Novel mutations in 5-HT3A and 5-HT3B receptor genes not associated with clozapine response

Schizophrenia Research 58 (2002) 93 – 97 www.elsevier.com/locate/schres

Novel mutations in 5-HT3A and 5-HT3B receptor genes not associated with clozapine response Blanca Gutie´rrez *, Marı´a J. Arranz, Patricia Huezo-Diaz, David Dempster, P. Matthiasson, M. Travis, Janet Munro, Sarah Osborne, Robert W. Kerwin Department of Clinical Neuropharmacology, Institute of Psychiatry, Denmark Hill, London SE5 8AF, UK Received 8 June 2001; accepted 13 January 2002

Abstract Clozapine is a potent antagonist of 5-HT3 receptors, which are ligand-gated ion channels that mediate rapid excitatory responses in the central nervous system. Two different isoforms of 5-HT3 receptor subunit genes (HTR3A and HTR3B) have been identified. They have been assigned to chromosome 11q23.1 – q23.2, a region which in the past has been linked to schizophrenia and bipolar disorder. In this study, we performed a systematic mutation screening of the 5-HT3A and 5-HT3B receptor genes and tested the variants for association with clozapine response in a sample of 266 clozapine-treated patients. Two polymorphisms at the 5-HT3A gene and five new variants in the 5-HT3B gene were finally detected. Of these, only the more frequent mutations (178-C/T and 1596-A/G in 5-HT3A and a CA-repeat in 5-HT3B) were genotyped in our clozapine sample. Association analysis showed similar allele and genotype distributions among clozapine responders and nonresponders. These results make unlikely the possibility that 5-HT3A and 5-HT3B receptor genes underlie variation in clinical response to clozapine. However, the promoter regions of both genes have yet to be investigated. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Schizophrenia; Clozapine response; HTR3A; HTR3B

1. Introduction Clozapine is an atypical antipsychotic agent effective in 40– 60% of cases which have been refractory to treatment with other antipsychotic drugs (Lieberman et al., 1994; Kane 1992). The actions of clozapine are mediated through a variety of neurotransmitter receptors including histaminergic, adrenergic, serotonergic, * Corresponding author. Unitat d’Antropologia, Facultat de Biologia, Universitat de Barcelona, Diagonal 645, 08028 Barcelona, Spain. Tel.: +34-93-402-1461; fax: +34-93-403-5740. E-mail address: [email protected] (B. Gutie´rrez).

dopaminergic and muscarinic receptors (Richelson and Souder, 2000). The potent antagonism exerted by clozapine on 5-HT3 receptors (Hermann et al., 1996) has been hypothesised to contribute to the atypical clinical profile of this drug increasing its particular antipsychotic efficacy (Wang et al., 1994). In contrast to other serotonin receptor subtypes, 5-HT3 receptors are ligand-gated ion channels involved in rapid excitatory responses in peripheral and central nervous system. Because of their potential anxiolytic and antipsychotic properties, 5-HT3 receptor antagonists are being explored as therapeutic agents for a variety of behavioural disorders (Bloom and Morales, 1998).

0920-9964/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 9 2 0 - 9 9 6 4 ( 0 2 ) 0 0 2 0 5 - 0

94

B. Gutie´rrez et al. / Schizophrenia Research 58 (2002) 93–97

Two different isoforms of 5-HT3 receptor subunit genes (HTR3A and HTR3B) have been cloned (Maricq et al., 1991; Davies et al., 1999). They are located in the chromosomal region 11q23.1/23.2 (Weiss et al., 1995; Davies et al., 1999), where linkage with bipolar disorder and schizophrenia has been suggested by several authors (Maziade et al., 1995; Detera-Wadleigh et al., 1997; Levinson et al., 1998). In previous studies, we reported the finding of two novel 5-HT3A polymorphisms, 178-T/C and 1596-A/G (Arranz et al., 1997, 2000). In a recent study in a German sample, eight genetic variants were described in the 5-HT3A gene, the two mentioned above plus four infrequent polymorphisms (249-C/T, IVS3/A/7C, 795-G/A, 1050-G/A) and two novel but very rare structural mutations Arg344His, Pro391Arg (Niesler et al., 2001 a,b). None of those polymorphisms was found to be associated with schizophrenia (Niesler et al., 2001a). However, an association between the 5-HT3A 178-C/ T variant and bipolar disorder was described (Niesler et al., 2001b). The 5-HT3B receptor gene has not been systematically screened for mutations by any group to date. In the present study, a screening for natural occurring mutations in the 5-HT3A and 5-HT3B receptor genes was performed in a sample of unrelated individuals including schizophrenic patients and healthy controls. The putative role of 5-HT3A and 5-HT3B genes in clinical response to clozapine was evaluated.

