v) oatmeal, 2% (w/v) sucrose, 1.5% (w/v) agar) at 20 °C in the dark. Mycelia for DNA extraction were grown on yeast extract glucose (YG) broth (0.5% (w/v) yeast extract, 2% (w/v) glucose) at 26 °C for 3 days on a reciprocal shaker (120 strokes per min). Field isolates sampled from Japan, China, and Bhutan were used for assessment of mating type. 2.2. Crosses Crosses were performed by culturing each isolate with mating type-tester isolates 70-14 (Mat1-1 = MAT1-2) or 70-6 (Mat12 = MAT1-1) (Table 1). Field isolates were placed at the apex of a triangle and testers were placed at the other apices on oat agar medium in a 9-cm-diam Petri dish, and incubated at 20 °C under fluorescent light (ca. 5500 lx; 12 h light/dark cycles). Fertility of isolates was evaluated by perithecial formation usually near the

7

Table 1 Isolates of Magnaporthe oryzae used in this study Isolate

Hoku-1 P2 Y93-164a-1 a Y93-165g-1 a 70-6 a 70-14 a

Origin

Japan Japan China China USA USA

Mating type

Source

Original designation b

Designation in this study c

– – Mat1-1 Mat1-2 Mat1-2 Mat1-1

MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-1 MAT1-2

T. Teraoka T. Teraoka N. Yashuda N. Yashuda A. Ellingboe A. Ellingboe

a Fertility was confirmed by crossing with the isolates of the opposite mating type by the formation of perithecia near the boundary of colonies. b Determined by outcrosses with the testers (70-6 and 70-14). –, could not be determined by outcrossing (asexual). c Structure-based MAT nomenclature (Turgeon and Yoder, 2000).

boundary of colonies, and formation of asci and ascospores inside of the perithecia after 30–50-day incubation. 2.3. DNA and RNA manipulations Genomic DNA (gDNA) of M. oryzae was purified as described (Arie et al., 1998; Saitoh et al., 2006). RNA was extracted from mycelia cultured under the two different conditions. To mimic provisional sexual conditions, an isolate of M. oryzae was incubated on cellophane membrane (8 cm) placed on the surface of oat agar medium in a 9-cm-diam Petri dish at 20 °C for 14 days. To mimic sexual conditions, two isolates were placed on opposite sides of the cellophane membrane embedding on the oat agar medium, and incubated at 20 °C for 14 days. Mycelia formed on the plates were harvested with the cellophane membrane and ground in liquid nitrogen. Total RNA was extracted from the powdered mycelia using ISOGEN-LS (Nippon Gene, Toyama, Japan) according to the manufacturer's protocol. Isolation of Poly (A+) mRNA from the total RNA was carried out using MPG mRNA Purification Kit (CPG, Lincoln Park, NJ, USA) according to the manufacturer's protocol. 2.4. PCR Primers used for PCR are listed in Table 2. Most of the primers were synthesized by Boehringer Mannheim Nihon Gene Research Laboratory (Sendai, Japan), dissolved (100 μM) in water, and stored at −20 °C. Each PCR mixture (final volume 50 μl) contained 1× PCR Gold Buffer (Applied Biosystems, Foster City, CA, USA), 2.5 mM MgCl2, 0.2 mM (each) dNTPs, 2 μM (each) primers, 0.025 U AmpliTaq Gold (Applied Biosystems), and about 20 ng of fungal gDNA. Thermal conditions were: denaturation at 95 °C for 15 min; 35 cycles of 94 °C for 1 min/ 55 °C for 30 s/72 °C for 1 min; final extension at 72 °C for 10 min. To obtain long PCR fragments, reaction mixtures in 50 μl contained 1× LA PCR Buffer (Takara-Bio, Shiga, Japan), 0.4 mM (each) dNTPs, 1 μM (each) primers, 0.5 μl TaKaRa LA Taq (Takara-Bio), and about 20 ng of template DNA. Cycling conditions were: denaturation at 94 °C for 1 min; 30 cycles of 98 °C for 20 s/58 °C for 10 min; final extension at 72 °C for 10 min.

8

M. Kanamori et al. / Gene 403 (2007) 6–17

Table 2 Primers used in this study Primer

Sequence (5′–3′)

Gene

Position a

Reference b

A1 A5 A24 A201 A202 B15 B16 B113-001

AGCCTCATCAACGGCAA GGCACGAACATGCGATG CTCGAAATACCCTCTCAAT CTGCGAATGCCTACATCCTG GCCGACGAGGAGAGTAGCGA CTCAATCTCCGTAGTAG ACAGCAGTATAGCCTAC CTGCATGGTTTGGATCTGGG CAAACCGCTGGATTCTCTACCGTG

B113-008 B113-800 B156 B182 B199 B205 B208

GCTCGCCACTATGCTGTTCTCGTA GCTCCACTCCACGCTCCACATCTT GCAGGCAACTCGCAGGAATC CCGATGATGTTGTTGAGC TAGGATGACTGTGCTCTC TACGAGAACAGCATAGTGG GCGGTTTGGAGGCTTGGAA

111F2 112R2 SMART II A Oligonucleotide 3′- CDS 5′- CDS UPM

CAGAGCAAATGACGAGAAAGAGCG TTTACACCGAGCCCGATG AAGCAGTGGTATCAACGCAGAGTACGCGGG AAGCAGTGGTATCAACGCAGAGTAC(T)30N− 1N (T)25N− 1N Long:CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT Short:CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT CCCAGTCACGACGTTGTAAAACG AGCGGATAACAATTTCACACAGG GTTTTCCCAGTCACGAC NGTCGASWGANAWGAA GTNCGASWCANAWGTT WGTGNAGWANCANAGA TGYTGYWSNCARTTYGG TGYCCNAAYMGNYT TTRTTNCCRTANCCDAT YTGRTTRTTRCARTCNA CCNARNARTCRCA

