- Email: [email protected]
Novel method to rapidly and efficiently lyse Escherichia coli for the isolation of recombinant protein
Analytical Biochemistry 528 (2017) 1e6
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Novel method to rapidly and efficiently lyse Escherichia coli for the isolation of recombinant protein Himanshu Joshi, Vikas Jain* Microbiology and Molecular Biology Laboratory, Department of Biological Sciences, Indian Institute of Science Education and Research (IISER), Bhopal, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 26 January 2017 Received in revised form 15 April 2017 Accepted 17 April 2017 Available online 18 April 2017
Rapid and high-throughput protein purification methods are required to explore structure and function of several uncharacterized proteins. Isolation of recombinant protein expressed in Escherichia coli strain BL21 (DE3) depends largely on the efficient and speedy bacterial cell lysis, which is considered as the bottleneck during protein purification. Cells are usually lysed by either sonication or high pressure homogenization, both of which are slow, require special equipment, lead to heat generation, and may result in loss of protein's biological activity. We report here a novel method to lyse E. coli, which is rapid, and results in high yield of isolated protein. Here, we have carried out intracellular expression of lysozyme domain (LD) of mycobacteriophage D29 endolysin. LD remains non-toxic until chloroform is added into the culture medium that permeabilizes bacterial cell membrane and allows the diffusion of LD to the peptidoglycan layer causing latter's degradation ensuing cell lysis. Our method efficiently lyses E. coli in short duration. As a proof-of-concept, we demonstrate large scale isolation and purification of a subunit of E. coli RNA polymerase and GFP, when they are co-expressed with LD. We believe that our method will be adopted easily in high-throughput as well as large scale protein isolation experiments. © 2017 Elsevier Inc. All rights reserved.
Keywords: Rapid lysis Lysozyme Recombinant protein Protein purification Dual expression Membrane permeabilization
Introduction Recombinant protein expression and purification have allowed a detailed examination of proteins, which has greatly enhanced our understanding about myriad of biological functions. A large number of uncharacterized proteins have been expressed in large quantities and have enabled the biochemical, structural and functional studies. E. coli has been the workhorse for both cloning and protein expression [1]. Yeast, insects and mammalian cell systems have also been used to express different proteins [2]. While these systems provide various advantages over E. coli expression system, rapid growth, low cost, large-scale culture, and ease of genetic manipulation of E. coli make it the preferred choice for the production of large quantities of proteins [3,4]. E. coli BL21 (DE3) is one of the most widely used strains for the production of proteins. This strain is devoid of Lon and OmpT proteases and thus shows high protein stability. Further, this strain allows the use of T7
* Corresponding author. Microbiology and Molecular Biology Laboratory, Department of Biological Sciences, Indian Institute of Science Education and Research (IISER), Academic Building 3, Bhopal Bypass Road, Bhauri, Bhopal, 462066, Madhya Pradesh, India. E-mail address: [email protected] (V. Jain). http://dx.doi.org/10.1016/j.ab.2017.04.009 0003-2697/© 2017 Elsevier Inc. All rights reserved.
bacteriophage RNA polymerase-based expression system that is easily controlled and is high yielding [5,6]. Upon addition of an inducer, isopropyl b-D-1-thiogalactopyranoside (IPTG), T7 RNA polymerase is expressed that in turn leads to the transcription of gene cloned downstream of the T7 promoter in the vector. The cellular machinery is thereby biased towards translating large quantities of mRNA produced from the vector resulting in the production of large amounts of recombinant protein. For the expression of eukaryotic genes, BL21 strain has also been modified to express tRNAs recognizing rare codons. To purify the expressed protein in large quantities, it is imperative to ensure effective lysis of cells. The most commonly used methods currently employed are the physical disruption of the cells by sonication and high pressure homogenization [7,8]. These methods are very useful in lysing a large amount of cells. However, the drawbacks of these methods include requirement of special equipment, loss of sample during processing, heat generation, and contamination with other samples. For example, heat generated during sonication can hamper the structure as well as the solubility of the protein. Indeed, it has been reported that the sonication can lead to aggregation of the proteins and reduces the overall biological activity [9]. To overcome these problems, the phage holinendolysin cell lysis system has been viewed as a potential
2
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
alternative to traditional methods used to disrupt cells [10,11]. Recent efforts to develop such a system have been noteworthy. In two separate studies, Ni2þ- and green light-inducible holin-endolysin systems were integrated into the genome of a cyanobacterium Synechocystis sp. PCC 6803 for lysis without carrying out any physical or chemical disruption of cells [12,13]. These results clearly demonstrate the potential of the phage lytic system for cell lysis and isolation of biomolecules. However, such systems are required to be under tight regulation in order to avoid premature cell lysis. Furthermore, these methods cannot be used as general purpose protein production systems. In this paper, we present a novel method to effectively lyse E. coli cells. Here, we have expressed the lysozyme domain (LD) of the D29 mycobacteriophage endolysin. We have previously shown that LD has the ability to lyse E. coli cells [14]. Here we demonstrate that chloroform treatment of cells expressing LD results in rapid lysis of cells with the release of intracellular proteins. Chloroform perturbs the cell membrane that allows LD to diffuse to the cell wall and hydrolyze peptidoglycan, resulting in cell lysis. To further show the utility of the method, two proteins viz. a subunit of RNA polymerase and GFP have been purified after co-expressing them with LD protein. We believe that this method will help in carrying out high throughput protein isolation since sophisticated methods such as sonication and high pressure homogenization are not required. Materials and methods Bacterial strains, reagents, media, and growth condition E. coli XL1-Blue (Stratagene) was used for all cloning procedures, whereas E. coli BL21(DE3) (Novagen) was used for protein expression experiments. Cells were grown in LuriaBertani medium (Difco) supplemented with either 100 mg/ml ampicillin (for experiments involving pET21b vector) or 50 mg/ ml kanamycin (for bacteria carrying pRSFDuet-1 vector), as required, at 37 C, and with constant shaking at 200 rpm. 1.5% agar plates supplemented with either 100 mg/ml ampicillin or 50 mg/ml kanamycin, as required, were used for bacterial growth on solid medium. All the reagents used were of highest quality. Construction of clones pRSFDuet-1 vector (Novagen) possesses two multiple cloning sites (MCS) for the co-expression of two ORFs. The rationale behind using the dual MCS vector was to clone the LD gene in one of the MCSs and the gene of interest in the second MCS. Both ORFs are under T7 promoter. LD gene was PCR amplified from pETGP10LD [14] as template using LD_NcoI (GAGATATACCCATGGCTAGCGCACGC) and T7Rev (GCTAGTTATTGCTCAGCGG) primers. The amplified product was cloned in MCS1 between NcoI and NotI sites to yield pRSF-LD construct; digestion with NotI removed the hexa-histidine codons from this construct. RNAPa and GFP genes were PCR amplified from pETRNAPa (containing E. coli RNA polymerase a subunit; laboratory stock) and pET21b-GFP [15], respectively, using T7prom (CGAAATTAATACGACTCACTATAGGG) and T7Rev primers, such that both genes contained hexa-histidine codons at their 3’. The amplicons obtained were digested with NdeI enzyme that acted at the 50 end. The digested amplicons were ligated in the MCS2 of pRSFDuet-1 vector between NdeI and EcoRV sites to yield pRSF-GFP and pRSF-RNAPa constructs. We also ligated these amplicons in the MCS2 of pRSF-LD to obtain pRSF-LD-RNAPa and pRSF-LD-GFP constructs.