2. Materials and methods 2.1. Clinical sample Two hundred and sixty-six unrelated patients with a DSMIII-R diagnosis of schizophrenia were included in the study. All patients were British Caucasians recruited in hospitals in London, Cambridge and Burnley (UK). Responses were retrospectively assessed based on medical notes using the GAS scales (Endicott et al., 1976). A 20-point improvement in GAS scores after a minimum of 3 months treatment was considered as cut-off for response. According to this criteria, the sample was divided into 180 responders and 86 nonresponders. Ethical approval was obtained for these studies.

2.2. Screening of 5-HT3A and 5-HT3B receptor genes Systematic screening for DNA variants in both 5HT3A and 5-HT3B genes was performed using singlestrand conformation polymorphism (SSCP) techniques (Orita et al., 1989). The screening sample included 48 schizophrenic patients and 48 unrelated healthy controls, all of British origin. Overlapping PCRs were designed covering the entire coding region of both genes. Nine sets of primers were chosen to produce nine overlapping fragments encompassing the coding region and the intron– exon boundaries of the human 5-HT3A gene. Eight sets of primers were chosen in the case of 5-HT3B gene (primer sequences and annealing temperatures for SSCP analysis are available on demand). Fragment sizes ranged from 196 to 365 bp. Standard PCR amplifications were carried out using 50 ng of genomic DNA, 10 pmol of each primer, 200 AM of each dNTP, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris –Cl (pH 8.3) and 0.5 U of DNA polymerase in a total volume of 25 Al. An initial 5-min cycle at 94 jC was followed by 35 cycles consisting of 1 min at 92 jC, 30 s at annealing temperature and 1 min at 72 jC, followed by a final extension step of 10 min at 72 jC. After amplification of each DNA fragment, standard SSCP was performed in 10% polyacrylamide gels under three different conditions: 18 h at room temperature, 48 h at room temperature in a polyacrylamide gel containing 2% glycerol and 48 h at + 4 jC. DNA bands were resolved by silver staining. When changes in migration patterns were found, automated sequencing was performed in an ABI 377 sequencer in order to identify the location and nature of the mutation. When possible, PCR-based restriction fragment length polymorphism (RFLP) assays were developed for rapid genotyping. Conditions for genotyping HTR3A and HTR3B variants are summarised in Table 1. 2.3. Statistical analyses The presence of allele or genotype association was determined with the v2 test of independence. Odds ratios (OR) with 95% confidence intervals were estimated for the effects of high-risk genotypes and alleles. The power of the sample was calculated to determine the probability of detecting a statistically significant effect of a given magnitude. Bonferroni

B. Gutie´rrez et al. / Schizophrenia Research 58 (2002) 93–97

95

Table 1 Genetic variants found in HTR3A and HTR3B: location, allele frequencies and molecular characterisation Primer sequences (5V! 3V)

TA

178C: 79% 178T: 21% 1596A: 76% 1596G: 24%

1F: GGAAACATGATCCAGCTGAAG 2B: TGGACCCACAGCAGCATAGC 13N: AAACCACTGCAGCCACATGGG 14N: CACTGGGCTGTACCCACTCAA

58 jC 236

–

58 jC 308

NheI

10% acrylamide/ 5% glycerol 3% agarose

CA: 36% CACA: 64% T: 98% C: 2% 529G: 98% 529A: 2% Ser533: > 99% Arg533: < 1% Leu537: >99% Ser537: < 1%

7F: CCAAGTATGATGCTGTAGGCC 8: GTCTTCTGGGCTCCTCAGAAA 7: GATACCCTGACCTTCCCTATG 8R: GGCCTACAGCATCATACTTGG 7: GATACCCTGACCTTCCCTATG 8R: GGCCTACAGCATCATACTTGG 7: GATACCCTGACCTTCCCTATG 8R: GGCCTACAGCATCATACTTGG MF: AGGTGGTCTCTGCGTGCAGAT MR: GGGGCCTACAGCATCATACTTGG

