Novel monoclonal antibody against truncated C terminal region of Histidine Rich Protein2 (PfHRP2) and its utility for the specific diagnosis of malaria caused by Plasmodium falciparum

Experimental Parasitology 150 (2015) 56–66

Contents lists available at ScienceDirect

Experimental Parasitology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y e x p r

Full length article

Novel monoclonal antibody against truncated C terminal region of Histidine Rich Protein2 (PfHRP2) and its utility for the specific diagnosis of malaria caused by Plasmodium falciparum Reena Verma, N.S. Jayaprakash, M.A. Vijayalakshmi, Krishnan Venkataraman * Centre for Bio Separation Technology (CBST), VIT University, Vellore 632 014, India

H I G H L I G H T S

• • • • •

Highly polymorphic Pf HRP2 is used in malaria Rapid Diagnostic Tests. C-terminus of PfHRP2 has unique and conserved peptide repeats. Recombinant C-terminal 105 amino acids of PfHRP2 was used as an antigen. Selected PfHRP2 mAbs were highly specific to PfHRP2 but not to PfHRP3. mAbs efficiently distinguished P. falciparum vs P. vivax with human serum samples.

G R A P H I C A L

A B S T R A C T

Unique peptide repeats and their frequency in Pf HRP2 C-terminal polypeptide MATDAHHAADAHHATDAHHAADAHHAADAHHAADAHHATDAHHAADAHHAAD (1)

(1)

(2,3,4)

(2)

(5)

(6)

AHHATDAHHAHHAADAHHAAAHHATDAHHAAAHHATDAHHAAAHHEAATHCLR (3)

(1) (7)

mAb against C-terminal Pf HRP2 (anti-recHRP2-T3) is highly specific to HRP-2

(1)

(4)

(2)

(5)

(1)

anti-recHRP2-T3 mAb recognize Pf HRP2 from P. falcoparum infected human serum samples

96kDa 66kDa 43kDa 29kDa 20kDa 14kDa

A R T I C L E

I N F O

Article history: Received 15 May 2014 Received in revised form 15 December 2014 Accepted 4 January 2015 Available online 12 January 2015 Keywords: Plasmodium falciparum Plasmodium vivax Plasmodium falciparum Histidine Rich Protein2 (PfHRP2) Histidine Rich Protein3 (PfHRP3) Anti-PfHRP2 monoclonal antibody Malaria diagnosis

A B S T R A C T

An accurate diagnosis of malarial infection is an important element in combating this deadly disease. Malaria diagnostic test including, microscopy and other molecular tests are highly sensitive but too complex for field conditions. Rapid detection tests for P. falciparum infection using monoclonal antibodies (mAbs) against highly polymorphic PfHRP2 (Histidine Rich Protein2) are still most preferred test in field conditions, but with limitations such as specificity, and sensitivity leading to false positive and false negative results. To overcome these limitations, we carried out bioinformatics analysis PfHRP2 and PfHRP3 and found that the C-terminal region of PfHRP2 (~105 amino acids) displayed relatively lower sequence identity with PfHRP3. This C-terminal region of PfHRP2 contained unique peptide repeats and was found to be conserved in various isolates of P. falciparum. Moreover, this region was also found to be highly antigenic as predicted by antigenicity propensity scores. Thus we constructed a cDNA clone of the truncated PfHRP2 (recPfHRP2-T3) coding for C-terminal 105 amino acids and expressed it in E. coli and purified the polypeptide to homogeneity. The purified recPfHRP2-T3 was used as an antigen for development of both polyclonal and monoclonal antibody (mAb). The mAbs b10c1 and Aa3c10 developed against recPfHRP2T3 was found to efficiently recognize recombinant PfHRP2 but not PfHRP3. In addition, the above mAbs

Abbreviations: recPfHRP2, recombinant PfHRP2 protein; mAbs, monoclonal antibody; RDTs, rapid diagnostic tests; PfHRP, P.falciparum Histidine Rich Protein; ELISA, enzyme Linked ImmunoAssay; P.f, Plasmodium falciparum; P.v, Plasmodium vivax. * Corresponding author. Fax: +914162243092. E-mail address: [email protected]; [email protected] (K. Venkataraman). http://dx.doi.org/10.1016/j.exppara.2015.01.001 0014-4894/© 2015 Elsevier Inc. All rights reserved.

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

57

reacted positively with spent media and serum sample of P. falciparum infection recognizing the native PfHRP2. The affinity constant of both the clones were found to be 109 M−1. Quantitatively, both these clones showed ~4.4 fold higher reactivity with P. falciparum infected serum compared to serum from healthy volunteers or P. vivax infected patient samples. Thus these anti-C-terminal PfHRP2 mAbs (Aa3c10 and b10c1) display a very high potential for improvising the existing malarial diagnostic tools for detection of P. falciparum infection especially in areas where PfHRP2 polymorphism is highly prevalent. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Malaria is one of the most important parasitic infections that affect mankind, and is associated with huge burden of morbidity and mortality. (http://whqlibdoc.who.int/publications/2010 /9789241547925_eng.pdf). Four species of Plasmodium causes malaria in humans and among which P. falciparum is the most lethal (World Health Organization, 2011). In addition, it also causes cerebral malaria especially in children. Hence the early diagnosis of malaria is critical for the treatment. Histidine Rich Protein (PfHRP2) which is believed to be expressed only by P. falciparum is considered to be one of the unique markers for diagnosis of malaria in humans (Rock et al., 1987). This abundant protein is water soluble with unique arrangement of amino acids that it contains multiple amino acid repeats that are rich in alanine, histidine, and aspartic acid (Howard et al., 1986; Rock et al., 1987). Because of the above described features, PfHRP2 is considered as a potential biomarker in immunodetection and it is being widely used in RDTs (Baker et al., 2010; Mariette et al., 2008). Recent reports have indicated that there is presence of definitive variations in the amino acid sequence of PfHRP2 from different geographical locations (Baker et al., 2010; Mariette et al., 2008). In addition, there are also variations in frequency of the peptide repeats of PfHRP2 which may serve as potential epitopes (Baker et al., 2005; Maltha et al., 2013). Several factors influence the binding of mAbs to the target epitope. First is the presence of highly repetitive nature of the peptide sequences in PfHRP2 polypeptide which may serve as potential epitopes that are one or several amino acid shorter than a major epitope (a stretch of 10–15 amino acids) or minor epitope (a stretch of 3–6 amino acids) to be recognized by the mAbs. Second is the frequency of these targeted epitopes of PfHRP2 protein and third is the geographical distribution of these PfHRP2 epitopes in malarial parasites (Baker et al., 2005; Lee et al., 2006). So an ideal epitope for RDTs, which uses two antibody (capture and the detector), would be one that is present in most isolates of P. falciparum (100% prevalence) and has high copy number in each isolates (high frequency) so that the diagnosis would be effective and accurate. So far a number of anti-PfHRP2 antibodies have been developed and are used in RDTs. These antibodies are either made against complete PfHRP2 polypeptide or with synthetic peptides of PfHRP2 with the repeats (Tomar et al., 2006). Many of these antibodies are not sensitive and in addition cross reacts with PfHRP3 which is very closely related to PfHRP2 whose contribution to diagnosis is not well characterized. Moreover, the antibodies made against synthetic peptides may miss one or other amino acid which is substituted or absent in the target epitopes. Keeping above described parameters as guidelines and its limitations, we have generated a truncated PfHRP2 in such a way that it covers almost all the possible major epitopes which is found in C terminus of the PfHRP2 protein. Importantly, it is present in most isolates of the world (Baker et al., 2005). The possible logic behind this idea could be the frequency and the abundance of target epitopes which in turn will define the binding affinity of mAb, where a higher frequency and complete presence of the target epitope may result in greater sensitivity and higher binding affinity of the mAb.