Optimization of chloroform amount required for protein extraction E. coli BL21 (DE3) cells carrying either pET21b empty vector or pETGP10LD (for LD wild-type expression) were grown in 5 ml of LBampicillin at 37 C with constant shaking at 200 rpm. Cells were induced with 1 mM ITPG at OD600 ~ 0.6 and were allowed to grow further for 3 h at 37 C with constant shaking at 200 rpm. Equal amounts of cells at the same OD600 were then harvested and suspended in 500 ml of lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl and 5 mM 2-mercaptoethanol. Chloroform to a final concentration from 0 to 4% (v/v) as specified was added and the suspension was vortexed briefly and kept for shaking at 800 rpm at RT for 15 min. The lysate was centrifuged and 10 ml of supernatant in each case was examined on SDS-PAGE. The gel was stained with Coomassie R-250 dye and imaged.
b-galactosidase assay b-galactosidase assay was performed as described previously with some modifications [16]. Briefly, 5 ml of E. coli BL21 (DE3) cells carrying either pET21b empty vector, pETGP10LD (for LD wild-type expression), or pET-LDR198A (for the expression of R198A mutant of LD) were grown in LB-ampicillin at 37 C with constant shaking at 200 rpm. Induction of protein expression was done with 1 mM ITPG at OD600 ~ 0.6 and the cells were allowed to grow further for 3 h at 37 C with constant shaking at 200 rpm. Equal amount of cells at same OD600 were then harvested and suspended in 500 ml of lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl and 5 mM 2mercaptoethanol. Chloroform to a final concentration of 0.5% (v/v) was added and the suspension was vortexed briefly and kept for shaking at 800 rpm at RT for 15 min. The lysate was centrifuged and the collected supernatant was subjected to b-galactosidase activity estimation using orthonitrophenyl-b-D-galactopyranoside (ONPG) as substrate as described previously [16]. The absorbance at 420 nm was recorded for the different constructs and plotted. Lysing of the cells by sonication To lyse bacterial cells by sonication, 5 ml of E. coli BL21 (DE3) cells carrying either pET21b empty vector, pETGP10LD (for LD wildtype expression), or pET-LDR198A (for the expression of R198A mutant of LD) were grown in LB-ampicillin and induced for protein production with IPTG essentially as described for b-galactosidase assay in section 2.4. Equal amount of cells at same OD600 were then harvested and suspended in 500 ml of lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl and 5 mM 2-mercaptoethanol, and sonicated using a probe sonicator (Sonics). The amplitude was set at 80% and on/off pulse of 10 s duration each was given for 8 min. The lysate was clarified by centrifugation and the equal amounts of supernatant were examined on SDS-PAGE. The gel was stained with Coomassie dye and imaged. Chloroform-based in vivo activity assay The in vivo cell lysis activity of various proteins was elucidated with the help of chloroform assay. The experiment was performed as described previously with modifications [17]. E. coli BL21 (DE3) cells harboring various pRSFDuet-based constructs were grown in LB-kanamycin at 37 C at 200 rpm till OD600 reached ~0.4. The cells were then induced with 1 mM IPTG and were further grown for ~30 min. The culture was transferred to a glass vial and chloroform to a final concentration of 2% (v/v) was added. Brief vortexing was carried out to allow the chloroform to uniformly suspend in the culture. OD600 was then recorded at an interval of 2 min for a time period of 10 min and plotted.
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
Purification of proteins E. coli BL21 (DE3) cells expressing various constructs were grown in LB broth at 37 C with constant shaking at 200 rpm. The cells were induced with 1 mM ITPG at OD600 ~0.6 and were further grown for 3 h at 37 C with constant shaking at 200 rpm. The cells were harvested and suspended in 50 ml lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl, 5 mM imidazole, 5 mM 2mercaptoethanol. Chloroform to a final concentration of 0.5% (v/v) was added and the suspension was then vortexed briefly and was kept on a rotator for 15 min at 4 C. Each suspension was then cleared by centrifugation at 19000 rpm for 45 min at 4 C. The cleared supernatant thus obtained was incubated with 500 ml bed volume of pre-equilibrated Ni-NTA beads (Qiagen) for 1 h and the protein was purified as described previously [18]. 5 elution fractions of 1 ml each were collected and analyzed on SDS-PAGE gel that was stained with Coomassie dye and imaged. Protein purification after lysing the cells using sonication was performed the same way as described above except that instead of chloroform addition, sonication of the cell suspension was carried out using a probe sonicator (Sonics Inc.) to lyse the cells. The amplitude was set at 80% and on/off pulse of 10 s duration each was given for 8 min. Results Treatment of lysozyme-expressing E. coli cells with chloroform results in cell lysis and intracellular protein release We have earlier shown that the lysozyme domain (LD) of mycobacteriophage D29 endolysin is capable of hydrolyzing E. coli peptidoglycan [14]. We envisaged a method to rapidly and efficiently lyse E. coli cells using LD for the isolation of proteins. Production of LD in E. coli cytoplasm does not harm the cell since the substrate for LD, i.e. peptidoglycan, is physically separated from the cytoplasm by means of a cell membrane [14]. Furthermore, we have observed that the addition of small quantities of chloroform (~2% v/ v) in an E. coli culture expressing LD protein leads to a sharp decline in the OD600 values indicative of cell lysis (data not shown). We, therefore, attempted to develop an LD-based method as an effective substitute for the cell lysis through physical disruption (for example, by sonication or high pressure homogenization) and exogenous addition of lysozyme to the cell suspension [19]. We first carried out an optimization of the amount of chloroform required in our cell lysis experiments. We used various chloroform amounts ranging from 0% to 4% to test the optimal value required to extract maximum amount of protein. We observed that addition of 0.5% (v/
3
v) chloroform is sufficient for the protein extraction from E. coli cells having high expression of LD (Fig. 1); cells that do not express LD fail to show such phenomenon. Higher concentrations of chloroform precipitated substantial amount of protein (data not shown) and thus resulted in lower yields. We, therefore, carried out all other experiments by treating E. coli expressing LD protein with 0.5% (v/v) chloroform. We next attempted to assess the lytic efficiency of the intracellularly expressing LD in combination with chloroform by performing b-galactosidase assay. The enzyme b-galactosidase is known to be an intracellular enzyme and its release into the lysate can be used as a tool to estimate the efficiency of cell lysis. Indeed, it has been used to study cell lysis by phage-encoded holin, wherein the activity of holin to disrupt the cell membrane was elucidated with the help of b-galactosidase assay [16,20]. In addition, estimation of the activity of b-galactosidase helped in determining the pore size as well as the lytic efficiency of holin molecules [16,20]. Here, we investigated the ability of LD to rapidly lyse E. coli by estimating the released b-galactosidase activity. An inactive mutant of LD protein, LDR198A (carrying the arginine to alanine substitution at 198 position; unpublished data), was also used along with pET21b empty vector for investigation. All the three constructs were induced for protein expression by IPTG addition; here, the addition of IPTG will also result in the expression of b-galactosidase from the bacterial genomic DNA. Cells expressing LDWT were further subjected to either sonication or 0.5% (v/v) chloroform treatment and the culture supernatant was assayed for the presence of b-galactosidase; sonication procedure acted as a positive control. The substrate, o-nitrophenyl b-D-galactopyranoside, was added to the reaction mixture containing the lysate supernatant obtained after centrifugation. The formation of o-nitrophenol, as a measure of the b-galactosidase activity, was recorded at 420 nm. The cells expressing the wild-type LD protein treated either by chloroform or by sonication showed the maximum and nearly equal A420 values (Fig. 2). On the other hand, the LDR198A and pET21b empty vector treated only with chloroform showed only negligible A420 values (Fig. 2) that can be attributed to the fact that chloroform disrupts the cell membrane and thus results in some amount of b-galactosidase release. Indeed, chloroform is one of the chemicals used in Miller assay, where b-galactosidase activity is measured by permeabilizing the cells using chloroform and sodium dodecylsulfate [21]. In our assay, the wild-type LD hydrolyzes the peptidoglycan layer upon disruption of the cell membrane by chloroform, and results in excessive release of b-galactosidase that is further indicative of the release of large amounts of intracellular proteins in the supernatant. Furthermore, b-galactosidase activity
Fig. 1. Optimization of chloroform amount for cell permeabilization. Different amounts of chloroform as specified were used to test the optimal chloroform concentration for protein extraction. The effect of these amounts of chloroform was assessed on IPTG-induced E. coli BL21 (DE3) cells carrying either pET21b empty vector (A) or expressing wild-type LD (B). M represents the molecular weight marker; few marker bands are labeled. In both A and B, the addition of 0.5% (v/v) chloroform shows the highest protein amount obtained in the lane. Higher amount of chloroform led to protein precipitation and therefore, less protein is visible at higher concentration of chloroform in both the cases.