1222–1239 1592–1576 2371–2389 1748–1767 2015–1996 888–872 518–534 3548–3567 2666–2685 3881–3904 2998–3022 3332–3309 3051–3074 717–698 1183–1166 2257–2274 3309–3327 3888–3870 3006–2988 367–390 2516–2499

Xu and Hamer (1995) Xu and Hamer (1995) This study This study This study Xu and Hamer (1995) Xu and Hamer (1995) This study

B113-003

MAT1-2-1 MAT1-2-1 MAT1-2-2 MAT1-2-1 MAT1-2-1 MAT1-1 MAT1-1-1 MAT1-1-3 MAT1-2-2 MAT1-1-3 MAT1-2-2 MAT1-1-3 MAT1-1 MAT1-1-1 MAT1-1-1 MAT1-1-2 MAT1-1-3 MAT1-1-3 MAT1-2-2 MAT1-1-1 MAT1-1-2

NUP M13 Forward M13 Reverse M13 Primer M4 TP1 TP2 TP3 N1 N5 C3 C4 C5

AD AD AD AD AD AD AD AD

This study This study This study This study This study This study This study This study This study This study BD BD BD BD BD Takara Takara Takara Liu (1995) Liu (1995) Liu (1995) Arie (1998) This study This study This study This study

a Positions (nt) based on the nucleotide sequences from Hoku-1 (MAT1-1, #AB080668) and/or P2 (MAT1-2, #AB080669) are shown. AD: arbitrary degenerate primer for TAIL-PCR. b BD; BD Bioscience Clontech (Palo Alto, CA, USA), Takara; Takara-Bio (Shiga, Japan).

Primary thermal asymmetric interlaced (TAIL)-PCR (Liu and Whittier, 1995; Arie et al., 1997) reaction mixture (final volume 25 μl) contained 1× PCR Buffer II (Applied Biosystems), 2.5 mM MgCl2, 0.2 mM (each) dNTPs, 0.4 μM specific primer, 5 μM arbitrary degenerate (AD) primer, 0.016 U AmpliTaq (Applied Biosystems), and approximately 20 ng genomic DNA. The secondary amplification reaction mixture (final volume 50 μl) contained the same components as the primary reactions except a 0.2 μM nested specific primer and 1 μl of a 1:50 dilution of the primary reaction mixture as template. Thermal conditions for TAIL-PCR were as previously described (Liu and Whittier, 1995). Reverse transcription (RT)-PCR was performed using the TaKaRa RNA PCR Kit (AMV) ver. 2.1 or 3.0 (Takara-Bio). The RT-reaction mixture (20 μl) containing ca. 1 μg of total RNA or mRNA, 0.125 μM of Oligo dT-Adapter primer, 1 mM (each) dNTPs and 5 U of AMV reverse transcriptase XL was incubated

at 42 °C for 1 h, and the enzyme was inactivated at 99 °C for 5 min. For primary PCR reaction, the whole RT-reaction mixture was added with 0.2 μM M13 primer M4 (Table 2; Takara-Bio), 0.2 μM appropriate sense primer, and 2.5 U TaKaRa Taq (Takara-Bio). Primary PCR conditions were: denaturation at 94 °C for 2 min; 30 cycles of 94 °C for 30 s/55 °C for 30 s/72 °C for 3 min; final extension at 72 °C for 10 min. To exclude nonspecific amplicons, the secondary PCR reaction used appropriate nested primers. The secondary PCR reaction mixture in 50 μl contained 1 μl of primary PCR reaction mixture, 1 μM (each) nested primers, 0.2 mM (each) dNTPs, and 1.25 U of AmpliTaq Gold. Secondary PCR conditions were denaturation at 94 °C for 10 min; 30 cycles of 94 °C for 1 min/55 °C for 30 s/72 °C for 2 min; final extension at 72 °C for 10 min. Rapid amplification of cDNA ends (RACE)-PCR was carried out using a SMART RACE cDNA Amplification Kit (BD Bioscience Clontech, Palo Alto, CA, USA). First-strand cDNA