In this work we have successfully expressed C-terminal 105 amino acids of PfHRP2 by recombinant DNA-technology in E. coli and purified the recombinant protein to homogeneity. It is further used as an antigen to generate both polyclonal and mAbs. The mAbs were developed by hybridoma technology by using an alternative adjuvant polyNisopropylacrylamide (PNiPAAm) against recPfHRP2-T3 with the aim to preserve the conformation of epitopes. In addition, PNiPAAm has the property to act as a reservoir of antigen with efficient delivery and protection of the antigen (Kumar et al., 2007; Shakya et al., 2011; Zerpa et al., 2006). The mAbs developed against truncated PfHRP2 were found to be highly specific to PfHRP2. The two mAbs b10c1 and Aa3c10 were characterized for its affinity, specificity and sensitivity. Finally we have shown that the mAb developed against truncated polypeptide recPfHRP2-T3 is effective in recognizing native PfHRP2 from spent medium of P. falciparum culture. With the successful development of highly specific antibody we demonstrated the utility of these mAbs in the specific detection of malaria caused by P. falciparum upon evaluation of malaria infected serum samples. 2. Material and methods 2.1. Materials pET20b (+) expression vector, Competent Escherichia coli, BL21 (DE3) strains were obtained from Novagen (Madison, WI), Ampicillin (HiMedia Lab. Mumbai, INDIA). Genomic DNA isolation Kit (QIAGEN Venlo, Netherland), restriction digestion enzymes, (Nco1, Xho1 and Not1) polymerases and ligases are from NEB (New England Biolabs Boston, MA). Monoclonal antibody against PfHRP2 was a gift from SPAN Diagnostic Surat India). All analytical reagents and cell culture reagents were from Sigma (St.Louis,Mo, USA). Non-fat milk was procured from Hi Media (Mumbai, India). Tetra methyl benzidine (TMB)/H2O2 was purchased from Genei (Bangalore, Karnataka, India). ELISA plates were purchased from Nunc (Roskilde, Denmark) and all other plastic wares were from Cellstar, Greiner Bio-one (Frickenhausen, Germany). PNiPAAm adjuvant was a gift from Dr.Ashok Kumar, Department of Biological Sciences and Bioengineering, Indian Institute of Technology, Kanpur, 208016, India. P. falciparum culture and serum/plasma samples of malaria infected patients were obtained from the National Institute of Malaria Research (NIMR), New Delhi India. 2.1.1. Laboratory animals All animals used in the development of antibodies were approved by the Institutional Animal Ethical Committee (IAEC). 2.2. Methods 2.2.1. Bioinformatics analysis The PfHRP2 and PfHRP3 protein sequences used for alignment (tcoffee.crg.cat/) had Genbank Accession number XM002808697.1 and protein id = “XP-002808743.1” for PfHRP2; Genbank accession number U69552.1 and protein id = “AAC47454.1” were for PfHRP3 respectively. The selection of truncated PfHRP2 comprising of C-terminal 105 amino acids named as PfHRP2-T3 (see below)