4
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
These results clearly demonstrate that only the wild-type LD protein lyses E. coli cells upon chloroform treatment. The presence of proteins on the SDS-PAGE gel also suggests that the methodology of wild-type LD expression along with chloroform treatment can be used as a substitute for sonication. Purification of GFP and E. coli RNA polymerase a subunit as a proof of concept of the methodology Fig. 2. b-galactosidase assay as a measure to assess the release of intracellular proteins in the presence of LD. b-galactosidase assay was performed to estimate the extent of cell lysis upon chloroform addition. Chloroform-treated culture supernatants of IPTG-induced E. coli cells were assayed for the presence of b-galactosidase. The cells expressed either wild-type LD (LDWT) or LDR198A (inactive mutant of LD). The empty vector pET21b acted as negative control. Cells expressing LDWT were treated with either chloroform (LDWTCh) or sonication (LDWTSo). The formation of o-nitrophenol was measured by recording the absorbance at 420 nm. The experiments were repeated at least thrice and the data presented here are the average with standard deviation.
of the samples treated with chloroform was found to be similar to that obtained during the sonication, indicating similar levels of cell lysis. Protein yield obtained from chloroform-treated E. coli cells expressing LD is comparable to that from the physical disruption of cells by sonication Sonication is one of the most widely used methods for the physical disruption of bacterial cells [22]. More often than not, it is used for the preparation of recombinant proteins from E. coli. We therefore compared the SDS-PAGE protein profiles of the uninduced (eIPTG) and the induced (þIPTG) E. coli BL21 (DE3) cells having either pET21b empty vector, wild-type LD, or R198A mutant of LD, after suspending the cells in lysis buffer and treating them with either chloroform or sonication (Fig. 3). Here, pET21b empty vector and LDR198A protein were used as controls. Remarkably, the cells containing wild-type LD upon treatment with chloroform yielded the protein profile that was comparable to the sonication in all of the cases (Fig. 3B). In the absence of wild-type LD protein (i.e. the pET21b or the LDR198A), the chloroform treatment resulted in negligible amounts of proteins on the SDS gel (Fig. 3A and C). The untreated samples did not show any protein. These results clearly indicate that the chloroform alone does not lyse the cells but only manages to permeabilize the membrane that results in small amounts of proteins to leak out of the cell. Indeed, as discussed before, chloroform is used as one of the components to permeabilize cell membrane for the release of b-galactosidase [21].
To show the applicability of our method of cell lysis using the LD protein and chloroform, we carried out the expression and purification of two proteins e GFP and a subunit of E. coli RNA polymerase (RNAP). In order to purify the recombinant proteins using this method, we co-expressed either GFP or RNAPa with LD protein using the pRSFDeut-1 vector (Novagen). Both GFP and RNAPa carried a C-terminal histidine tag so as to enable their purification on Ni-NTA metal ion affinity chromatography. We first performed the growth curve experiments to ascertain the lytic capability of the LD protein in the dual protein expression condition. The cells carrying the plasmids were induced with 1 mM IPTG and chloroform was added to the culture after 30 min. The constructs expressing the LD protein along with the GFP (pRSF-LD-GFP) or RNAPa (pRSF-LDRNAPa) showed drastic decline in OD600 upon addition of chloroform suggesting cell lysis (Fig. 4). However, the constructs devoid of the LD protein viz. pRSF-GFP and pRSF-RNAPa did not show such
Fig. 4. Effect of chloroform treatment on cells co-expressing wild-type LD with either GFP or RNAPa proteins. Growth profile of the cells harboring various plasmids was monitored by inducing them with IPTG at OD600 ~ 0.6 and treating them with chloroform after 30 min of induction. pRSFDuet-1 vector was used in all of the studies. pRSF represents the empty vector and the suffix represents the protein being expressed; LD-RNAPa and LD-GFP represent the co-expression of the two proteins. After the addition of chloroform, OD600 was recorded at every 2 min for 10 min. Each data point is an average of three independent experiments with standard deviation.
Fig. 3. Assessment of E. coli cell lysis by sonication and chloroform treatment on SDS-PAGE. Equal amounts of uninduced (eIPTG) and induced (þIPTG) bacterial cultures of empty vector pET21b (A), wild-type LD protein (B) and LDR198A mutant protein (C), at same OD600, were treated with either chloroform (Ch) or sonication (So) as indicated. Culture with no treatment (Nt) were used as control. The suspension in each case was cleared by centrifugation. Coomassie-stained SDS-PAGE gels show the clarified suspension. M represents the molecular weight marker; few marker bands are labeled. Chloroform-treated (Ch) sample of only the LD wild-type protein (B) shows significant amounts of proteins with high molecular weight that is comparable with the sonication (lane So in all the gels).
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
phenomenon upon addition of chloroform (Fig. 4). These results clearly demonstrate that LD is able to efficiently lyse E. coli cells even in the presence of other overexpressed proteins. We also confirmed the expression levels of GFP and RNAPa from pRSF-LDGFP and pRSF-LD-RNAPa plasmids, respectively (data not shown). Finally, we went ahead with the large scale expression and purification of GFP and RNAPa proteins. 500 ml culture volume of E. coli BL21 (DE3) carrying plasmid to express either LD with GFP or LD with RNAPa were induced with 1 mM ITPG at OD600 ~0.6 and were further grown for 3 h at 37 C with constant shaking at 200 rpm. The cells were harvested and resuspended in lysis buffer. 0.5% (v/v) chloroform was then added to each suspension to initiate LD-mediated cell lysis. The cells were incubated at 4 C for 15 min with intermittent shaking. The lysate was cleared by centrifugation and was further processed for protein purification on Ni-NTA chromatography as described elsewhere for other proteins [14]. 5 elution fractions of 1 ml each were collected for both the proteins and were examined on a SDS-PAGE. In all of the elution fractions, the proteins GFP and RNAPa were present. Here, only GFP and RNAPa carried the hexa-histidine tag; LD protein was devoid of any tag to avoid co-purification. The purity of the proteins was estimated to be more than 95% (Fig. 5) from the SDS PAGE gel image. We also compared the GFP protein yields obtained with the help of sonication to that of the LD-chloroform treatment. 1 l culture volume of E. coli BL21 (DE3) expressing LD with GFP was grown as described earlier. The culture was split into two batches of 500 ml each and the cells were harvested. One batch was lysed by sonication, whereas the other half was treated with chloroform. In both cases, the lysate was cleared by centrifugation and further processed for protein purification as described previously. A total of 5 elution fractions of 1 ml each was collected and the samples were examined on an SDS-PAGE. We observed similar elution profile for both the protein purification methods (Fig. 6). Furthermore, the yield of the purified GFP by following the sonication procedure was 5.3 mg/500 ml culture that was equivalent to that obtained from the LD-chloroform treatment method (5.1 mg/500 ml culture). Thus, we conclude that the chloroform-mediated cell lysis method developed here gives yields equivalent to the sonication procedure. Discussion Recombinant protein purification is one of the critical steps in achieving the overall goal of gaining key insights into the structure and function of large number of uncharacterized proteins. E. coli BL21 (DE3) remains, by far, the most preferred strain for the over-
Fig. 5. RNAPa and GFP purification from the chloroform-treated E. coli cells. E. coli BL21 (DE3) cells co-expressing wild-type LD with GFP and wild-type LD with RNAPa were harvested and processed for protein purification on Ni-NTA chromatography. Elution fractions were collected and examined on SDS-PAGE. The gel was stained with Coomassie dye and imaged. The lanes E1-E5 show five eluted fractions that were collected. M represents the molecular weight marker; few marker bands are labeled.
5
Fig. 6. GFP purification from the sonicated and the chloroform-treated E. coli cells. E. coli BL21 (DE3) cells co-expressing wild-type LD with GFP were harvested and processed for protein purification on Ni-NTA chromatography. Elution fractions were collected and examined on SDS-PAGE. GFP (So) represents the elution fractions obtained following the sonication procedure, whereas GFP (Ch) represents the elution fractions from the chloroform-treated samples. The gel was stained with Coomassie dye and imaged. The E1-E5 lanes show five eluted fractions that were collected. M represents the molecular weight marker; few marker bands are labeled.