55 jC 363/365

–

10% acrylamide

55 jC 332

Sau96I

3% agarose

55 jC 332

NlaIII

3% agarose

55 jC 332

CviRI

3% agarose

58 jC 268

Sau3AI 10% acrylamide

Polymorphism Location Frequency HTR3A 178-C/T

5VUTR

1596-A/G

exon 9

HTR3B CA repeat

intron

T!C

intron

529-G/A

exon

Ser533Arg

exon

Leu537Ser

exon

PCR RE product (bp)

Detection

TA: annealing temperature; RE: restriction enzyme.

correction was applied to correct for possible type I errors due to multiple testing. We used the ARLEQUIN program (Schneider et al., 1996) to estimate haplotype frequencies for 178-T/C and 1596-A/G polymorphisms. Linkage disequilibrium coefficients were measured through the standardised DVvalue first reported by Lewontin (1964).

3. Results 3.1. 5-HT3A receptor gene After screening 100% of the coding region of the 5HT3A receptor gene, only two previously reported polymorphisms, 178-C/T and 1596-A/G, were detected (Arranz et al., 1997, 2000). The 5-HT3A 178T allele was found to be present in 21.2% of subjects and the 1596-G variant in 24% of them. Genotype frequencies were found to be in Hardy – Weinberg equilibrium in both groups of patients (responders and nonresponders to treatment). Polymorphism location, allele frequencies and detection methods are detailed in Table 1. The association analysis revealed that allele and genotype frequencies did not significantly differ be-

tween patients who responded to clozapine and patients who did not respond (178-C/T polymorphism ! alleles: v2 = 0.83, df = 1, p = 0.361; genotypes: v2 = 20.93, df = 2, p = 0.629; 1596-G/A polymorphism ! alleles: v2 = 0.08, df = 1, p = 0.776; genotypes: v2 = 0.59, df = 2, p = 0.745; Table 2). We examined linkage disequilibrium between the two polymorphisms and estimated haplotype frequencies. A high linkage disequilibrium between the 178C/T and 1596-A/G polymorphisms was detected in both groups of patients (DV= 0.98, p =0.0000). Haplotypes were found to be similarly distributed in both groups (v2 = 2.83, df = 3, p = 0.418, Table 3). Apart from the 178-C/T and 1596-A/G polymorphisms, six novel and infrequent mutations in the 5HT3A receptor gene (249-C/T, 795-G/A, 1050-G/A, A + 7C, Arg344His and Pro391Arg) have been recently described in a German sample (Niesler et al., 2001a). The genotyping of the three most frequent of these polymorphisms in our sample failed to find the rare variants 1050-A, His344 and Arg391. 3.2. 5-HT3B receptor gene Five novel variants in 5-HT3B gene (a CA repeat polymorphism, an intronic T/C change, a silent 529-

B. Gutie´rrez et al. / Schizophrenia Research 58 (2002) 93–97

96

Table 2 Allele and genotype frequencies of 178-C/T and 1596-A/G polymorphisms (HTR3A) and CA-repeat variant (HTR3B) in clozapinetreated patients 5-HT3A gene 178-C/T polymorphism Genotype C/C C/T T/T Allele C T

Responders

Nonresponders

71 (59.7%) 42 (35.3%) 6 (5.0%)

47 (65.3%) 23 (31.9%) 2 (2.8%)

184 (77.3%) 54 (22.7%)

117 (81.3%) 27 (18.7%)

4. Discussion

1596-A/G polymorphism Genotype A/A 93 (58.5%) A/G 57 (35.8%) G/G 9 (5.7%) Allele A 243 (76.4%) G 75 (23.6%)

134 (75.3%) 44 (24.7%)

5-HT3B gene

Nonresponders

Responders

CA-repeat polymorphism Genotype 2/2 80 (44.4%) 1/2 79 (43.9%) 1/1 21 (11.7%) Allele 2 CA-repeats 239 (66.4%) 1 CA-repeat 121 (33.6%)

Genotypes for both groups (responders and nonresponders) were in Hardy – Weinberg equilibrium. The association analysis showed that allele and genotype frequencies for the CA-repeat polymorphism were similarly distributed between responders and nonresponders to treatment (alleles: v2 = 2.15, df = 1, p = 0.14; genotypes: v2 = 4.53, df = 2, p = 0.104, Table 2).