58

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

was based on the analysis homology between PfHRP2 and PfHRP3, number of different types of peptide repeats and the frequency of conserved repeats present in the C-terminal region PfHRP2 protein (Baker et al., 2010; Lopez et al., 2000; Moody, 2002; Wurtz et al., 2013). The PfHRP2-T3 polypeptide antigenecity and epitope prediction was done by Kolaskar & Tongaonkar antigenicity prediction software (tools.immuneepitope.org/tools/bcell/tutorial.jsp). 2.2.2. Construction of cDNA clone of PfHRP2 protein: recPfHRP2-T1 (284 amino acid) We obtained Plasmodium falciparum (field isolate from Rourkela, India) deposited at National Institute of Malaria Research (ICMR) (Ministry of Health & Family Welfare), New Delhi, India. The genomic DNA was isolated from this isolate by use of a QIA blood kit (QIAGEN), in accordance with the manufacturer’s instructions. The PCR product was cloned in T-Vector (PxcMKn-12). The nucleotide sequence of the selected clone was verified using M13 reverse and forward primers. Subsequently both nucleotide and deduced amino acid sequences were analyzed by BLAST program with NCBI database and confirmed to be that of PfHRP2. Further the cDNA construct of P. falciparum Pfhrp-2 gene (Exon-2) was cloned into pET20b (+) expression vector (Sharma, 1988; Wallach et al., 1984; Wellems and Howard, 1986). 2.2.3. Construction of truncated (C-terminus) cDNA clone of PfHRP2 protein: recPfHRP2-T3 (105 amino acid) A cDNA clone coding for C-terminal 105 amino acids of the PfHRP2 was constructed by PCR amplification using recPfHRP2-T1 template with 5’ CCATGGCAACCGATGCTCATCATGCA3’ – (Nco1) Forward primer and 5’GCGGCCGCAATAAATTTAATGGCGTAGGCA 3’ – (Not1) Reverse primer. The P.C.R conditions were 94 °C – 2 min denaturation, 94 °C – 50 sec hold, 63 °C – 45 sec annealing, 70 °C – 1 min hold, 72 °C – 10 min final extension. The reaction was carried out for 35 cycles with 0.2 mM dNTPs, 5units of Vent Polymerase, 20 ng of template DNA (recPfHRP2-T1). The restriction enzyme included in the primers for recPfHRP2-T3 was Nco1 and Not1 for the forward and reverse primers respectively. The purified DNA after restriction digestion was cloned into bacterial expression vector pET20b (+). The putative bacterial clones were verified by restriction enzyme digestion and nucleotide sequencing (Sambrook and Russel, 2001). 2.2.4. Protein expression and purification of recPfHRP2-T3 E. coli BL21DE3 strain was grown in Luria and Bertani (LB) medium containing sodium chloride (10 grams), peptone (10 grams) and yeast (5 grams) per liter. Expression of recPfHRP2-T3 was optimized at various temperatures with increasing concentrations of IsoPropyl β-D-ThioGalactoside (IPTG). Cell pellets were resuspended in lysis buffer (TrisHCl 20 mM pH 7.4, NaCl – 150 mM, Glycerol – 10%, PMSF – 1 mM, DNase – 10 mg/ml, Lysozyme – 10 mg/ ml) for 12 hrs at 4 °C with gentle shaking for periplasmic extraction of recombinant protein. The cell suspension was centrifuged at 9000 rpm at 4 °C for 15 min. The expression of the protein was analyzed on 15%-SDS-PAGE and confirmed by Western blot (Laemmli, 1970). The purification of the expressed recPfHRP2-T3 was carried out by IMAC (Immobilized Metal Affinity Chromatography) since the PfHRP2 is highly rich in histidine residues which aid easy purification by this method (Porath et al., 1975; Scopes, 1993; Vijayalakshmi, 1989). To bind target protein to IMAC column, 50 mM phosphate buffer with 0.5 M NaCl and 20 mM imidazole at pH 7.2 was used. The column chosen for the purification was NovaroseIDA with zinc as the metal aiding target protein to bind the column matrix. Bound proteins were eluted by decreasing the pH in batches using 50 mM acetate buffer with 0.5 M NaCl whose pH were 6.0,

5.0 and 4.0 respectively. The presence of purified recPfHRP2-T3 protein in the purified fraction was confirmed by Western blot analysis (Towbin et al., 1979). 2.2.5. Generation of polyclonal antibody against recPfHRP2-T3 polypeptide Laboratory-bred female NewZealand albino rabbits were immunized with the purified recPfHRP2-T3 polypeptide. Briefly, the rabbit was immunized intradermally with 100 μg of purified antigen emulsified in Freund’s complete adjuvant. After 2 successive booster doses in Freund’s incomplete adjuvant at an interval of 4 weeks, serum samples were collected 10 days after the final booster and tested for immunoreactivity against the recPfHRP2-T3 antigen by indirect ELISA. After confirming the high antibody titer, the rabbit was sacrificed; whole blood was collected, centrifuged at 1500 rpm for 20 min to collect serum and subsequently the polyclonal antibody was purified (Boden et al., 1994; Lehninger et al., 2005). Purified polyclonal antibody was used in sandwich ELISAs. 2.2.6. Generation of monoclonal antibody against recPfHRP2-T3 polypeptide Female BALB/c mice were immunized subcutaneously with 100 μg of purified recPfHRP2-T3 protein emulsified with adjuvant PolyN-isopropylacrylamide (PNiPAAm) in the ratio 1:1. The screening of hybridomas secreting anti-recPfHRP2-T3 protein antibody was done by indirect ELISA method using microplates coated with purified recPfHRP2-T3 protein. The positive clones were expanded and subsequently sub cloned to monoclonality by the method of limited dilution (Harlow and Lane, 1988; Kohler and Milstein, 1975). 2.2.7. ELISAs to identify positive hybridoma clones producing antirecPfHRP2-T3 antibody ELISA plates were coated with recPfHRP2-T3 (1 μg/well) suspended in 100 mM carbonate-bicarbonate buffer (pH 9.6) and incubated overnight at 4 °C. The plates were then washed and blocked with 5% non-fat skim milk for 2 hrs at 37 °C. After three washes, cell culture supernatant was added and incubated for 1 hr at 37 °C. The bound antibody was detected using goat anti-mouse IgG-HRP conjugate with tetramethylbenzidine (TMB)/H2O2 as the enzyme substrate. The reaction was stopped with 2 M sulphuric acid and optical density (OD) was measured at 450 nm using multiwell plate reader (FLUOstar Optima, BMG Labtech, Ortenberg, Germany). The clones (b10c1 and Aa3c10) showing strong reactivity with recPfHRP2-T3 was further characterized and expanded for lab scale production. 2.2.8. Confirmation of specificity of anti-recPfHRP2-T3 mAbs from clones, b10c1 and Aa3c10 by Western blot The protein preparations were electrophoresed in 15% SDSpolyacrylamide gel. The proteins were electrophoretically transferred onto a nitrocellulose membrane using a Trans-blot apparatus (BioRad, Hercules, CA, USA). Western blot analysis was done using the cell culture supernatant containing anti-recPfHRP2-T3 antibodies. Membrane was blocked with 5% non-fat milk in wash buffer (phosphate buffer saline (PBS) + 0.1% Tween-20) and incubated with mAb for 2 h at 37 °C. The pre-immune serum from the mouse was used as a negative control. After extensive washing with PBS-Tween, horse radish peroxidase conjugated anti-mouse immunoglobulin was added and incubated at 37 °C for 1 h. The bands were visualized by using diaminobenzidine as substrate. 2.2.9. Characterization of b10c1 and Aa3c10 monoclonal antibody clones The cross reactivity of the mAbs with recombinant PfHRP-3 cDNA clone (obtained from Indian Institute of Science, Bangalore, India,

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

consisting of 176 amino acid of PfHRP-3 protein) expressed in E. coli host BL21DE3 was also tested. The mAbs were further characterized for their antigen sensitivity by coating different concentrations of antigen (recPfHRP2-T3 protein) on ELISA plate and the sensitivity of mAbs was determined by the method of indirect ELISA. The antigen concentration ranged from 0.45 ng to 1000 ng. Similarly, by the method of double dilution, with fixed concentration of antigen (1 μg/well) coated on the ELISA plate, the antibody titer was determined as its end point titer of a full-length dilution curve.