expression of protein of interest [23]. Effective lysis of E. coli BL21 (DE3) expressing recombinant proteins is imperative in order to obtain large amounts of purified protein. Physical disruption via sonication is one of the most widely used methods to lyse the cells. However, the key disadvantages of this procedure include heating of the sample leading to protein denaturation, limitation of the cell lysis volume, and the requirement of special equipment. The enzymatic digestion of the cell wall peptidoglycan of E. coli with the help of lysozyme is often employed to lyse the cells more effectively. However, the cost involved in this process when treating a large volume of culture along with critical pH and salt requirements make the process less lucrative [19]. Therefore, there is a need for rapid, high-throughput, and cost-effective means for cell lysis for the isolation of proteins. In the present manuscript, we have developed a novel approach to address the problem of effective and rapid lysis of E. coli BL21(DE3) cells. We have utilized the peptidoglycan hydrolyzing ability of the LD domain of mycobacteriophage D29 endolysin to lyse E. coli cells. We previously showed that LD is able to hydrolyze peptidoglycan of Gram positive and Gram negative bacteria [14]. Here, we expressed LD in the cytoplasm and used chloroform as the trigger. Chloroform easily permeabilizes the cell membrane and allows LD to diffuse to the periplasm where it acts upon the bacterial peptidoglycan. We have also optimized the amount of chloroform required to carry out such lysis. The LD-mediated cell lysis was further confirmed by b-galactosidase assay. The LDR198A, an inactive mutant of LD, does not show any cell lysis, thus confirming that the bacterial cell lysis is a result of wild-type LD only. As a proof of concept, we carried out large scale preparation of two proteins viz. a subunit of E. coli RNAP and GFP. These proteins were coexpressed with wild-type LD from the pRSFDuet-1 vector. We observed that both proteins expressed in high quantities and the cells could be readily lysed upon addition of 0.5% chloroform; in the absence of wild-type LD, no cell lysis was observed. Further, both the proteins could be purified on Ni-NTA chromatography. Furthermore, GFP protein isolation with the sonication and the LDchloroform treatment gave similar yields. We thus believe that the current method of lysing the cells is very economical in terms of both cost and time. Furthermore, this process does not require any special equipment. The method presented here can also help to process multiple samples in a short duration, and thus can greatly help in high-throughput experiments.
6
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
Conclusion We have presented here a novel strategy to carry out rapid lysis of E. coli BL21(DE3) cells for the isolation of proteins. Lysozyme is a common molecule that is added in the cell lysis buffer to lyse bacterial cells. Instead, here, we have over-produced a lysozyme domain of mycobacteriophage endolysin within the bacterial cell cytoplasm. Addition of chloroform permeabilizes the membrane and allows the diffusion of the cytoplasmic lysozyme to the peptidoglycan resulting in the latter's hydrolysis. As a proof-ofconcept, we have demonstrated the isolation and purification of two proteins. The large amount of release of b-galactosidase additionally suggests that our strategy can also be used for the isolation of high molecular weight proteins. The vector developed here can be used for the cloning of any gene, in the MCS2, for its expression and protein isolation. We believe that our methodology can be adopted for high-throughput as well as the large scale isolation and purification of recombinant proteins. Acknowledgements H.J. thanks the Council of Scientific and Industrial Research (CSIR), Govt. of India for the senior research fellowship. The work is supported by a grant (BT/PR20257/BBE/117/223/2016) from the Department of Biotechnology, Govt. of India to V.J. References [1] G.L. Rosano, E.A. Ceccarelli, Recombinant protein expression in Escherichia coli: advances and challenges, Front. Microbiol. 5 (2014) 172. [2] A.L. Demain, P. Vaishnav, Production of recombinant proteins by microbes and higher organisms, Biotechnol. Adv. 27 (2009) 297e306. [3] B. Jia, C.O. Jeon, High-throughput recombinant protein expression in Escherichia coli: current status and future perspectives, Open Biol. 6 (2016) 160196. [4] M. Liu, X.J. Feng, Y.M. Ding, G. Zhao, H.Z. Liu, M. Xian, Metabolic engineering of Escherichia coli to improve recombinant protein production, Appl. Microbiol. Biotechnol. 99 (2015) 10367e10377. [5] J.W. Dubendorff, F.W. Studier, Controlling basal expression in an inducible T7 expression system by blocking the target T7 promoter with lac repressor, J. Mol. Biol. 219 (1991) 45e59. [6] F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.W. Dubendorff, Use of T7 RNA polymerase to direct expression of cloned genes, Methods Enzymol. 185 (1990) 60e89. [7] M.S. Doulah, Mechanism of disintegration of biological cells in ultrasonic cavitation, Biotechnol. Bioeng. 19 (1977) 649e660.
[8] J.X. Feliu, R. Cubarsi, A. Villaverde, Optimized release of recombinant proteins by ultrasonication of E. coli cells, Biotechnol. Bioeng. 58 (1998) 536e540. [9] S. Peternel, R. Komel, Isolation of biologically active nanomaterial (inclusion bodies) from bacterial cells, Microb. Cell Fact. 9 (2010). [10] Y. Gao, X. Feng, M. Xian, Q. Wang, G. Zhao, Inducible cell lysis systems in microbial production of bio-based chemicals, Appl. Microbiol. Biotechnol. 97 (2013) 7121e7129. [11] M.H. Saier, B.L. Reddy, Holins in bacteria, eukaryotes, and archaea: multifunctional xenologues with potential biotechnological and biomedical applications, J. Bacteriol. 197 (2015) 7e17. [12] X.Y. Liu, R. Curtiss, Nickel-inducible lysis system in Synechocystis sp PCC 6803, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 21550e21554. [13] K. Miyake, K. Abe, S. Ferri, M. Nakajima, M. Nakamura, W. Yoshida, K. Kojima, K. Ikebukuro, K. Sode, A green-light inducible lytic system for cyanobacterial cells, Biotechnol. Biofuels 7 (2014) 56. [14] A.A. Pohane, H. Joshi, V. Jain, Molecular dissection of phage endolysin: an interdomain interaction confers host specificity in Lysin A of Mycobacterium phage D29, J. Biol. Chem. 289 (2014) 12085e12095. [15] A.A. Dubey, M.I. Singh, V. Jain, Rapid and robust PCR-based all-recombinant cloning methodology, PLoS One 11 (2016) e0152106. [16] S. Kamilla, V. Jain, Mycobacteriophage D29 holin C-terminal region functionally assists in holin aggregation and bacterial cell death, FEBS J. 283 (2016) 173e190. [17] M. Henry, M. Begley, H. Neve, F. Maher, R.P. Ross, O. McAuliffe, A. Coffey, J.M. O'Mahony, Cloning and expression of a mureinolytic enzyme from the mycobacteriophage TM4, FEMS Microbiol. Lett. 311 (2010) 126e132. [18] M.I. Singh, V. Jain, Tagging the expressed protein with 6 histidines: rapid cloning of an amplicon with three options, Plos One 8 (2013). [19] S. Graslund, P. Nordlund, J. Weigelt, B.M. Hallberg, J. Bray, O. Gileadi, S. Knapp, U. Oppermann, C. Arrowsmith, R. Hui, J. Ming, S. dhe-Paganon, H.W. Park, A. Savchenko, A. Yee, A. Edwards, R. Vincentelli, C. Cambillau, R. Kim, S.H. Kim, Z. Rao, Y. Shi, T.C. Terwilliger, C.Y. Kim, L.W. Hung, G.S. Waldo, Y. Peleg, S. Albeck, T. Unger, O. Dym, J. Prilusky, J.L. Sussman, R.C. Stevens, S.A. Lesley, I.A. Wilson, A. Joachimiak, F. Collart, I. Dementieva, M.I. Donnelly, W.H. Eschenfeldt, Y. Kim, L. Stols, R. Wu, M. Zhou, S.K. Burley, J.S. Emtage, J.M. Sauder, D. Thompson, K. Bain, J. Luz, T. Gheyi, F. Zhang, S. Atwell, S.C. Almo, J.B. Bonanno, A. Fiser, S. Swaminathan, F.W. Studier, M.R. Chance, A. Sali, T.B. Acton, R. Xiao, L. Zhao, L.C. Ma, J.F. Hunt, L. Tong, K. Cunningham, M. Inouye, S. Anderson, H. Janjua, R. Shastry, C.K. Ho, D. Wang, H. Wang, M. Jiang, G.T. Montelione, D.I. Stuart, R.J. Owens, S. Daenke, A. Schutz, U. Heinemann, S. Yokoyama, K. Bussow, K.C. Gunsalus, Protein production and purification, Nat. Methods 5 (2008) 135e146. [20] M.J. Catalao, F. Gil, J. Moniz-Pereira, M. Pimentel, Functional analysis of the holin-like proteins of mycobacteriophage Ms6, J. Bacteriol. 193 (2011) 2793e2803. [21] J.H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972. [22] Y. Kim, G. Babnigg, R. Jedrzejczak, W.H. Eschenfeldt, H. Li, N. Maltseva, C. Hatzos-Skintges, M. Gu, M. Makowska-Grzyska, R. Wu, H. An, G. Chhor, A. Joachimiak, High-throughput protein purification and quality assessment for crystallization, Methods 55 (2011) 12e28. [23] G.J. Gopal, A. Kumar, Strategies for the production of recombinant protein in Escherichia coli, Prot. J. 32 (2013) 419e425.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Novel method to rapidly and efficiently lyse Escherichia coli for the isolation of recombinant protein Himanshu Joshi, Vikas Jain* Microbiology and Molecular Biology Laboratory, Department of Biological Sciences, Indian Institute of Science Education and Research (IISER), Bhopal, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 26 January 2017 Received in revised form 15 April 2017 Accepted 17 April 2017 Available online 18 April 2017
Rapid and high-throughput protein purification methods are required to explore structure and function of several uncharacterized proteins. Isolation of recombinant protein expressed in Escherichia coli strain BL21 (DE3) depends largely on the efficient and speedy bacterial cell lysis, which is considered as the bottleneck during protein purification. Cells are usually lysed by either sonication or high pressure homogenization, both of which are slow, require special equipment, lead to heat generation, and may result in loss of protein's biological activity. We report here a novel method to lyse E. coli, which is rapid, and results in high yield of isolated protein. Here, we have carried out intracellular expression of lysozyme domain (LD) of mycobacteriophage D29 endolysin. LD remains non-toxic until chloroform is added into the culture medium that permeabilizes bacterial cell membrane and allows the diffusion of LD to the peptidoglycan layer causing latter's degradation ensuing cell lysis. Our method efficiently lyses E. coli in short duration. As a proof-of-concept, we demonstrate large scale isolation and purification of a subunit of E. coli RNA polymerase and GFP, when they are co-expressed with LD. We believe that our method will be adopted easily in high-throughput as well as large scale protein isolation experiments. © 2017 Elsevier Inc. All rights reserved.