49 (55.1%) 36 (40.4%) 4 (4.5%)

27 (31.4%) 49 (57.0%) 10 (11.6%) 103 (59.9%) 69 (40.1%)

G/A change, and two structural polymorphisms, Ser533Arg and Leu537Ser) were detected in our sample. The one-repeat allele of the CA-repeat polymorphism was found to be present in 36% of subjects. The C variant of the intronic polymorphism was detected in 2% of subjects screened. Two percent of individuals carried the 529-A allele, 1% the Arg-533 variant and 1% the 537-Ser mutation. Only the relatively frequent intronic CA-repeat polymorphism was tested for association with clozapine response.

The aim of this study was to investigate the possible role of the 5-HT3A and 5-HT3B receptor genes in clozapine response. We performed systematic mutation screening of both genes and found two polymorphic variants in 5-HT3A (178-C/T and 1596-A/G) and five new variants in 5-HT3B (an intronic CArepeat polymorphism, a T/C change, 529-G/A, Ser533Arg and Leu537Ser). We had previously reported the finding of the two genetic variants at 5HT3A (Arranz et al., 1997, 2000), which were also reported in a later study by Niesler et al. (2001a). All the 5-HT3B polymorphisms described here constitute novel polymorphisms not previously reported. Association analyses between the 5-HT3A polymorphisms and response were performed in a sample of clozapine treated patients. Given the allele frequencies found in our sample for the 178-T/C and 1596-A/ G variants, we had 80% power (95% CI) to detect an association that conferred a risk greater or equal than 2.3. However, no clear differences in allele, genotype or haplotype distributions were found between patients who responded and patients who did not respond to clozapine treatment. The 178-C/T missense mutation, located in an upstream open reading frame of 5-HT3A receptor gene, has recently been reported to be associated with bipolar disorder but not with schizophrenia in a German sample (Niesler et al., 2001b). Other very rare mutations also described by Niesler et al. in the German population (1050-G/A,

Table 3 Distribution of 178-C/T and 1596-A/G haplotypes in responders and nonresponders to clozapine treatment

Responders Nonresponders

C178-A1596

C178-G1596

T178-A1596

T178-G1596

135 (71.8%) 89 (72.1%)

13 (6.9%) 14 (10.9%)

15 (7.9%) 6 (4.6%)

25 (13.4%) 15 (12.4%)

B. Gutie´rrez et al. / Schizophrenia Research 58 (2002) 93–97

Arg344His, Pro391Arg) were not found in our sample. It is likely that these polymorphisms do not exist in the British population or are extremely rare suggesting that they may not play an important role in treatment response. Of the five sequence variants detected in 5-HT3B, four of them were found in a frequency < 2% and only the relatively frequent intronic CA-repeat polymorphism was tested for association with clozapine response. Taking into account the allele frequencies of the CA-repeat mutation, risks greater than 2.2 could be detected in our study with 80% power (95% CI). However, no differences in allele or genotype distributions of the CA-repeat variant were found in relation to clozapine response. In conclusion, our results suggest that it is unlikely that clozapine response is associated with variation in 5-HT3A and 5-HT3B receptor genes. However, an involvement of 5-HT3 receptors in the response to clozapine treatment, or even in the aetiology of psychiatric disorders, should not be discarded as research in the promoter regions of both genes has yet to be completed.

Acknowledgements Dr. Blanca Gutie´rrez was supported by an EMBO fellowship.

References Arranz, M.J., Munro, J., Kirov, G., Kerwin, R.W., Collier, D.A., 1997. Novel polymorphisms detected in the 5-HT3 receptor gene: association studies with schizophrenia and clozapine response. Am. J. Med. Genet. 74, 615. Arranz, M.J., Munro, J., Osborne, S., Gutie´rrez, B., Huezo, P., Dempster, D., Hassan, B.A., Niesler, B., Rappold, G.A., Kerwin, R.W., 2000. Novel polymorphisms in 5-HT3A receptor gene not related to schizophrenia and clozapine response. Am. J. Med. Genet. 96, 538. Bloom, F.E., Morales, M., 1998. The central 5-HT3 receptor in CNS disorders. Neurochem. Res. 23, 653 – 659. Davies, P.A., Pistis, M., Hanna, M.C., Peters, J.A., Lambert, J.J., Hales, T.G., Kirkness, E.F., 1999. The 5-HT3B subunit is a major determinant of serotonin-receptor function. Nature 397, 359 – 363. Detera-Wadleigh, S.D., Berrettini, W.H., Yoshikawa, T., Badner, J.A., Sanders, A.R., Goldin, L.R., 1997. Linkage disequilibrium de-