2.2.10. Antigen-antibody binding affinity The affinity constant of the mAbs b10c1 and Aa3c10 for recPfHRP2-T3 was determined by Surface Plasmon Resonance (SPR) with Biacore 3000 (Lynch et al., 2014; Xiong et al., 2011).

2.2.11. Reaction of monoclonal antibody (b10c1 and Aa3c10) with P. falciparum spent medium The reactivity of the mAbs (b10c1 and Aa3c10) with P. falciparum spent medium was analyzed by Western blot (Trager and Jensen, 1978). For this, proteins in the spent media were separated by electrophoreses in 10% polyacrylamide gel and Western blot was carried out with b1c10 and Aa3c10. RecPfHRP2-T3 protein was used as a positive control. Recombinant PfHRP3 protein expressed in E. coli

59

and P. falciparum spent media were tested for its cross reactivity with the anti-PfHRP2-T3 mAbs. In addition, commercial anti-PfHRP2 mAb was also used in Western blot for the validation of the results. 2.2.12. Validation of monoclonal antibody with malaria patients’ serum/plasma sample of P. falciparum and P. vivax Sandwich ELISA: Sandwich ELISA plates were prepared by coating purified rabbit polyclonal antibody made against recPfHRP2-T3 (capture antibody). After washing with PBST, the plates were blocked with 5% non-fat milk powder for 2 hr at 37 °C. Then the patient’s serum samples were added and incubated for 1 hr at 37 °C. Serum samples from 5 patients each, which were diagnosed either with P. falciparum or with P. vivax infection, were used in this experiment. Serum from healthy volunteers was used as control. Detection was achieved with monoclonal antibody b10c1and Aa3c10 in separate wells in triplicates, followed by goat antibodies to mouse IgGconjugated to HRP. The peroxidise activity was determined as described in section 2.2.7 (Brown et al., 1994; Kifude et al., 2008; Parra et al., 1991). In addition, commercial mAb against PfHRP2 was also tested in sandwich ELISA with above mentioned samples. 2.2.13. Western blot analysis The total protein concentration of the patient’s serum sample was quantified by Bradford’s method (Bradford, 1976) using bovine

Fig. 1. Multiple Sequence Alignment of recPfHRP2-T1 and recPfHRP2-T3 amino acid sequence with PfHRP2 and PfHRP3. (A) Alignment of recPfHRP2-T1 and recPfHRP2-T3 amino acid sequences with PfHRP2 (protein ID “Xp-0028 08743.1”) and PfHRP3 (protein ID “AAC47454.1”). (B) Truncated clones of PfHRP2. Schematic representation of truncated cDNA clones coding for PfHRP2.

60

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

Table 1 Number of peptide repeats present in recPfHRP2-T3 polypeptide which is used as an antigen in this work and the truncated PfHRP2 (C-terminal 105 amino acid) is predicted to be potentially antigenic (see Fig. 2). Unique peptide repeats and their frequency of occurrence in the C-terminal polypeptide of PfHRP2 is shown below. MATDAHHAADAHHATDAHHAADAHHAADAHHAADAHHATDAHHAADAHH AADAHHATDAHHAHHAADAHHAAAHHATDAHHAAAHHATDAHHAAAHHE AATHCLRH S. No.

Peptide sequences in PfHRP2 protein

Presence in recHRP2-T3 cDNA clone

Number of copies of peptide sequences in PfHRP2

Presence in PfHRP3

1. 2. 3. 4. 5.

AHHAHHAAD AHHATD AHHAAD AHHAAAHHATD AHHAAAHHEAATH

+ve +ve +ve +ve +ve

1 5 7 2 1

Absent Absent Present once Absent Absent

serum albumin as a standard and Western blot was carried out with b10c1 and Aa3c10 mAbs as described earlier. 3. Results 3.1. Sequence analysis of recPfHRP2-T1 and recPfHRP2-T3 polypeptide The Multiple sequences Alignment (MSA), (Fig. 1) shows the alignment of PfHRP2-T1 (285 amino acids) and PfHRP2-T3 (105 amino acids) with native PfHRP2 and PfHRP3 protein of P. falciparum (Note: both PfHRP2-T1 and PfHRP2-T3 polypeptides were recombinantly expressed in E. coli). In-silico analysis of amino acid sequences of truncated PfHRP2-T3 revealed that there was minimum homology

with native PfHRP-3 protein. Peptide repeats analysis of both PfHRP2 and PfHRP3 revealed that the C-terminus of the PfHRP2 polypeptide was found to be rich in unique repeats specific to PfHRP2 polypeptide whereas N-terminus has the common repeats of both PfHRP2 and PfHRP3. Table 1 gives the amino acid sequence of the PfHRP2-T3 polypeptide and the highlighted amino acids are the repeats of the PfHRP2 protein unique to C-terminus. Table 1 also gives the number of repeats which is conserved in most isolates from various geographical locations. These repeats present in C-terminus are predicted to be both major and minor epitopes (Fig. 2). The 105 amino acid regions are predicted to be highly antigenic as the average predicted antigenic propensity value has a score more than 1 and above as determined by Kolaskar & Tongaonkar Antigenicity prediction (Fig. 2) (Kolaskar and Tongaonkar, 1990).

Fig. 2. Predicted epitopes of C-terminal amino acid sequence of PfHRP2 by Kolaskar and Tongaonkar antigenecity prediction method (Kolaskar and Tongaonkar, 1990). The predicted antigenic propensity (epitopes) average score was 1.048, minimum score was 0.997 and the maximum score was 1.103 respectively for the C-terminal 105 amino acid of PfHRP2 polypeptide. The average antigenic propensity score of >1.0 is considered as potentially antigenic by this method.