Keywords: Rapid lysis Lysozyme Recombinant protein Protein purification Dual expression Membrane permeabilization
Introduction Recombinant protein expression and purification have allowed a detailed examination of proteins, which has greatly enhanced our understanding about myriad of biological functions. A large number of uncharacterized proteins have been expressed in large quantities and have enabled the biochemical, structural and functional studies. E. coli has been the workhorse for both cloning and protein expression [1]. Yeast, insects and mammalian cell systems have also been used to express different proteins [2]. While these systems provide various advantages over E. coli expression system, rapid growth, low cost, large-scale culture, and ease of genetic manipulation of E. coli make it the preferred choice for the production of large quantities of proteins [3,4]. E. coli BL21 (DE3) is one of the most widely used strains for the production of proteins. This strain is devoid of Lon and OmpT proteases and thus shows high protein stability. Further, this strain allows the use of T7
* Corresponding author. Microbiology and Molecular Biology Laboratory, Department of Biological Sciences, Indian Institute of Science Education and Research (IISER), Academic Building 3, Bhopal Bypass Road, Bhauri, Bhopal, 462066, Madhya Pradesh, India. E-mail address: [email protected] (V. Jain). http://dx.doi.org/10.1016/j.ab.2017.04.009 0003-2697/© 2017 Elsevier Inc. All rights reserved.
bacteriophage RNA polymerase-based expression system that is easily controlled and is high yielding [5,6]. Upon addition of an inducer, isopropyl b-D-1-thiogalactopyranoside (IPTG), T7 RNA polymerase is expressed that in turn leads to the transcription of gene cloned downstream of the T7 promoter in the vector. The cellular machinery is thereby biased towards translating large quantities of mRNA produced from the vector resulting in the production of large amounts of recombinant protein. For the expression of eukaryotic genes, BL21 strain has also been modified to express tRNAs recognizing rare codons. To purify the expressed protein in large quantities, it is imperative to ensure effective lysis of cells. The most commonly used methods currently employed are the physical disruption of the cells by sonication and high pressure homogenization [7,8]. These methods are very useful in lysing a large amount of cells. However, the drawbacks of these methods include requirement of special equipment, loss of sample during processing, heat generation, and contamination with other samples. For example, heat generated during sonication can hamper the structure as well as the solubility of the protein. Indeed, it has been reported that the sonication can lead to aggregation of the proteins and reduces the overall biological activity [9]. To overcome these problems, the phage holinendolysin cell lysis system has been viewed as a potential
2
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
alternative to traditional methods used to disrupt cells [10,11]. Recent efforts to develop such a system have been noteworthy. In two separate studies, Ni2þ- and green light-inducible holin-endolysin systems were integrated into the genome of a cyanobacterium Synechocystis sp. PCC 6803 for lysis without carrying out any physical or chemical disruption of cells [12,13]. These results clearly demonstrate the potential of the phage lytic system for cell lysis and isolation of biomolecules. However, such systems are required to be under tight regulation in order to avoid premature cell lysis. Furthermore, these methods cannot be used as general purpose protein production systems. In this paper, we present a novel method to effectively lyse E. coli cells. Here, we have expressed the lysozyme domain (LD) of the D29 mycobacteriophage endolysin. We have previously shown that LD has the ability to lyse E. coli cells [14]. Here we demonstrate that chloroform treatment of cells expressing LD results in rapid lysis of cells with the release of intracellular proteins. Chloroform perturbs the cell membrane that allows LD to diffuse to the cell wall and hydrolyze peptidoglycan, resulting in cell lysis. To further show the utility of the method, two proteins viz. a subunit of RNA polymerase and GFP have been purified after co-expressing them with LD protein. We believe that this method will help in carrying out high throughput protein isolation since sophisticated methods such as sonication and high pressure homogenization are not required. Materials and methods Bacterial strains, reagents, media, and growth condition E. coli XL1-Blue (Stratagene) was used for all cloning procedures, whereas E. coli BL21(DE3) (Novagen) was used for protein expression experiments. Cells were grown in LuriaBertani medium (Difco) supplemented with either 100 mg/ml ampicillin (for experiments involving pET21b vector) or 50 mg/ ml kanamycin (for bacteria carrying pRSFDuet-1 vector), as required, at 37 C, and with constant shaking at 200 rpm. 1.5% agar plates supplemented with either 100 mg/ml ampicillin or 50 mg/ml kanamycin, as required, were used for bacterial growth on solid medium. All the reagents used were of highest quality. Construction of clones pRSFDuet-1 vector (Novagen) possesses two multiple cloning sites (MCS) for the co-expression of two ORFs. The rationale behind using the dual MCS vector was to clone the LD gene in one of the MCSs and the gene of interest in the second MCS. Both ORFs are under T7 promoter. LD gene was PCR amplified from pETGP10LD [14] as template using LD_NcoI (GAGATATACCCATGGCTAGCGCACGC) and T7Rev (GCTAGTTATTGCTCAGCGG) primers. The amplified product was cloned in MCS1 between NcoI and NotI sites to yield pRSF-LD construct; digestion with NotI removed the hexa-histidine codons from this construct. RNAPa and GFP genes were PCR amplified from pETRNAPa (containing E. coli RNA polymerase a subunit; laboratory stock) and pET21b-GFP [15], respectively, using T7prom (CGAAATTAATACGACTCACTATAGGG) and T7Rev primers, such that both genes contained hexa-histidine codons at their 3’. The amplicons obtained were digested with NdeI enzyme that acted at the 50 end. The digested amplicons were ligated in the MCS2 of pRSFDuet-1 vector between NdeI and EcoRV sites to yield pRSF-GFP and pRSF-RNAPa constructs. We also ligated these amplicons in the MCS2 of pRSF-LD to obtain pRSF-LD-RNAPa and pRSF-LD-GFP constructs.