M. Kanamori et al. / Gene 403 (2007) 6–17

(3′- or 5′-RACE-Ready first-strand cDNA) synthetic reaction mixture in 10 μl containing 1 μg of mRNA, and 1 μM of 3′-CDS or 5′-CDS primer, and 1 μM of SMART II A oligonucleotide were incubated at 70 °C for 2 min, and then cooled on ice for 2 min. Following the above reaction, 5× First-strand buffer, 2 mM of dithiothreitol (DTT), 1 mM (each) dNTPs, and 1 μl of PowerScript Reverse Transcriptase were added to the reaction mixture, and incubated at 42 °C for 90 min. First-strand cDNA reaction products were diluted with tricine-EDTA buffer, and incubated at 72 °C for 7 min to inactivate the enzyme. The 3′- or 5′RACE-Ready first-strand cDNA were stored at −20 °C until needed. The primary 3′- or 5′-RACE-PCR reaction mixture (final volume 50 μl) contained 10× Advantage 2 PCR buffer, 0.2 mM (each) dNTPs, 10× Universal Primer Mix A (UPM, BD Bioscience Clontech), 0.4 μM of gene specific primer, 50× Advantage 2 polymerase Mix, and 2.5 μl of 3′- or 5′-RACE-Ready firststrand cDNA as template. Thermal conditions for the RACE-PCR reactions were: Initial denaturation at 94 °C for 3 min, 30 cycles of 94 °C for 5 s/68 °C for 10 s/72 °C for 3 min and an additional extension at 72 °C for 5 min. If non-specific multiple bands were detected in the primary RACE-PCR products, PCR using nested gene specific primer and Nested Universal Primer Mix A (NUP, BD Bioscience Clontech) was performed. The nested PCR reaction mixture (final volume of 50 μl) contained 10× Advantage 2 PCR buffer, 0.2 mM (each) dNTPs, 0.2 μM NUP, 0.4 μM of nested gene specific primer, 50× Advantage 2 polymerase Mix, and 5 μl of the primary RACE-PCR product diluted with tricineEDTA buffer as a template. Thermal conditions for the nested PCR reactions were the same as primary RACE-PCR. Quantitative real-time RT-PCR for monitoring gene expression was performed using Smart Cycler II (Cepheid, Sunnyvale, CA, USA) with an intercalator SYBR Green I (Takara-Bio). Real-time RT-PCR reaction mixture (final volume 25 μl) contained 1× R-PCR Buffer (Takara-Bio), 3 mM Mg+ solution for R-PCR, 0.3 mM (each) dNTPs, 0.3 μM (each) primers, 0.33× SYBR Green I, 1.25 U TaKaRa Ex Taq HS for R-PCR (Takara-Bio), and 10 ng of total cDNA. Thermal conditions were: denaturation at 95 °C for 10 s; 55 cycles of 95 °C for 5 s/ 55 °C for 10 s (monitor)/72 °C for 10 s. After real-time PCR, specificity of the amplicons was checked by melting curve analysis at 60–95 °C (0.2 °C/s, monitor/s). Relative expression levels of the genes compared to MAT1-1-3 of Hoku-1 were calculated by the equation: relative expression level = 2▵Ct MAT1-1-3 (▵CtMAT1-1-3 = CtHoku-1 − CtMAT1-1-3, Ct: threshold cycle). 2.5. Cloning, sequencing, and analysis of PCR products PCR products were ligated into the pCR2.1 vector (Invitrogen, San Diego, CA, USA) or the pGEM-T easy vector (Promega, Madison, WI, USA) following the manufacturer's protocols. Plasmid DNA was purified using the RPM Kit (BIO 101, Carlsbad, CA, USA) following the manufacturer's protocol. The inserts were sequenced using the M13 Reverse or M13 Forward primers. DNA sequences were determined using DYEnamic ET Terminator Cycle sequencing Kit (Amersham Biosciences, NJ, USA) and Automated Fluorescent DNA Sequencer 377 (Applied Biosystems). Sequences were assem-

9

bled and analyzed using the Genetyx-Mac ver. 12 software (Genetyx, Tokyo, Japan). BLAST searches (Altschul et al., 1997) were performed against the NCBI/GenBank databases. Multiple alignments of amino acid sequences of HMG-box and alpha-box were constructed by using the Clustal W program (Thompson et al., 1997) and adjusted manually. 3. Results 3.1. PCR cloning of the MAT1 locus in asexual Japanese and sexual isolates of M. oryzae Three hundred fifty-bp fragments were amplified from isolates Hoku-1 and P2 by PCR using B15 + B16 and A1 + A5 primers, respectively (Table 2). These primer sets were designed to amplify fragments from MAT1-1 and MAT1-2 idiomorphs, respectively. Following Xu and Hamer (1995), mating type of Hoku-1 was identified to be Mat1-2, and P2 was Mat1-1. The nucleotide sequences of the PCR fragments were determined and used to design additional primers (Table 2). Repeated TAIL-PCR using the specific primers yielded a 4618bp sequence from Hoku-1 and a 3736-bp sequence from P2, each including the ∼ 350-bp fragment (Fig. 1). Nucleotide alignment of the ∼ 4.6- and 3.7-kb fragments from Hoku-1 and P2 showed that the nucleotide positions (nt) 155 of Hoku-1 and 1-55 of P2, plus nt 3397-4618 of Hoku-1 and 2516-3736 of P2 were nearly identical. In contrast, the nt 563396 (∼ 3.3 kb) of Hoku-1 and nt 56-2515 (∼2.5 kb) of P2 had little identity (Fig. 1). This suggested that the 3.3- and 2.5-kb fragments from Hoku-1 and P2 are idiomorphs characteristically found in ascomycete MAT1 alleles (Fig. 1). The idiomorphs were determined to be MAT1-1 (Hoku-1) and MAT1-2 (P2) based on Turgeon and Yoder's nomenclature (2000) (Fig. 1). Henceforth, we replace the original mating type designations Mat1-2 and Mat1-1 for M. oryzae with MAT1-1 and MAT-2, respectively (Turgeon and Yoder, 2000). Nucleotide sequences of the MAT1 locus were also determined for sexual isolates 70-6, 70-14, Y93-165g-1, and Y93-164a-1 for structural comparison with those from Hoku-1 and P2. MAT1 sequence data have been deposited in the DDBJ/ EMBL/ GenBank Nucleotide Sequence Databases under the accession nos. AB080668 [Hoku-1 (MAT1-1); 4618 bp], AB080669 [P2 (MAT1-2) 3736 bp], AB080670 [70-6 (MAT1-1); 4666 bp], AB080671 [70-14 (MAT1-2); 3736 bp], AB080671 [Y93-165g-1 (MAT1-1); 4650 bp], and AB080672 [Y93-164a-1 (MAT1-2); 3736 bp]. 3.2. Structural organization of the MAT1 locus in asexual Japanese strains of M. oryzae In the Hoku-1 MAT1-1 idiomorph, two open reading frames (ORFs) were identified. One of them designated MAT1-1-1 (981 bp) was composed of two exons (nt 299–476, 530–1332) interrupted by a 53-bp intron (nt 477–529) and encoded a predicted protein of 327 amino acids (Fig. 1). Transcription of MAT1-1-1 on oat agar medium (vegetative growth conditions) was confirmed by RT-PCR with primers 111F2 + B156 (Table 2;

10

M. Kanamori et al. / Gene 403 (2007) 6–17

Fig. 1. Structural organization of MAT1 locus in Magnaporthe oryzae. Nucleotide positions are indicated based on the asexual Japanese isolates Hoku-1 (MAT1-1; GeenBank accession no. AB080668) and P2 (MAT1-2; AB080669). White and dark boxes are MAT1 idiomorphs, and striped lines are common flanking regions. ORFs are indicated by arrows with triangle representing intron. Dark or white rectangles under the arrow indicate an alpha-box or HMG-box motifs, respectively. Primers (Table 1; Figs. 2 and 3) are indicated with arrowheads.