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

61

Fig. 3. Cloning of recombinant truncated PfHRP2 (recPfHRP2-T3). (A) Lane 1 and 2 Genomic DNA of P. falciparum from P. falciparum culture. Lane M – DNA marker starting from 10 kilobases. (B) Lanes 1 and 2, PCR amplification of Exon-2 (855 base pair nucleotides) of PfHRP2 of P. falciparum. Lane M – DNA marker in base pairs, Lane C – control, no amplification without template. (C) Lanes 1 and 2 – Release of 855 base pair insert of recPfHRP2-T1 upon restriction enzyme digestion with Nco1 and Xho1; Lanes 3 and 4 – Release of 315 base pair insert of recPfHRP2-T3 upon restriction enzyme digestion by Nco1 and Not1; Lane 5 – control (vector without insert), M – 100 base pair, UC – Uncut vector.

3.2. Construction of cDNA clone coding for recPfHRP2 polypeptidesrecPfHRP2-T1 (285 amino acid) and recPfHRP2-T3 (105 amino acid) The genomic DNA of P. falciparum was isolated and the DNA was run on 6% agarose gel; Fig. 3A shows a band above 10 kb corresponding to genomic DNA. Fig. 3B shows the amplification of 855 nucleotide of exon-2 P. falciparum Pfhrp2 gene. This PCR product was cloned into PXcmKn-12 vector and sequence verified. The nucleotide sequences of recPfHRP2-T1 cDNA clone matched with NCBI database entry Accession No.EU5897331.1 TDD060349 Histidine rich protein (PfHRP) gene of P. falciparum, exon 2 and partial Cds with a maximum sequence identity of 91%. The PfHRP2 cDNA (recPfHRP2T1) was subcloned into pET20b (+) vector and insert was released by restriction digestion of Fig. 3C. The recPfHRP2-T1 cDNA clone was used as a template and sequence coding for C-terminal 105 amino acids were PCR amplified and subsequently cloned into pET20b (+) expression vector to generate recPfHRP2-T3 clone. Positive bacterial clones were identified confirmed by both restriction digestion analysis and nucleotide sequencing Fig. 3C. 3.3. Protein expression and purification of recPfHRP2-T3 The IPTG concentration of 0.5 mM at 28 °C gave the best condition for the expression of the recPfHRP2-T3 polypeptide. The expression of the polypeptide was confirmed by molecular weight on 15% SDS-PAGE and by Western blot using anti HRP-2 antibody from SPAN Diagnostics, India Pvt. Ltd. The molecular weight of the recombinant polypeptide was found to be near around 22 kDa which

was twice higher than the expected molecular weight (~11 kDa). IMAC was used in the purification of expressed recPfHRP2-T3 polypeptide. Sharp peaks were observed during each elution step upon decreasing pH (Fig. 4A). The purified fractions were analyzed by SDSPAGE and it was observed that the recombinant truncated PfHRP2T3 was eluted at pH 4.0 whose molecular weight was ~22 KDa (Fig. 4B). Further, the eluted recombinant PfHRP2 was confirmed in a Western blot by use of commercial monoclonal antibody (Fig. 4C). In addition, both rabbit polyclonal antibody and monoclonal antibody developed in house against recPfHRP2-T3 efficiently recognized the purified recombinant antigen recPfHRP2-T3; Fig. 4D. 3.4. Production and characterization of anti-PfHRP2-T3 monoclonal antibody (mAb) Several hybridomas producing mAbs against recPfHRP2-T3 were obtained by the fusion of Sp2/0 myeloma cells with spleen cells from recPfHRP2-T3 immunized BALB/c mice. The selected stable clones were taken for further characterization studies. In Western blot analysis, all the selected clones displayed reactivity with recPfHRP2T3 protein transferred onto nitrocellulose membrane (Supplementary Fig. S1). Based on antigen sensitivity, antibody titer and specificity, two clones viz., b10c1 and Aa3c10 were selected as they displayed very high specificity and high titer values. The sensitivity of mAbs to recPfHRP2-T3 was determined by the antigen dilution curve of recPfHRP2-T3 antigen ELISA (Fig. 5A). The results showed that the antibodies were very sensitive and the lowest concentration of the antigen that could be detected with confidence was up to 0.5 ng

62

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

Fig. 4. Purification and confirmation of recPfHRP2-T3. (A) Chromatogram depicting the purification of recPfHRP2-T3 by IMAC. (B) SDS-PAGE analysis for the purification of recPfHRP2-T3. Lane M is protein mol.wt.marker in kilodaltons (kDa)., Lane 1 – unbound protein pH 7.0, Lane 2 – pH 6.0 elution, Lane 3 – pH 5.0 elution, Lane 4 – pH 4.0 elution, Lane 5 – EDTA elution. The arrow indicates purified protein at pH-4.0. Samples were run on 15% acrylamide gel under reducing condition. (C) Confirmation of recPfHRP2T3 by Western blot. Purified recPfHRP2-T3 was electrophoresed on 15% polyacrylamide gel under reducing condition and transferred on to nitrocellulose membrane. Western blotting was performed with commercial anti-PfHRP2 mAb was used as the primary antibody and anti-IgG conjugated with alkaline phosphatase was used as a secondary antibody. (D) Validation of the anti-PfHRP2-T3 polyclonal and monoclonal antibody developed in house. Lane 1 – Protein molecular weight marker, Lane 2 – purified recombinant PfHRP2-T3 protein, Lane 3 – anti-PfHRP2 polyclonal antibody was probed against purified recPfHRP2-T3, Lane 4 – anti-PfHRP2 monoclonal antibody was probed against purified recPfHRP2-T3. All samples were run with 15% polyacrylamide gel under reducing condition.

Fig. 5. Antigen sensitivity and antibody titer curves of mAbs b10c1 and Aa3c10. (A) Purified recPfHRP2 antigen was serially diluted starting from 1000 ng of antigen and probed with mAbs b10c1 and Aa3c10 for their sensitivity. Blank value – This value represents the ELISA value without the antigen; Nc – Negative control value where mAb was not added. (B) Antibody titer curve generated by double dilution of mAbs b10c1 and Aa3c10. Antibody was titrated against same amount of antigen. Blank value – This value represents the ELISA value without the antigen; Nc – Negative control value where mAb was not added. (Note: Both blank and Nc values are not shown as they were very low).