97

tects a potential susceptibility locus for bipolar disorder at 11q22 – 24. Am. J. Med. Genet. 74, 669. Endicott, J., Spritzer, R.L., Fleiss, J.L., Cohen, J., 1976. The global assessment scale. Arch. Gen. Psychiatry 55, S5 – S12. Hermann, B., Wetzel, C.H.R., Pestel, E., Zieglgnsberger, W., Holsboer, F., Rupprecht, R., 1996. Functional antagonistic properties of clozapine at the 5-HT3 receptor. Biochem. Biophys. Res. Commun. 225, 957 – 960. Kane, J.M., 1992. Clinical efficacy of clozapine in treatment — refractory schizophrenia: an overview. Br. J. Psychiatry 17, 41 – 45. Levinson, D.F., Mahtani, M.M., Nancarrow, D.J., Brown, D.M., Kruglyak, L., Kirby, A., 1998. Genome scan of schizophrenia. Am. J. Psychiatry 155, 741 – 750. Lewontin, R.C., 1964. The interaction of selection and linkage. General considerations: heterotic models. Genetics 49, 49 – 67. Lieberman, J.A., Safferman, A.Z., Pollack, S., Szymanski, S., Johns, C., Howard, A., Kronig, M., Bookstein, P., Kane, J.M., 1994. Clinical effects of clozapine in chronic schizophrenia: response to treatment and predictors of outcome. Am. J. Psychiatry 151 (12), 1744 – 1752. Maricq, A.V., Peterson, A.S., Brake, A.J., Myers, R.M., Julius, D., 1991. Primary structure and functional expression of the 5-HT3 receptor, a serotonin-gated ion channel. Science 254, 432 – 437. Maziade, M., Raymond, V., Cliche, D., Fournier, J.P., Caron, C., Garneau, Y., 1995. Linkage results on 11q21 – 22 in eastern Quebec pedigrees densely affected by schizophrenia. Am. J. Med. Genet. 60, 522 – 528. Niesler, B., Weiss, B., Fischer, C., No¨then, M.M., Propping, P., Bondy, B., Rietschel, M., Maier, W., Albus, M., Franzek, E., Rappold, G.A., 2001a. Serotonin receptor gene HTR3A variants in schizophrenic and bipolar affective patients. Pharmacogenetics 11, 21 – 27. Niesler, B., Flohr, T., No¨then, M.M., Fischer, C., Rietschel, M., Franzek, E., Albus, M., Propping, P., Rappold, G.A., 2001b. Association between the 5VUTR variant C178T of the serotonin receptor gene HTR3A and bipolar affective disorder. Pharmacogenetics 11, 1 – 5. Orita, M., Suzuki, Y., Sekiya, T., Hayashi, K., 1989. Rapid and sensitive detection of point mutations and polymorphisms using the polymerase chain reaction. Genomics 5, 874 – 879. Richelson, E., Souder, T., 2000. Binding of antipsychotic drugs to human brain receptors — focus on newer generation compounds. Life Sci. 68 (1), 29 – 39. Schneider, S., Kuefer, J.M., Roessli, D., Excoffier, L., 1996. Arlequin (version 1.0): A Software Environment for the Analysis of Population Genetics Data. Genetics and Biometry Lab., University of Geneva, Geneva. Wang, R.Y., Ashby, C.R., Edwards, E., Zhang, J.Y., 1994. The role of 5-HT3-like receptors in the action of clozapine. J. Clin. Psychiatry 55, 23 – 26. Weiss, B., Mertz, A., Schro¨ck, E., Koenen, M., Rappold, G.A., 1995. Assignment of a human homolog of the mouse HTR3 receptor gene to chromosome 11q23.1 – q23.2. Genomics 29, 304 – 305.