Fig. 2A). 3′-RACE revealed the polyadenylation site (179 bp downstream from the stop codon), but the transcription starting point (tsp) could not be determined by 5′-RACE. The deduced protein product of MAT1-1-1 included an α-box motif (aa. 47102) that is conserved among MAT1-1 product in many ascomycete fungi (Turgeon, 1998). A second ORF (906 bp), designated MAT1-1-2, contained a single exon (nt 2839-1934) and encoded a protein of 302 amino acids (Fig. 1). Transcription of MAT1-1-2 on oat agar medium was confirmed by RT-PCR with primers B199 + 112R2 (Table 2; Fig. 2B). However, the tsp and polyadenylation site could not be determined by 5′- and 3′- RACE. In the P2 MAT1-2 idiomorph, we identified an ORF designated MAT1-2-1 (1326 bp). The ORF was composed of four exons (nt 727–902, 957–1831, 1887–2035, and 2102– 2227) interrupted by introns (nt 903–956, 1832–1886, and 2036–2101) and encoded a predicted protein of 442 amino acids (Fig. 1). Transcription of MAT1-2-1 on oat agar medium was confirmed by RT-PCR with primers A201 + A202 (Table 2; Fig. 2C). Both 5′- and 3′- RACEs suggested the tsp (132 bp upstream from the initiation codon) and polyadenylation site (260 bp downstream from the stop codon). The deduced amino acid sequence contained a putative HMG-box motif (aa. 321– 391) that is conserved in MAT1-2 products of many ascomycetes (Arie et al., 1997; Turgeon, 1998).

3.3. Mating type-dependent novel transcripts at MAT1 When the structures of the MAT1 locus was compared between Hoku-1 (MAT1-1) and P2 (MAT1-2), we found additional putative mating type-dependent genes designated MAT1-1-3 and MAT1-2-2 from Hoku-1 and P2, respectively (Fig. 1). These genes were found at the border between the MAT1 idiomorphs and their flanking regions (Figs. 1 and 3). Two ORFs (939 and 498 bp), tentatively named MAT1-1-3a and MAT1-1-3b determined by alternative splicing with a frame shift at the first intron, were identified from MAT1-1-3; 846- and 405-bp ORFs, tentatively named MAT1-2-2a and MAT1-2-2b, also arranged by alternative splicing with frame shift at the first intron, were determined from MAT1-2-2 (Figs. 1 and 3). The MAT1-1-3a ORF was composed of four exons (nt 3303– 3448, 3536–3648, 3731–3961, and 4116–4564) interrupted by three introns (nt 3449–3535, 3649–3730, and 3962–4115) and encoded a protein of 313 amino acids containing a putative HMG-box motif (aa. 133–192) (Fig. 1). On the other hand, MAT1-1-3b ORF was composed of three exons (nt 3303–3448, 3510–3648, and 3731–3943) interrupted by two introns (nt 3449–3509 and 3649–3730) and encoded a protein of 166 amino acids (Fig. 1). 5′- RACE of MAT1-1-3a or MAT1-1-3b using primers (NUP + B113-008) suggested a tsp (72 bp upstream from the initiation codon). 3′-RACE using primers M13

M. Kanamori et al. / Gene 403 (2007) 6–17

11

(494 bp) were not seen on an agarose gel, respectively (Fig. 4A, B). These results suggest that transcription of MAT1-1-3 and MAT1-2-2 starts in the MAT1-1 and MAT1-2 idiomorph, respectively, whereas both genes mostly share the reading frame and the encoded proteins are mostly common in their primary structures but with distinct N-terminals (Figs. 1, 3, 4C). 3.5. Structural comparison of MAT1 locus and MAT genes between asexual and sexual isolates of M. oryzae

Fig. 2. Expression of MAT1 genes in MAT1-1 and MAT1-2 idiomorphs. Expression of MAT1 genes in both idiomorphs was analyzed by RT-PCR with primers 111F2 + B156 for MAT1-1-1 (A), B199 + 112R2 for MAT1-1-2 (B), and A201 + A202 for MAT1-2-1 (C), respectively (Table 2, Fig. 1). cDNA (lane 1) synthesized from the mRNA from oat agar-cultured mycelia and gDNA (lane 2) were used as templates, and the amplicons were separated in a 1.5% agarose gel. Hoku-1 (asexual), 70-6 (sexual) and Y93-165g-1 (sexual) are MAT1-1 isolates (A and B); P2 (asexual), 70-14 (sexual) and Y93-164a-1 (sexual) are MAT1-2 isolates (C). Arrowhead indicates the 500-bp in 100 bp DNA ladder markers (2Log DNA Ladder, New England Biolabs, Beverly, MA, USA; lane M).