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

63

Fig. 6. Western blot analysis of native and recombinant PfHRP2 and PfHRP3. (A) Western blot analysis with commercial anti-PfHRP-2 mAb. Lane 1 – purified recPfHRP2-T3; Lane-2 recPfHRP-3; Lane-3, spent media of P. falciparum. M – Represent protein molecular weight marker in kilodaltons (kDa). Samples were run on 10% acrylamide gel under reducing condition. (B) Western blot analysis with clone b10c1. Lane 1 – purified recPfHRP2-T3; Lane 2 – recPfHRP3; Lane 3 – spent media of P. falciparum. M – Protein molecular weight marker. (C) Western blot analysis of P. falciparum spent medium. Lane 1 – Spent medium probed with mAb b10c1 and Lane 2 – spent medium probed with Aa3c10.

(Fig. 5A). The titration curves of the two mAbs are shown in Fig. 5B. The antibody titer was determined as its end point titer of a full length dilution curve and was taken as the highest dilution which gave 0.1 OD above the negative (Sp2/0 supernatant) control. The titer values were almost comparable with each other (Palani et al., 2013). Affinity constant was determined from the sensogram obtained by SPR analysis of both mAbs viz., b10c1 and Aa3c10 with truncated PfHRP2 and they showed a very high affinity for the antigen recPfHRP2-T3 having an affinity constant of 109 M−1 (Lynch et al., 2014; Xiong et al., 2011).

3.5. Analysis of anti-PfHRP2-T3 mAb with spent media and recombinant PfHRP3 polypeptide of P. falciparum The commercial mAb against PfHRP2 detected both recombinant PfHRP2 (recPfHRP2-T3) and PfHRP3 polypeptides (Fig. 6A). It efficiently recognized native PfHRP2 from spent medium (Fig. 6A). In contrast, mAbs developed in house against recPfHRP2-T3 recognized only recombinant PfHRP2 but not PfHRP3, suggesting that the in house mAbs were highly specific to PfHRP2 (Fig. 6B). Importantly, the mAbs developed in house (b10c1 and Aa3c10 mAbs) also recognized native PfHRP2 from spent medium which were seen above 66 kDa (Fig. 6C).

3.6. Analysis of anti-PfHRP2-T3 mAbs with malaria patients’ sample The sandwich ELISA performed on malaria patients samples and healthy volunteers with the commercial anti-PfHRP2 mAb showed that the commercial mAb recognized the P. falciparum infected serum sample with average value of 0.9438 + 0.223; with P. vivax the average value was 0.263 + 0.108 and for healthy control the average value was 0.152 ± 0.014 (Fig. 7A). When sandwich ELISA was performed on malaria patient samples with in-house mAbs, both b10c1 and Aa3c10 rapidly recognized P. falciparum patient’s sample compared to P. vivax infected patient samples or healthy serum samples; Fig. 7B. They showed a 4.4 folds higher titer value for P. falciparum sample compared to P. vivax samples (average value for P. falciparum sample was 0.952 ± 0.032; for P. vivax it was 0.216 ± 0.029; and for healthy control the average value was 0.154 ± 0.0104). The titer values for P. vivax and normal healthy control samples did not show significant differences between them; Fig. 7B. (Note: The graph was plotted taking average value of the two clones for each sample). Thus, the newly developed mAbs against recombinant PfHRP2 efficiently recognized PfHRP2 from patient samples. The Western blot results further confirmed the reactivity of mAbs Aa3c10 and b10c1 toward PfHRP2 protein in the P. falciparum sample showing a clear single band of native PfHRP2. In contrast, there was no band observed either in the P. vivax sample or in healthy control

64

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

Fig. 7. Analysis of malaria patient serum samples with anti-PfHRP2 monoclonal antibodies. (A) Average sandwich ELISA values of commercial anti-PfHRP-2 mAb, y-axis represents absorbance value. P. falciparum infected serum sample, P. vivax infected serum sample, Normal control-serum sample of healthy individuals. (B) Average sandwich ELISA values of mAbs from clones b10c1 and Aa3c10 plotted where y-axis represents absorbance values. P. falciparum infected serum sample, P. vivax infected serum sample, Normal control – serum sample of healthy individuals. Note: Average values are obtained from 5 samples from each group in triplicate. Student’s t-test was performed and p values have been provided. (C Left Panel): Western blot of P. falciparum and P. vivax patient’s sample probed with b10c1 mAb. Serum sample run on 10% SDSPAGE under non-reducing conditions. A representative Western blot of malaria infected patient sample has been shown. Lane M; protein molecular weight marker in kilodaltons (kDa). Lane 1: healthy control serum, Lane 2: pure commercial IgG, Lane 3: P. vivax serum sample, Lane 4: P. falciparum serum sample. (C Right Panel): Healthy human serum sample probed with secondary antibody (anti-mouse IgG conjugated with Horse Radish Peroxidase). Lane 1: RecHRP2-protein, Lane 2 and 3 healthy human serum, Lane 4: human IgG marker (Sigma), Lane M: protein molecular weight marker in kilodaltons (kDa).

at that specified molecular weight Fig. 7C (Left panel). The higher mol.wt. bands observed in these Westerns could be due to nonspecific interactions of IgG with the secondary antibody which recognizes human IgG. See Fig. 7C, right panel, when healthy serum samples were probed directly with secondary antibody (antimouse IgG). Bands corresponding human IgG were recognized, which strongly suggested that the higher mol.wt. bands observed in the immunoblots were due to non-specific reactivity of human IgG by secondary antibody. These data clearly suggested that the monoclonal antibody raised against recPfHRP2-T3 polypeptide was very specific to only PfHRP2 and is able to recognize the antigen efficiently and effectively in both spent media of P. falciparum culture and malaria serum samples infected by P. falciparum. 4. Discussion In order to diagnose the malaria caused by P. falciparum, most of the recent diagnostic kits use PfHRP2 as a marker protein. The polymorphisms associated with PfHRP2 gene have led to the heterogeneity in PfHRP2 protein in parasites isolated from different geographical region of the world. (Mouatcho and Goldring, 2013) Therefore, the amino acid sequence homology and distinct conserved repeats present in PfHRP2 and PfHRP3 may play a very important role in differential diagnosis of P. falciparum with other species of Plasmodium. Due to the commonality of the epitopes