Optimization of chloroform amount required for protein extraction E. coli BL21 (DE3) cells carrying either pET21b empty vector or pETGP10LD (for LD wild-type expression) were grown in 5 ml of LBampicillin at 37 C with constant shaking at 200 rpm. Cells were induced with 1 mM ITPG at OD600 ~ 0.6 and were allowed to grow further for 3 h at 37 C with constant shaking at 200 rpm. Equal amounts of cells at the same OD600 were then harvested and suspended in 500 ml of lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl and 5 mM 2-mercaptoethanol. Chloroform to a final concentration from 0 to 4% (v/v) as specified was added and the suspension was vortexed briefly and kept for shaking at 800 rpm at RT for 15 min. The lysate was centrifuged and 10 ml of supernatant in each case was examined on SDS-PAGE. The gel was stained with Coomassie R-250 dye and imaged.
b-galactosidase assay b-galactosidase assay was performed as described previously with some modifications [16]. Briefly, 5 ml of E. coli BL21 (DE3) cells carrying either pET21b empty vector, pETGP10LD (for LD wild-type expression), or pET-LDR198A (for the expression of R198A mutant of LD) were grown in LB-ampicillin at 37 C with constant shaking at 200 rpm. Induction of protein expression was done with 1 mM ITPG at OD600 ~ 0.6 and the cells were allowed to grow further for 3 h at 37 C with constant shaking at 200 rpm. Equal amount of cells at same OD600 were then harvested and suspended in 500 ml of lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl and 5 mM 2mercaptoethanol. Chloroform to a final concentration of 0.5% (v/v) was added and the suspension was vortexed briefly and kept for shaking at 800 rpm at RT for 15 min. The lysate was centrifuged and the collected supernatant was subjected to b-galactosidase activity estimation using orthonitrophenyl-b-D-galactopyranoside (ONPG) as substrate as described previously [16]. The absorbance at 420 nm was recorded for the different constructs and plotted. Lysing of the cells by sonication To lyse bacterial cells by sonication, 5 ml of E. coli BL21 (DE3) cells carrying either pET21b empty vector, pETGP10LD (for LD wildtype expression), or pET-LDR198A (for the expression of R198A mutant of LD) were grown in LB-ampicillin and induced for protein production with IPTG essentially as described for b-galactosidase assay in section 2.4. Equal amount of cells at same OD600 were then harvested and suspended in 500 ml of lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl and 5 mM 2-mercaptoethanol, and sonicated using a probe sonicator (Sonics). The amplitude was set at 80% and on/off pulse of 10 s duration each was given for 8 min. The lysate was clarified by centrifugation and the equal amounts of supernatant were examined on SDS-PAGE. The gel was stained with Coomassie dye and imaged. Chloroform-based in vivo activity assay The in vivo cell lysis activity of various proteins was elucidated with the help of chloroform assay. The experiment was performed as described previously with modifications [17]. E. coli BL21 (DE3) cells harboring various pRSFDuet-based constructs were grown in LB-kanamycin at 37 C at 200 rpm till OD600 reached ~0.4. The cells were then induced with 1 mM IPTG and were further grown for ~30 min. The culture was transferred to a glass vial and chloroform to a final concentration of 2% (v/v) was added. Brief vortexing was carried out to allow the chloroform to uniformly suspend in the culture. OD600 was then recorded at an interval of 2 min for a time period of 10 min and plotted.
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
Purification of proteins E. coli BL21 (DE3) cells expressing various constructs were grown in LB broth at 37 C with constant shaking at 200 rpm. The cells were induced with 1 mM ITPG at OD600 ~0.6 and were further grown for 3 h at 37 C with constant shaking at 200 rpm. The cells were harvested and suspended in 50 ml lysis buffer containing 40 mM TrisCl pH 8.0, 200 mM NaCl, 5 mM imidazole, 5 mM 2mercaptoethanol. Chloroform to a final concentration of 0.5% (v/v) was added and the suspension was then vortexed briefly and was kept on a rotator for 15 min at 4 C. Each suspension was then cleared by centrifugation at 19000 rpm for 45 min at 4 C. The cleared supernatant thus obtained was incubated with 500 ml bed volume of pre-equilibrated Ni-NTA beads (Qiagen) for 1 h and the protein was purified as described previously [18]. 5 elution fractions of 1 ml each were collected and analyzed on SDS-PAGE gel that was stained with Coomassie dye and imaged. Protein purification after lysing the cells using sonication was performed the same way as described above except that instead of chloroform addition, sonication of the cell suspension was carried out using a probe sonicator (Sonics Inc.) to lyse the cells. The amplitude was set at 80% and on/off pulse of 10 s duration each was given for 8 min. Results Treatment of lysozyme-expressing E. coli cells with chloroform results in cell lysis and intracellular protein release We have earlier shown that the lysozyme domain (LD) of mycobacteriophage D29 endolysin is capable of hydrolyzing E. coli peptidoglycan [14]. We envisaged a method to rapidly and efficiently lyse E. coli cells using LD for the isolation of proteins. Production of LD in E. coli cytoplasm does not harm the cell since the substrate for LD, i.e. peptidoglycan, is physically separated from the cytoplasm by means of a cell membrane [14]. Furthermore, we have observed that the addition of small quantities of chloroform (~2% v/ v) in an E. coli culture expressing LD protein leads to a sharp decline in the OD600 values indicative of cell lysis (data not shown). We, therefore, attempted to develop an LD-based method as an effective substitute for the cell lysis through physical disruption (for example, by sonication or high pressure homogenization) and exogenous addition of lysozyme to the cell suspension [19]. We first carried out an optimization of the amount of chloroform required in our cell lysis experiments. We used various chloroform amounts ranging from 0% to 4% to test the optimal value required to extract maximum amount of protein. We observed that addition of 0.5% (v/
3
v) chloroform is sufficient for the protein extraction from E. coli cells having high expression of LD (Fig. 1); cells that do not express LD fail to show such phenomenon. Higher concentrations of chloroform precipitated substantial amount of protein (data not shown) and thus resulted in lower yields. We, therefore, carried out all other experiments by treating E. coli expressing LD protein with 0.5% (v/v) chloroform. We next attempted to assess the lytic efficiency of the intracellularly expressing LD in combination with chloroform by performing b-galactosidase assay. The enzyme b-galactosidase is known to be an intracellular enzyme and its release into the lysate can be used as a tool to estimate the efficiency of cell lysis. Indeed, it has been used to study cell lysis by phage-encoded holin, wherein the activity of holin to disrupt the cell membrane was elucidated with the help of b-galactosidase assay [16,20]. In addition, estimation of the activity of b-galactosidase helped in determining the pore size as well as the lytic efficiency of holin molecules [16,20]. Here, we investigated the ability of LD to rapidly lyse E. coli by estimating the released b-galactosidase activity. An inactive mutant of LD protein, LDR198A (carrying the arginine to alanine substitution at 198 position; unpublished data), was also used along with pET21b empty vector for investigation. All the three constructs were induced for protein expression by IPTG addition; here, the addition of IPTG will also result in the expression of b-galactosidase from the bacterial genomic DNA. Cells expressing LDWT were further subjected to either sonication or 0.5% (v/v) chloroform treatment and the culture supernatant was assayed for the presence of b-galactosidase; sonication procedure acted as a positive control. The substrate, o-nitrophenyl b-D-galactopyranoside, was added to the reaction mixture containing the lysate supernatant obtained after centrifugation. The formation of o-nitrophenol, as a measure of the b-galactosidase activity, was recorded at 420 nm. The cells expressing the wild-type LD protein treated either by chloroform or by sonication showed the maximum and nearly equal A420 values (Fig. 2). On the other hand, the LDR198A and pET21b empty vector treated only with chloroform showed only negligible A420 values (Fig. 2) that can be attributed to the fact that chloroform disrupts the cell membrane and thus results in some amount of b-galactosidase release. Indeed, chloroform is one of the chemicals used in Miller assay, where b-galactosidase activity is measured by permeabilizing the cells using chloroform and sodium dodecylsulfate [21]. In our assay, the wild-type LD hydrolyzes the peptidoglycan layer upon disruption of the cell membrane by chloroform, and results in excessive release of b-galactosidase that is further indicative of the release of large amounts of intracellular proteins in the supernatant. Furthermore, b-galactosidase activity
Fig. 1. Optimization of chloroform amount for cell permeabilization. Different amounts of chloroform as specified were used to test the optimal chloroform concentration for protein extraction. The effect of these amounts of chloroform was assessed on IPTG-induced E. coli BL21 (DE3) cells carrying either pET21b empty vector (A) or expressing wild-type LD (B). M represents the molecular weight marker; few marker bands are labeled. In both A and B, the addition of 0.5% (v/v) chloroform shows the highest protein amount obtained in the lane. Higher amount of chloroform led to protein precipitation and therefore, less protein is visible at higher concentration of chloroform in both the cases.