Primer M4 + B113-003 determined the polyadenylation site of MAT1-1-3a (53 bp downstream from the stop codon), but that of MAT1-1-3b was not determined. The MAT1-2-2a ORF was composed of four exons (nt 2515– 2567, 2654–2766, 2849–3079, and 3234–3682) interrupted by three introns (nt 2568–2653, 2767–2848, and 3080–3233) and encoded a protein of 282 amino acids containing a putative HMGbox motif (aa. 102–161) (Fig. 1). On the other hand, MAT1-2-2b ORF was composed of three exons (nt 2515–2567, 2628–2766, and 2849–3061) interrupted by two introns (nt 2568–2627, and 2767–2848) and encoded a protein of 135 amino acids (Fig. 1). The tsp of MAT1-2-2a and MAT1-2-2b has not been determined by 5′- RACE. However, RT-PCR using primer A24 suggested that transcription of MAT1-2-2 started ≥143 bp upstream from the initiation codon. By 3′-RACE, the polyadenylation site of MAT1-2-2a was determined to be 53 bp downstream from the stop codon, but that of MAT1-2-2b was not determined. 3.4. Transcription of MAT1-1-3 and MAT1-2-2 Mating type dependent transcription of MAT1-1-3 and MAT1-2-2 on oat agar medium (vegetative growth conditions) was confirmed by RT-PCR with primers B205 (designed on MAT1-1 idiomorph) or A24 (designed on MAT1-2 idiomorph) + B208 (designed on the flanking region of MAT1 locus) (Table 2; Figs. 1 and 4A, B). MAT1-1-3a (411 bp) and MAT1-2-2a (468 bp) transcripts seemed to be predominant in M. oryzae compared with MAT1-1-3b and MAT1-2-2b because amplicons of expected size from MAT1-1-3b (437 bp) and MAT1-2-2b

Comparison of the ca. 4.6-kb fragments showed that there were no major differences at the MAT1 locus among the three MAT1-1 isolates, except in the CT-dinucleotide repeat at the upstream of MAT1-1-3. Likewise, there were only slight differences in the ca. 3.6-kb fragments among the three MAT1-2 isolates. Comparison of the MAT1 loci in asexual and sexual isolates is summarized in Fig. 5 and Table 3. Nucleotide sequences of common flanking regions (55 and 677 bp, respectively) revealed high (100% and 96.9%, respectively) identity between all isolates of M. oryzae (Fig. 5). MAT1-1 idiomorph (3341 bp) of an asexual isolate (Hoku-1) was 98.3% and 99.0% similar to those of sexual 70-6 and Y93-165g-1, respectively, and likewise MAT1-2 idiomorph (2460 bp) of an asexual isolate (P2) was 99.7% similar with those of both 70-14 and Y93-164a-1. Sequences of MAT1-1-1, MAT1-1-2, and MAT1-1-3a genes of asexual isolate Hoku-1 isolate were 100% identical at both the nucleotide and amino acid levels to those of sexual isolates 70-6 and Y93-165g-1 (Fig. 5). On the other hand, MAT1-2-1 and MAT1-2-2a of P2 isolate were 99.6–99.7% and 100% identical to those of sexual isolates 70-14 and Y93-164a-1, respectively at the nucleotide sequence level and 99.1–99.5% and 100% identical at the amino acid level (Fig. 5, Table 3). 3.6. Polymorphism of the CT-dinucleotide repeat at MAT1-1-3, and MAT1-1-3 expression The 5′- untranslated region (UTR) of MAT1-1-3 of Hoku-1 carried a CAAT motif (CCAATCT; nt 3131–3137, 93 bp upstream from the tsp) and a TATA motif (TATAAA; nt 3146–3151, 79 bp upstream from tsp). A CT-rich region composed of 19 dinucleotide repeats of CT [(CT)19] (nt 3189-3226) was found

Table 3 Single nucleotide differences in MAT1-2-1 among Magnaporthe oryzae MAT12 isolates Isolate (GenBank accession)

Nucleotide sequence and amino acid position nt

a

1241– 1243

aa b 154 P2 (AB080669) 70-14 (AB080671) Y93-164a-1 (AB080672) a b

1532– 1534

1592– 1594

1955– 1957

2214– 2216

251

271

374

441

ggc (Gly) gac (Asp) ccg (Pro) ctg (Leu) ccg (Pro) gac (Asp) ggc (Gly) ctg (Leu) gag (Glu) ccg (Pro) ggc (Gly) gac (Asp) ccg (Pro) gan (Glu) cgg (Arg)

Nucleotide position based on P2 MAT1-2 sequence. Amino acid position in predicted MAT1-2-1 protein.

12

M. Kanamori et al. / Gene 403 (2007) 6–17

Fig. 3. Nucleotide and amino acid sequence comparison of the 5′-regions of MAT1-1-3 and MAT1-2-2. Gray boxes represent the idiomorphs MAT1-1 of Hoku-1 and MAT1-2 of P2, respectively. Nucleotide and amino acid sequences which are different between the isolates are in bold. Underlined sequence indicates mRNA. Introns in MAT1-1-3a and MAT1-2-2a are indicated in small letters. Alternative splicing sites are shown with wave lines. Deduced amino acid sequences of MAT1-1-3a and MAT1-2-2a are indicated below the nucleotide sequences and the amino acid sequences of MAT1-1-3b and MAT1-2-2b produced by an alternative splicing are italicized.

4 bp upstream from the tsp (Fig. 6A). In contract, a sexual, Chinese isolate Y93-165g-1 had a (CT)35 (nt 3189-3258 of AB080672) and a sexual laboratory strain 70-6 had a (CT)43 (nt 3189-3274 of AB080670) at the upstream of MAT1-1-3 (Fig. 6A). No CT-dinucleotide repeat was found in the 5′- non-cording region of MAT1-2-2 of MAT1-2 isolates. Comparison of CTrepeat sizes with other sexual and asexual isolates by PCR indicated that the repeats in sexual isolates (four isolates) were likely longer than those of asexual Japanese isolates (six isolates) (Fig. 6B). The expression level of MAT1-1-3 was higher in asexual Hoku-1 than that of sexual isolates (Y93-165g-1 and 70-6)

under the provisional sexual conditions. In contrast, expression of the gene in sexual isolates seemed to be stronger than that of Hoku-1 under the sexual conditions (Fig. 7). Each expression experiment was replicated three times with similar results. 3.7. Determination of mating type of field isolates using multiplex-PCR A multiplex-PCR strategy (Henegariu et al., 1997; Dyer et al., 2001) was used to amplify mating type-specific MAT1 fragments in order to determine the mating type of field isolates