shared by these PfHRPs, most mAb generated against PfHRP2 either by using complete PfHRP2 polypeptide or synthetic peptides, recognizes both the Pf HRPs, leading to sensitivity and specificity issues in diagnostic tests which employ monoclonal antibody in RDTs (Rubio et al., 2001). In RDTs, it is expected that an antigen whose epitopes are unique and conserved across geographic locations would result in increased reliable detection and sensitivity compared to an antigen with wide variation in amino acid sequences. Therefore, in principle the reactivity of the each generated mAbs against an antigen would correlate with the number of putative epitopes which is unique to PfHRP2 and in addition to its conservation in various isolates. The variation in molecular weight of both native and recPfHRP2 that has been reported earlier may be due to unusual content of histidine which in turn could be due to genetic polymorphisms in PfHRP2 gene (Panton et al., 1989; Sullivan et al., 1996). The major problem in variation in sensitivity of mAbs may be overcome by these mAbs reported here as the C-terminal amino acid sequences of PfHRP2 are conserved and may be present in most parasite isolates obtained from different parts of the world (Lee et al., 2006; Mariette et al., 2008). Our mAbs generated against C-terminal 105 amino acids are able to efficiently recognize both truncated recombinant recPfHRP2-T3 but not the recombinant PfHRP3 as revealed by both immunoblot analysis and ELISA based assays which suggested that the antibody is highly specific to PfHRP2. These two mAbs showed a very high affinity (10 9 M −1 ) for the recPfHRP2 as

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

determined by SPR with Biacore 3000 software. Since both the mAbs displayed a very high affinity constant, these antibodies may prove useful in RDTs, when there are low levels of infection or parasite counts in field conditions. Interestingly and importantly, this antibody is able to react efficiently with spent media of P. falciparum culture in ELISA based assays indicating the presence of PfHRP2 in the spent medium. Moreover, immunoblot analysis of spent media showed a band whose molecular weight was above ~66 kDa which is in agreement with many studies wherein molecular weight of native PfHRP2 from parasite or from spent media was shown to be around ~66 kDa (Howard et al., 1986; Rock et al., 1987). The spent media of P. falciparum should have both PfHRP2 and Pf HRP3 protein, but a single band as shown in Western blot Fig. 6 could be the native PfHRP2 of P. falciparum. To establish the worthiness of generated mAb for specific diagnostic purposes, we probed them against laboratory confirmed P. falciparum and P. vivax infected patient sera by both immunoblot analysis and ELISA based assays. Our immunoblot analysis clearly detected a band which corresponds to the expected molecular weight of PfHRP2 of P. falciparum infected patient serum sample but not in P. vivax. The sandwich ELISA with patients sample showed clearly higher titer value compared with normal healthy sera and P. vivax sera sample (Fig. 7) which substantiates the results reported here. Thus we have successfully differentiated P. falciparum serum from P. vivax serum and normal healthy sera, thus proving the specificity of generated mAb for specific diagnosis of malaria caused by P. falciparum. 5. Conclusion Based on the results reported here, we conclude that the mAbs b10c1 and Aa3c10 have very high diagnostic potential for specific detection of malaria caused by P. falciparum. These two mAbs can serve as capture and detector antibody in the RDTs based system. Furthermore, our findings might also help in identification of unique epitopes which will overcome the diverse differences in sensitivity reported for the various PfHRP2 based RDTs due to polymorphisms in PfHRP2 gene. Acknowledgments We thank Dr. Vineeta Singh (Scientist), National Institute of Malaria Research Institute (NIMR), New Delhi, Govt. of India, for providing human serum/plasma samples for analysis. We acknowledge Dr.G.Padmanabhan (Emeritus Professor), Indian Institute of Science, Bangalore, for providing PfHRP-3 cDNA clone and for his encouragement in this work. We thank the Department of Science and Technology (DST), Govt. of India, for funding. Funding DST-SERB (SR/CBST (PhaseII) IRHPA/2009) – Science and Engineering Research Board (SERB), Department of Science and Technology (DST), New Delhi, Government of India. Conflict of interest A provisional patent concerning this work has been filed. Appendix: Supplementary material Supplementary data to this article can be found online at doi:10.1016/j.exppara.2015.01.001.