4
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
These results clearly demonstrate that only the wild-type LD protein lyses E. coli cells upon chloroform treatment. The presence of proteins on the SDS-PAGE gel also suggests that the methodology of wild-type LD expression along with chloroform treatment can be used as a substitute for sonication. Purification of GFP and E. coli RNA polymerase a subunit as a proof of concept of the methodology Fig. 2. b-galactosidase assay as a measure to assess the release of intracellular proteins in the presence of LD. b-galactosidase assay was performed to estimate the extent of cell lysis upon chloroform addition. Chloroform-treated culture supernatants of IPTG-induced E. coli cells were assayed for the presence of b-galactosidase. The cells expressed either wild-type LD (LDWT) or LDR198A (inactive mutant of LD). The empty vector pET21b acted as negative control. Cells expressing LDWT were treated with either chloroform (LDWTCh) or sonication (LDWTSo). The formation of o-nitrophenol was measured by recording the absorbance at 420 nm. The experiments were repeated at least thrice and the data presented here are the average with standard deviation.
of the samples treated with chloroform was found to be similar to that obtained during the sonication, indicating similar levels of cell lysis. Protein yield obtained from chloroform-treated E. coli cells expressing LD is comparable to that from the physical disruption of cells by sonication Sonication is one of the most widely used methods for the physical disruption of bacterial cells [22]. More often than not, it is used for the preparation of recombinant proteins from E. coli. We therefore compared the SDS-PAGE protein profiles of the uninduced (eIPTG) and the induced (þIPTG) E. coli BL21 (DE3) cells having either pET21b empty vector, wild-type LD, or R198A mutant of LD, after suspending the cells in lysis buffer and treating them with either chloroform or sonication (Fig. 3). Here, pET21b empty vector and LDR198A protein were used as controls. Remarkably, the cells containing wild-type LD upon treatment with chloroform yielded the protein profile that was comparable to the sonication in all of the cases (Fig. 3B). In the absence of wild-type LD protein (i.e. the pET21b or the LDR198A), the chloroform treatment resulted in negligible amounts of proteins on the SDS gel (Fig. 3A and C). The untreated samples did not show any protein. These results clearly indicate that the chloroform alone does not lyse the cells but only manages to permeabilize the membrane that results in small amounts of proteins to leak out of the cell. Indeed, as discussed before, chloroform is used as one of the components to permeabilize cell membrane for the release of b-galactosidase [21].
To show the applicability of our method of cell lysis using the LD protein and chloroform, we carried out the expression and purification of two proteins e GFP and a subunit of E. coli RNA polymerase (RNAP). In order to purify the recombinant proteins using this method, we co-expressed either GFP or RNAPa with LD protein using the pRSFDeut-1 vector (Novagen). Both GFP and RNAPa carried a C-terminal histidine tag so as to enable their purification on Ni-NTA metal ion affinity chromatography. We first performed the growth curve experiments to ascertain the lytic capability of the LD protein in the dual protein expression condition. The cells carrying the plasmids were induced with 1 mM IPTG and chloroform was added to the culture after 30 min. The constructs expressing the LD protein along with the GFP (pRSF-LD-GFP) or RNAPa (pRSF-LDRNAPa) showed drastic decline in OD600 upon addition of chloroform suggesting cell lysis (Fig. 4). However, the constructs devoid of the LD protein viz. pRSF-GFP and pRSF-RNAPa did not show such
Fig. 4. Effect of chloroform treatment on cells co-expressing wild-type LD with either GFP or RNAPa proteins. Growth profile of the cells harboring various plasmids was monitored by inducing them with IPTG at OD600 ~ 0.6 and treating them with chloroform after 30 min of induction. pRSFDuet-1 vector was used in all of the studies. pRSF represents the empty vector and the suffix represents the protein being expressed; LD-RNAPa and LD-GFP represent the co-expression of the two proteins. After the addition of chloroform, OD600 was recorded at every 2 min for 10 min. Each data point is an average of three independent experiments with standard deviation.
Fig. 3. Assessment of E. coli cell lysis by sonication and chloroform treatment on SDS-PAGE. Equal amounts of uninduced (eIPTG) and induced (þIPTG) bacterial cultures of empty vector pET21b (A), wild-type LD protein (B) and LDR198A mutant protein (C), at same OD600, were treated with either chloroform (Ch) or sonication (So) as indicated. Culture with no treatment (Nt) were used as control. The suspension in each case was cleared by centrifugation. Coomassie-stained SDS-PAGE gels show the clarified suspension. M represents the molecular weight marker; few marker bands are labeled. Chloroform-treated (Ch) sample of only the LD wild-type protein (B) shows significant amounts of proteins with high molecular weight that is comparable with the sonication (lane So in all the gels).
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
phenomenon upon addition of chloroform (Fig. 4). These results clearly demonstrate that LD is able to efficiently lyse E. coli cells even in the presence of other overexpressed proteins. We also confirmed the expression levels of GFP and RNAPa from pRSF-LDGFP and pRSF-LD-RNAPa plasmids, respectively (data not shown). Finally, we went ahead with the large scale expression and purification of GFP and RNAPa proteins. 500 ml culture volume of E. coli BL21 (DE3) carrying plasmid to express either LD with GFP or LD with RNAPa were induced with 1 mM ITPG at OD600 ~0.6 and were further grown for 3 h at 37 C with constant shaking at 200 rpm. The cells were harvested and resuspended in lysis buffer. 0.5% (v/v) chloroform was then added to each suspension to initiate LD-mediated cell lysis. The cells were incubated at 4 C for 15 min with intermittent shaking. The lysate was cleared by centrifugation and was further processed for protein purification on Ni-NTA chromatography as described elsewhere for other proteins [14]. 5 elution fractions of 1 ml each were collected for both the proteins and were examined on a SDS-PAGE. In all of the elution fractions, the proteins GFP and RNAPa were present. Here, only GFP and RNAPa carried the hexa-histidine tag; LD protein was devoid of any tag to avoid co-purification. The purity of the proteins was estimated to be more than 95% (Fig. 5) from the SDS PAGE gel image. We also compared the GFP protein yields obtained with the help of sonication to that of the LD-chloroform treatment. 1 l culture volume of E. coli BL21 (DE3) expressing LD with GFP was grown as described earlier. The culture was split into two batches of 500 ml each and the cells were harvested. One batch was lysed by sonication, whereas the other half was treated with chloroform. In both cases, the lysate was cleared by centrifugation and further processed for protein purification as described previously. A total of 5 elution fractions of 1 ml each was collected and the samples were examined on an SDS-PAGE. We observed similar elution profile for both the protein purification methods (Fig. 6). Furthermore, the yield of the purified GFP by following the sonication procedure was 5.3 mg/500 ml culture that was equivalent to that obtained from the LD-chloroform treatment method (5.1 mg/500 ml culture). Thus, we conclude that the chloroform-mediated cell lysis method developed here gives yields equivalent to the sonication procedure. Discussion Recombinant protein purification is one of the critical steps in achieving the overall goal of gaining key insights into the structure and function of large number of uncharacterized proteins. E. coli BL21 (DE3) remains, by far, the most preferred strain for the over-
Fig. 5. RNAPa and GFP purification from the chloroform-treated E. coli cells. E. coli BL21 (DE3) cells co-expressing wild-type LD with GFP and wild-type LD with RNAPa were harvested and processed for protein purification on Ni-NTA chromatography. Elution fractions were collected and examined on SDS-PAGE. The gel was stained with Coomassie dye and imaged. The lanes E1-E5 show five eluted fractions that were collected. M represents the molecular weight marker; few marker bands are labeled.
5
Fig. 6. GFP purification from the sonicated and the chloroform-treated E. coli cells. E. coli BL21 (DE3) cells co-expressing wild-type LD with GFP were harvested and processed for protein purification on Ni-NTA chromatography. Elution fractions were collected and examined on SDS-PAGE. GFP (So) represents the elution fractions obtained following the sonication procedure, whereas GFP (Ch) represents the elution fractions from the chloroform-treated samples. The gel was stained with Coomassie dye and imaged. The E1-E5 lanes show five eluted fractions that were collected. M represents the molecular weight marker; few marker bands are labeled.
expression of protein of interest [23]. Effective lysis of E. coli BL21 (DE3) expressing recombinant proteins is imperative in order to obtain large amounts of purified protein. Physical disruption via sonication is one of the most widely used methods to lyse the cells. However, the key disadvantages of this procedure include heating of the sample leading to protein denaturation, limitation of the cell lysis volume, and the requirement of special equipment. The enzymatic digestion of the cell wall peptidoglycan of E. coli with the help of lysozyme is often employed to lyse the cells more effectively. However, the cost involved in this process when treating a large volume of culture along with critical pH and salt requirements make the process less lucrative [19]. Therefore, there is a need for rapid, high-throughput, and cost-effective means for cell lysis for the isolation of proteins. In the present manuscript, we have developed a novel approach to address the problem of effective and rapid lysis of E. coli BL21(DE3) cells. We have utilized the peptidoglycan hydrolyzing ability of the LD domain of mycobacteriophage D29 endolysin to lyse E. coli cells. We previously showed that LD is able to hydrolyze peptidoglycan of Gram positive and Gram negative bacteria [14]. Here, we expressed LD in the cytoplasm and used chloroform as the trigger. Chloroform easily permeabilizes the cell membrane and allows LD to diffuse to the periplasm where it acts upon the bacterial peptidoglycan. We have also optimized the amount of chloroform required to carry out such lysis. The LD-mediated cell lysis was further confirmed by b-galactosidase assay. The LDR198A, an inactive mutant of LD, does not show any cell lysis, thus confirming that the bacterial cell lysis is a result of wild-type LD only. As a proof of concept, we carried out large scale preparation of two proteins viz. a subunit of E. coli RNAP and GFP. These proteins were coexpressed with wild-type LD from the pRSFDuet-1 vector. We observed that both proteins expressed in high quantities and the cells could be readily lysed upon addition of 0.5% chloroform; in the absence of wild-type LD, no cell lysis was observed. Further, both the proteins could be purified on Ni-NTA chromatography. Furthermore, GFP protein isolation with the sonication and the LDchloroform treatment gave similar yields. We thus believe that the current method of lysing the cells is very economical in terms of both cost and time. Furthermore, this process does not require any special equipment. The method presented here can also help to process multiple samples in a short duration, and thus can greatly help in high-throughput experiments.