M. Kanamori et al. / Gene 403 (2007) 6–17

13

which the mating type locus (MAT1) has been identified, each individual (=isolate or cell) carries either the MAT1-1 or the MAT12 idiomorph, and this genomic locus determines the mating type of Table 4 Mating type determination of Magnapothe oryzae field isolates by multiplexPCR

Fig. 4. Expression of MAT1-1-3 and MAT1-2-2. Expression of MAT1-1-3 and MAT1-2-2 which share the reading frame at MAT1-flanking region was analyzed by RT-PCR with primers B205 + B208 for MAT1-1-3 (A), A24 + B208 for MAT1-2-2 (B), and B113-001 + B208 designed on the 3′- common flanking region as a control (C), respectively (Table 2, Fig. 1). Amplicons from cDNA from oat agar-cultured mycelia (lane 1) and gDNA (lane 2) were separated in a 1.5% agarose gel. Hoku-1 (asexual), 70-6 (sexual), and Y93-165g-1 (sexual) are MAT1-1 isolates; P2 (asexual), 70-14 (sexual), and Y93-164a-1 (sexual) are MAT1-2 isolates. Arrowhead indicates the 500-bp in 100 bp DNA ladder markers (lane M).

of M. oryzae. Primers B16 + B182 (Table 2; Fig. 1) designed for amplification of a 666-bp fragment from MAT1-1-1 and primers A1 + A5 (Table 2; Fig. 1) for a 371-bp fragment from MAT1-2-1 were mixed and used for multiplex-PCR with genomic DNA from field isolates. Mating types of the isolates Ina 86-137, Y93-165g-1, Y93245c-2, Y93-247b-1, and Y93-255e-1 were determined to be MAT1-1, Ina 168, 95MU-29, Kyu 92-2, Ina 72, Sasamori 121, Ina 93-3, GFOSU 8-1-1, Y93-164a-1, and Y93-247c-1 were identified as MAT1-2 (Fig. 8). Mating types of field-sampled isolates from Japan, China, and Bhutan are presented in Table 4. Hermaphroditic fertility of each isolate was determined by the production of the perithecia on both sides at the boundary of the colonies in the outcross with either of the testers (70-6 and 70-14) (Table 4). 4. Discussion Mating of heterothallic ascomycete fungi occurs only between isolates of opposite mating type. In all heterothallic species from

Notes to Table 4: a Hermaphroditic fertility was determined by the production of the perithecia on both sides at the boundary of the colonies in the outcross with either of the testers (70-6 and 70-14). Other isolates are asexual or fertility has never been confirmed. b 1, Shinzo Koizumi; 2, Nobuko Yasuda; 3, Li Chengyun, Yunnan Academy of Agriculture Science, China. c Mating type was determined by multiplex-PCR using a mixture of primers B16 + B182 (for determination of MAT1-1) and A1 + A5 (for MAT1-2).

Isolate

Origin

Source b

Mating type c

0528-2 24-22-1-1 1804-4 31-4-151-11-1 95Mu-29 Ai 74-134 Ai 79-142 Ao 92-06-2 GFOSU 8-1-1 Ina 72 Ina 86-137 Ina 93-3 Ina 168 IW 81-04 Ken 53-33 Kyu 89-246 Kyu 92-2 Kyu9439013 Mu-95 Mu-183 Sasamori 121 Shin 83-34 TH 68-126 TH 68-140 TH 69-8 Y93-165g-1 a Y93-164a-1 a Y93-245c-2 a Y93-247b-1 a Y93-247c-1 a Y93-255e-1 a 8113R-6 a 8113R-8 a 8113R-11 a 8113-R12 a 8113-R16 a CH520 a CH521 a CH522 a CH523 CH524 CH597 CH598 a CH600 a LM-1 159Z-2 BL1 X1 UN1-1 UgL3-1 UgL3-5 UgL2-1 UgL1-1 KL1 Upg2-1 Kt2-1 Kt3-1 Kf3-1

Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan Japan China China China China China China China China China China China China China China China China China China China Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan Bhutan

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1

MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-1 MAT1-2 MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-1 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-2 MAT1-1 MAT1-1 MAT1-2 MAT1-1 MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-1 MAT1-1 MAT1-2 MAT1-2 MAT1-1 MAT1-1 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2 MAT1-2

14

M. Kanamori et al. / Gene 403 (2007) 6–17

Fig. 5. Schematic comparison of MAT1 idiomorphs between MAT1-1 and MAT1-2 isolates of Magnaporthe oryzae. Hoku-1, an asexual Japanese isolate; 70-6, a sexual laboratory strain; Y93-165g-1, a sexual Chinese isolate, are MAT1-1 isolates. P2, an asexual Japanese isolate; 70-14, a sexual laboratory strain; Y93-164a-1, a sexual Chinese isolate are MAT1-2 isolates. A dark box in the idiomorph indicates the nucleotide position at where the nucleotide differs from the other two isolates (black). Nucleotide of each isolate is indicated below the box. Bold letter shows the nucleotide difference which generates the amino acid difference in the MAT1-2-1 product.