65

References Baker, J., McCarthy, J., Gatton, M., Kyle, D.E., Belizario, V., Luchavez, J., et al., 2005. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 (PfPFHRP2) and its effect on the performance of PfPFHRP2-based rapid diagnostic tests. J. Infect. Dis. 192, 870–877. Baker, J., Ho, M.F., Pelecanos, A., Gatton, M., Chen, N., Abdullah, S., et al., 2010. Global sequence variation in the histidine-rich proteins 2 and 3 of Plasmodium falciparum: implications for the performance of malaria rapid diagnostic tests. Malar. J. 9, 129–140. Boden, V., Winzerling, J.J., Vijayalakshmi, M.A., Porath, J., 1994. Rapid one-step purification of goat immunoglobulins by immobilized metal ion affinity chromatography. J. Immunol. Methods 181, 225–232. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72, 248–254. Brown, A.E., Kain, K.C., Pipithkul, J., Webster, H.K., 1994. Diagnosis of malaria by detection of Plasmodium falciparum HRP-II antigen with a rapid dipstick antigencapture assay. Lancet 343, 564–568. Harlow, E., Lane, D., 1988. Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory. Howard, R.J., Uni, S., Aikawa, M., Aley, S.B., Leech, J.H., Lew, A.M., et al., 1986. Secretion of a malarial histidine rich protein (PfHRPII) from Plasmodium falciparum-infected erythrocytes. J. Cell Biol. 103, 1269–1277. Kifude, C.M., Rajasekariah, H.G., Sullivan, D.J., Stewart, V.A., Angov, E., Martin, S.K., et al., 2008. Enzyme-linked immunosorbent assay for detection of Plasmodium falciparum histidine-rich protein 2 in blood, plasma and serum. Clin. Vaccine Immunol. 15, 1012–1018. Kohler, G., Milstein, C., 1975. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256, 495–497. Kolaskar, A.S., Tongaonkar, P.C., 1990. A semi-empirical method for prediction of antigenic determinants on protein antigens. FEBS Lett. 276, 172–174. Kumar, A., Srivastava, A., Yugalaeu, I.Y., Mattiasson, B., 2007. Smart polymer: physical forms and bioengineering application. Prog. Polym. Sci. 32, 1205–1237. Laemmli, E.K., 1970. Cleavage of structural protein during the assembly of the head bacteriophage T4. Nature 22, 680–685. Lee, N., Baker, J., Andrews, K.T., Gatton, M.L., Bell, D., Cheng, Q., et al., 2006. Effect of sequence variation in Plasmodium falciparum histidine-rich protein 2 on binding of specific monoclonal antibodies: implications for rapid diagnostic tests for malaria. J. Clin. Microbiol. 44, 2773–2778. Lehninger, A.L., Nelson, D.L., Cox, M.M., 2005. Principal of Biochemistry, fourth ed. W.H. Freeman and Co. Lopez, R., Urquiza, M., Curtidor, H., Eduardo, C.J., Mora, H., Puentes, A., et al., 2000. Plasmodium falciparum: red blood cell binding studies of peptides derived from histidine-rich KAHRP-I, HRP-II and HRP-III proteins. Acta Trop. 75, 349–359. Lynch, H.E., Stewart, S.M., Kepler, T.B., Sempowski, G.M., Alam, S.M., 2014. Surface plasmon resonance measurements of plasma antibody avidity during primary and secondary responses to anthrax protective antigen. J. Immunol. Methods 404, 1–12. doi:10.1016/j.jim.2013.11.026. Maltha, J., Gillet, P., Jacobs, J., 2013. Malaria rapid diagnostic tests in endemic settings. Clin. Microbiol. Infect. 5, 399–407. Mariette, N., Barnadas, C., Bouchier, C., Tichit, M., Ménard, D., 2008. Country-wide assessment of the genetic polymorphism in Plasmodium falciparum and Plasmodium vivax antigens detected with rapid diagnostic tests for malaria. Malar. J. 7, 219. Moody, A., 2002. Rapid diagnostic tests for malaria parasites. Clin. Microbiol. Rev. 15, 66–78. Mouatcho, J.C., Goldring, J.P., 2013. Malaria rapid diagnostic test: challenges and prospects. J. Med. Microbiol. 62, 1491–1505. Palani, B., Shiva Ranjini, S., Jayaprakash, N.S., Vijayalakshmi, M.A., 2013. Development, purification, and characterization of monoclonal antibodies against recombinant histidine–rich protein 3 of Plasmodium falciparum. Monoclon. Antib. Immunodiagn. Immunother. 32, 341–348. Panton, L.J., McPhie, P., Maloy, W.L., Wellems, T.E., Taylor, D.W., Howard, R.J., 1989. Purification and partial characterization of an unusual protein of Plasmodium falciparum: histidine-rich protein II. Mol. Biochem. Parasitol. 35, 149–160. Parra, M.E., Evans, C.B., Taylor, D.W., 1991. Identification of Plasmodium falciparum histidine-rich protein2 in the plasma of humans with malaria. J. Clin. Microbiol. 29, 1629–1634. Porath, J., Carlsson, J., Olsson, I., Belfrage, G., 1975. Metal chelate affinity chromatography, a new approach to protein fractionation. Nature 258, 598–599. Rock, E.P., Marsh, K., Saul, A.J., Wellems, T.E., Taylor, D.W., Maloy, W.L., et al., 1987. Comparative analysis of the Plasmodium falciparum histidine-rich proteins HRP-I, HRP-II and HRP-III in malaria parasites of diverse origin. Parasitology 95, 209– 227. Rubio, J.M., Buhigas, I., Subirats, M., Baquero, M., Puente, S., Benito, A., 2001. Limited level of accuracy provided by available rapid diagnosis tests for malaria enhances the need for PCR-based reference laboratories. J. Clin. Microbiol. 39, 2736–2737. Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor, New York. Scopes, R.K., 1993. Protein Purification: Principles and Practice, third ed. Springer, Australia. Shakya, A.K., Kumar, A., Nandakumar, K.S., 2011. Adjuvant properties of a biocompatible thermo-responsive polymer of N-isopropylacrylamode in autoimmunity and arthritis. J. R. Soc. Interface 8, 1748–1759.

66

R. Verma et al./Experimental Parasitology 150 (2015) 56–66

Sharma, Y.D., 1988. Genomic organization, structure and possible function of histidine rich proteins of malaria parasites. Int. J. Biochem. 20, 471–477. Sullivan, D.J., Gluzman, I.Y., Goldberg, D.E., 1996. Plasmodium hemozoin formation mediated by histidine-rich proteins. Science 271, 219–222. Tomar, D., Biswas, S., Tripathi, V., Rao, D.N., 2006. Development of diagnostic reagents: raising antibodies against synthetic peptides of PfHRP-2 and LDH using microsphere delivery. Immunobiology 211, 797–805. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of protein from polyacrylamide to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76, 4350–4354. Trager, W., Jensen, J.B., 1978. Cultivation of malaria parasites. Nature 273, 621–622. Vijayalakshmi, M.A., 1989. Pseudobiospecific ligand affinity chromatography. Trends Biotechnol. 7, 71–76. Wallach, M., Cully, D.F., Haas, L.O., Trager, W., Cross, G.A., 1984. Histidine-rich protein genes and their transcripts in Plasmodium falciparum and P. lophurae. Mol. Biochem. Parasitol. 12 (1), 85–94.

Wellems, T.E., Howard, R.J., 1986. Homologous genes encode two distinct histidine rich proteins in a cloned isolate of Plasmodium falciparum. Proc. Natl. Acad. Sci. U.S.A. 83, 6065–6069. World Health Organization, 2011. World Malaria Report. World Health Organization, Geneva. Wurtz, N., Fall, B., Bui, K., Pascual, A., Fall, M., Camara, C., et al., 2013. PfPfHRP2 and pfhrp3 polymorphisms in Plasmodium falciparum isolates from Dakar, Senegal: impact on rapid malaria diagnostic tests. Malar. J. 12 (34), 1475–2875. Xiong, C., Huang, M., Zhang, R., Song, S., Lu, W., Flores, L., 2nd, et al., 2011. In vivo small-animal PET/CT of EphB4 receptors using 64Cu-labeled peptide. J. Nucl. Med. 52 (2), 241–248. doi:10.2967/jnumed.110.081943. Zerpa, N.C., Wide, A., Noda, J., BermudeZ, H., Pabon, R., Noya, O.O., 2006. Immunogenicity of synthetic peptides derived from Plasmodium falciparum proteins. Exp. Parasitol. 113, 227–234.