6
H. Joshi, V. Jain / Analytical Biochemistry 528 (2017) 1e6
Conclusion We have presented here a novel strategy to carry out rapid lysis of E. coli BL21(DE3) cells for the isolation of proteins. Lysozyme is a common molecule that is added in the cell lysis buffer to lyse bacterial cells. Instead, here, we have over-produced a lysozyme domain of mycobacteriophage endolysin within the bacterial cell cytoplasm. Addition of chloroform permeabilizes the membrane and allows the diffusion of the cytoplasmic lysozyme to the peptidoglycan resulting in the latter's hydrolysis. As a proof-ofconcept, we have demonstrated the isolation and purification of two proteins. The large amount of release of b-galactosidase additionally suggests that our strategy can also be used for the isolation of high molecular weight proteins. The vector developed here can be used for the cloning of any gene, in the MCS2, for its expression and protein isolation. We believe that our methodology can be adopted for high-throughput as well as the large scale isolation and purification of recombinant proteins. Acknowledgements H.J. thanks the Council of Scientific and Industrial Research (CSIR), Govt. of India for the senior research fellowship. The work is supported by a grant (BT/PR20257/BBE/117/223/2016) from the Department of Biotechnology, Govt. of India to V.J. References [1] G.L. Rosano, E.A. Ceccarelli, Recombinant protein expression in Escherichia coli: advances and challenges, Front. Microbiol. 5 (2014) 172. [2] A.L. Demain, P. Vaishnav, Production of recombinant proteins by microbes and higher organisms, Biotechnol. Adv. 27 (2009) 297e306. [3] B. Jia, C.O. Jeon, High-throughput recombinant protein expression in Escherichia coli: current status and future perspectives, Open Biol. 6 (2016) 160196. [4] M. Liu, X.J. Feng, Y.M. Ding, G. Zhao, H.Z. Liu, M. Xian, Metabolic engineering of Escherichia coli to improve recombinant protein production, Appl. Microbiol. Biotechnol. 99 (2015) 10367e10377. [5] J.W. Dubendorff, F.W. Studier, Controlling basal expression in an inducible T7 expression system by blocking the target T7 promoter with lac repressor, J. Mol. Biol. 219 (1991) 45e59. [6] F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.W. Dubendorff, Use of T7 RNA polymerase to direct expression of cloned genes, Methods Enzymol. 185 (1990) 60e89. [7] M.S. Doulah, Mechanism of disintegration of biological cells in ultrasonic cavitation, Biotechnol. Bioeng. 19 (1977) 649e660.
[8] J.X. Feliu, R. Cubarsi, A. Villaverde, Optimized release of recombinant proteins by ultrasonication of E. coli cells, Biotechnol. Bioeng. 58 (1998) 536e540. [9] S. Peternel, R. Komel, Isolation of biologically active nanomaterial (inclusion bodies) from bacterial cells, Microb. Cell Fact. 9 (2010). [10] Y. Gao, X. Feng, M. Xian, Q. Wang, G. Zhao, Inducible cell lysis systems in microbial production of bio-based chemicals, Appl. Microbiol. Biotechnol. 97 (2013) 7121e7129. [11] M.H. Saier, B.L. Reddy, Holins in bacteria, eukaryotes, and archaea: multifunctional xenologues with potential biotechnological and biomedical applications, J. Bacteriol. 197 (2015) 7e17. [12] X.Y. Liu, R. Curtiss, Nickel-inducible lysis system in Synechocystis sp PCC 6803, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 21550e21554. [13] K. Miyake, K. Abe, S. Ferri, M. Nakajima, M. Nakamura, W. Yoshida, K. Kojima, K. Ikebukuro, K. Sode, A green-light inducible lytic system for cyanobacterial cells, Biotechnol. Biofuels 7 (2014) 56. [14] A.A. Pohane, H. Joshi, V. Jain, Molecular dissection of phage endolysin: an interdomain interaction confers host specificity in Lysin A of Mycobacterium phage D29, J. Biol. Chem. 289 (2014) 12085e12095. [15] A.A. Dubey, M.I. Singh, V. Jain, Rapid and robust PCR-based all-recombinant cloning methodology, PLoS One 11 (2016) e0152106. [16] S. Kamilla, V. Jain, Mycobacteriophage D29 holin C-terminal region functionally assists in holin aggregation and bacterial cell death, FEBS J. 283 (2016) 173e190. [17] M. Henry, M. Begley, H. Neve, F. Maher, R.P. Ross, O. McAuliffe, A. Coffey, J.M. O'Mahony, Cloning and expression of a mureinolytic enzyme from the mycobacteriophage TM4, FEMS Microbiol. Lett. 311 (2010) 126e132. [18] M.I. Singh, V. Jain, Tagging the expressed protein with 6 histidines: rapid cloning of an amplicon with three options, Plos One 8 (2013). [19] S. Graslund, P. Nordlund, J. Weigelt, B.M. Hallberg, J. Bray, O. Gileadi, S. Knapp, U. Oppermann, C. Arrowsmith, R. Hui, J. Ming, S. dhe-Paganon, H.W. Park, A. Savchenko, A. Yee, A. Edwards, R. Vincentelli, C. Cambillau, R. Kim, S.H. Kim, Z. Rao, Y. Shi, T.C. Terwilliger, C.Y. Kim, L.W. Hung, G.S. Waldo, Y. Peleg, S. Albeck, T. Unger, O. Dym, J. Prilusky, J.L. Sussman, R.C. Stevens, S.A. Lesley, I.A. Wilson, A. Joachimiak, F. Collart, I. Dementieva, M.I. Donnelly, W.H. Eschenfeldt, Y. Kim, L. Stols, R. Wu, M. Zhou, S.K. Burley, J.S. Emtage, J.M. Sauder, D. Thompson, K. Bain, J. Luz, T. Gheyi, F. Zhang, S. Atwell, S.C. Almo, J.B. Bonanno, A. Fiser, S. Swaminathan, F.W. Studier, M.R. Chance, A. Sali, T.B. Acton, R. Xiao, L. Zhao, L.C. Ma, J.F. Hunt, L. Tong, K. Cunningham, M. Inouye, S. Anderson, H. Janjua, R. Shastry, C.K. Ho, D. Wang, H. Wang, M. Jiang, G.T. Montelione, D.I. Stuart, R.J. Owens, S. Daenke, A. Schutz, U. Heinemann, S. Yokoyama, K. Bussow, K.C. Gunsalus, Protein production and purification, Nat. Methods 5 (2008) 135e146. [20] M.J. Catalao, F. Gil, J. Moniz-Pereira, M. Pimentel, Functional analysis of the holin-like proteins of mycobacteriophage Ms6, J. Bacteriol. 193 (2011) 2793e2803. [21] J.H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972. [22] Y. Kim, G. Babnigg, R. Jedrzejczak, W.H. Eschenfeldt, H. Li, N. Maltseva, C. Hatzos-Skintges, M. Gu, M. Makowska-Grzyska, R. Wu, H. An, G. Chhor, A. Joachimiak, High-throughput protein purification and quality assessment for crystallization, Methods 55 (2011) 12e28. [23] G.J. Gopal, A. Kumar, Strategies for the production of recombinant protein in Escherichia coli, Prot. J. 32 (2013) 419e425.