each individual. In all ascomycetes studied to date, the MAT1-1 idiomorph has an ORF designated MAT1-1-1 which encodes a protein with an alpha-box DNA binding motif, and the MAT1-2 idiomorph has an ORF designated MAT1-2-1 which encodes a protein with an HMG-box DNA binding motif (Turgeon, 1998). M. oryzae, the rice blast fungus, has a similar organization at the MAT1 locus. Each isolate of M. oryzae carries either a ∼ 3.3 kb MAT1-1 idiomorph containing an ORF MAT1-1-1 or a ∼2.5 kb MAT1-2 idiomorph containing an ORF MAT1-2-1 at MAT1 locus (Fig. 1). However, in addition to the ORFs mentioned above, we found novel mating-type dependent ORFs (MAT1-1-3 and MAT1-2-2) at the locus. The MAT1-1-3 ORF initiated within the MAT1-1 idiomorph while the MAT1-2-2 ORF initiated at the border of the MAT1-2 idiomorph with the majority of their reading frames in the MAT1 flanking region (Fig. 1). This suggests that the putative proteins (MAT1-1-3 and MAT1-2-2) were similar in their primary structures but can be distinguished by distinct N-termini with amino acids of 1 and 32, respectively, in each mating type. We compared the structure and expression pattern of the MAT1 genes in sexual and asexual isolates of M. oryzae to

determine if mating ability correlated with differences in MAT1 structural organization or gene expression. We could not determine any obvious differences in gene structure among asexual and sexual isolates, except for several amino acids differences in MAT1-2-1 (Table 3) and the CT-dinucleotide repeat upstream of MAT1-1-3. As Sharon et al. (1996) and Arie et al. (2000) have described, MAT1-2-1 proteins from Bipolaris sacchari and Alternaria alternata functioned in Cochliobolus heterostrophus by heterologous expression, suggesting that amino acid differences in MAT1-2-1 were not responsible for mating functions. These experiments indicated that the genes in asexual isolates of M. oryzae were likely functional and that lack of fertility of these isolates was not due to the structural and/or functional deficiencies of MAT1 genes. Transcription of MAT1-1-1, MAT1-1-2, MAT1-2-1, and MAT1-2-2 were similar between sexual and asexual isolates. The two newly identified mating type-dependent ORFs, MAT1-1-3a and MAT1-2-2a encoded predicted proteins carrying a putative HMG-box DNA binding motif. MAT1-1-3 genes reported from several sordariomycetes such as Neurospora crassa,

M. Kanamori et al. / Gene 403 (2007) 6–17

15

Fig. 6. CT-dinucleotide repeats (CT)n at 5′-UTR of MAT1-1-3 in Magnaporthe oryzae. Comparison of the nucleotide sequences at the 5′-UTR of MAT1-1-3 among MAT1-1 isolates (A). CT-repeat [(CT)n] is shown with bold letters in the box. Transcription starting point (tsp; +1) of MAT1-1-3 mRNA (italic letter), and translation (bold italic letter) start point (+ 74) are indicated. Hoku-1, an asexual Japanese isolate; 70-6, a sexual laboratory strain; Y93-165g-1, a sexual Chinese isolate. Comparison of the sizes of (CT)n among MAT1-1 isolates by PCR (B). CT-box regions were amplified from the genomic DNA of each isolate with the primers B113008 + B113-800 (Table 2; Fig. 1). The repeat-number determined by sequencing with the PCR amplicon is indicated below the picture. – indicates the repeat-number has not been determined. The fragment in MAT1-1-1 amplified with primers B16 + B182 (Table 2; Fig. 1) from the same gDNA sample is shown as a check. Amplified products were separated in 1.5% agarose gel. Arrowhead indicates the 500-bp in 100 bp DNA ladder markers (lane M).

G. fujikuroi, F. oxysporum, have an HMG-box DNA binding motif. M. oryzae MAT1-2-2a is the first report of a second gene carrying an HMG-box from MAT1 locus in a MAT1-2 isolate. Expression of both MAT1-1-3a and MAT1-2-2a suggested that the putative both protein products of these genes were potentially involved in the mating behavior. However, it is possible that these genes are pseudogenes since their functions are unknown.

The function of the CT-rich region upstream of the 5′-UTR (CT-dinucleotide repeat, so-called CT-box or CT-block) is unclear. It has been suggested that the CT-box acts as a basic transcriptional signal to determine the transcription initiation site and to increase the efficiency of transcription, depending upon the number of CT repeats (Xu and Goodridge, 1998). Several papers have suggested that the CT-box is related to the

Fig. 7. Relative transcription levels of MAT1-1-3 in the three MAT1-1 isolates of Magnaporthe oryzae. RNA was extracted from the mycelia of Hoku-1, an asexual Japanese isolate, 70-6, a sexual laboratory strain, and Y93-165g-1, a sexual Chinese isolate grown at provisional sexual or sexual conditions (detail is described in section 2.3), and was subjected to quantitative RT-PCR using primers B205 + B208 (Fig. 1; Table 2). Expression levels of MAT1-1-3 genes were calculated by the equation [2▵Ct MAT1-1-3 (▵CtMAT1-1-3 = CtHoku-1 − CtMAT1-1-3)] compared to MAT1-1-3 of Hoku-1 at each condition. Each data represented the mean value of three independent analyses, and the error bars indicated standard deviations.

16

M. Kanamori et al. / Gene 403 (2007) 6–17

Fig. 8. Determination of mating type of field isolates of Magnaporthe oryzae by multiplex-PCR. PCR amplification of mating type genomic locus in Japanese and Chinese field isolates. Amplified fragment of 666 bp by B16 + B182 or 371 bp by A1 + A5 primers (Table 2) indicates that mating type of the isolate is MAT1-1 or MAT1-2, respectively. Amplified products were separated in 1.0% agarose gel.

regulation of gene expression, although no critical evidence has been presented (Hattori et al., 2001; Xu and Goodridge, 1998). We found a CT-box at the 5′- upstream region of MAT1-1-3 in MAT1-1 isolates of M. oryzae (Fig. 6A). PCR and sequencing analyses revealed that the repeats were longer in the sexual isolates than those of asexual Japanese isolates (Fig. 6B). Therefore, we speculate that the CT-box may be involved in the transcription of MAT1-1-3, and MAT1-1-3 for fertility. Quantitative real-time RT-PCR analysis of MAT1-1-3 expression indicated stronger expression in isolates with longer CTrepeats at 5′-UTR of MAT1-1-3 under sexual conditions (Fig. 7). This is the first report that the CT-box potentially regulates expression of MAT gene in ascomycetes. Further studies are necessary to test this hypothesis. Among the twenty-five field isolates from Japan, six MAT11 and nineteen MAT1-2 isolates were identified. Although the number of MAT1-1 isolates identified was less than that of MAT1-2 isolates, the existence of both mating types may indicate that the lack of sexual reproduction and recombination among Japanese isolates is not due to lack of one or other mating type. All the isolates from Bhutan were MAT1-2, suggesting that MAT1-2 isolates are dominant in this country. Further studies on the relationship between mating types, pathogenic races, vegetative compatibility, mating populations, and phylogeny with M. oryzae are expected. Acknowledgments The research was partly supported by Grant-in-Aid for Scientific Research from Japan Society for the Promotion of Science (JSPS) for TA and TT. We thank A. Ellingboe, University of Wisconsin Madison for gifts of M. oryzae strains. Isolates obtained from foreign countries were imported under permits from The Ministry of Agriculture, Forestry and Fisheries of the Japanese Government. The authors wish to express their thanks to Dr. Lori Marie Carris, Washington State University, Pullman, WA, USA for critical reading of the manuscript. References Altschul, S.F., et al., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402.

Arie, T., Christiansen, S.K., Yoder, O.C., Turgeon, B.G., 1997. Efficient cloning of ascomycete mating type genes by PCR amplification of the conserved MAT HMG box. Fungal Genet. Biol. 21, 118–130. Arie, T., et al., 1998. Immunological detection of endopolygalacturonase secretion by Fusarium oxysporum in plant tissue and sequencing of its encoding gene. Ann. Phytopathol. Soc. Jpn. 64, 7–15. Arie, T., Yoshida, T., Shimizu, T., Kawabe, M., Yoneyama, K., Yamaguchi, I., 1999. Assessment of Gibberella fujikuroi mating type by PCR. Mycoscience 40, 311–314. Arie, T., Kaneko, I., Yoshida, T., Noguchi, M., Nomura, Y., Yamaguchi, I., 2000. Mating type genes from asexual phytopathogenic ascomycetes, Fusarium oxysporum and Alternaria alternata. Mol. Plant-Microb. Interact. 13, 1330–1339. Chao, C.T., Ellingboe, A.H., 1991. Selection for mating competence in Magnaporthe grisea pathogenic to rice. Can. J. Bot. 69, 2130–2134. Couch, B.C., Kohn, L.M., 2002. A gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae from M. grisea. Mycologia 94, 683–693. Dayakar, B.V., Narayanan, N.N., Gnanamanickam, S.S., 2000. Cross-compatibility and distribution of mating type alleles of the rice blast fungus Magnaporthe grisea in India. Plant Dis. 84, 700–704. Dyer, P.S., Furneaux, P.A., Douhan, G., Murray, T.D., 2001. A multiplex PCR test for determination of mating type applied to the plant pathogens Tapesia yallundae and Tapesea auformis. Fungal Genet. Biol. 33, 173–180. Hattori, E., et al., 2001. Association studies of the CT repeat polymorphism in the 5′ upstream region of the cholecystokinin B receptor gene with panic disorder and schizophrenia in Japanese subjects. Am. J. Med. Genet. 105, 779–782. Hayashi, N., Kaku, H., 2004. Sexual compatibility and pathogenic race of rice blast fungus in the east region in Myanmar. Jpn. J. Phytopathol. 70, 34 (abstract in Japanese). Henegariu, O., Heerema, N.A., Dlouhy, S.R., Vance, G.H., Vogt, P.H., 1997. Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 23, 504–511. Kang, S., Chumley, F.G., Valent, B., 1994. Isolation of the mating-type genes of the phytopathogenic fungus Magnaporthe grisea using genomic subtraction. Genetics 138, 289–296. Liu, Y.G., Whittier, F., 1995. Thermal asymmetric interlaced PCR: Automatable amplification and sequencing of insert end fragment from P1 and YAC clones for chromosome walking. Genomics 25, 674–681. Meckwatanakarn, P., Kostitrarana, W., Phromraksa, T., Zeigler, R.S., 1999. Sexually fertile Magnaporthe grisea rice pathogens in Thailand. Plant Dis. 83, 939–943. Montelone, B.A., 2002. Yeast mating type. Encyclopedia of Life Sci. doi:10.1038/npg.els.0000598. Saitoh, K.-I., Togashi, K., Arie, T., Teraoka, T., 2006. A simple method for a mini-preparation of fungal DNA. J. Gen. Plant Pathol. 72, 348–350. Sharon, A., Yamaguchi, K., Christiansen, S., Horwitz, B.A., Yoder, O.C., Turgeon, B.G., 1996. An asexual fungus has the potential for sexual development. Mol. Gen. Genet. 250, 11–122.

M. Kanamori et al. / Gene 403 (2007) 6–17 Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Turgeon, B.G., 1998. Application of mating type gene technology to problems in fungal biology. Annu. Rev. Phytopathol. 36, 115–137. Turgeon, B.G., Yoder, O.C., 2000. Proposed nomenclature for mating type genes of filamentous ascomycetes. Fungal Genet. Biol. 31, 1–5.

17

Xu, G., Goodridge, A.G., 1998. A CT repeat in the promoter of the chicken malic enzyme gene is essential for function at an alternative transcription start site. Arch. Biochem. Biophys. 358, 83–91. Xu, J.-R., Hamer, J., 1995. Assessment of Magnaporthe grisea mating type by spore PCR. Fungal Genet. Newsl. 42, 80. Yun, S.-H., Arie, T., Kaneko, I., Yoder, O.C., Turgeon, B.G., 2000. Molecular organization of mating type loci in heterothallic, homothallic and asexual Gibberella/Fusarium species. Fungal Genet. Biol. 31, 7–20.