- Email: [email protected]
Novel mutations of CETP gene in Italian subjects with hyeralphalipoproteinemia
Atherosclerosis 204 (2009) 202–207
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
Novel mutations of CETP gene in Italian subjects with hyeralphalipoproteinemia Angelo B. Cefalù a,1 , Davide Noto a,1 , Lucia Magnolo b , Elisa Pinotti b , Monica Gomaraschi c , Scipione Martini d , Giovanni B. Vigna e , Laura Calabresi c , Patrizia Tarugi b,∗ , Maurizio R. Averna a,∗∗ a
Department of Clinical Medicine and Emerging Diseases, Policlinico “Paolo Giaccone”, University of Palermo, Via del Vespro 141, 90127 Palermo, Italy Department of Biomedical Sciences, University of Modena and Reggio Emilia, Via Campi 287, I-41100 Modena, Italy c Center E. Grossi Paoletti, Department of Pharmacological Sciences, University of Milan, Italy d Department of Medical Sciences, University of Padua, Padua, Italy e Department of Clinical and Experimental Medicine, University of Ferrara, Italy b
a r t i c l e
i n f o
Article history: Received 6 May 2008 Received in revised form 20 August 2008 Accepted 22 August 2008 Available online 4 September 2008 Keywords: Familial hyperalphalipoproteinemia CETP gene mutations CETP activity HDL size
a b s t r a c t Cholesteryl ester transfer protein (CETP) is a plasma glycoprotein that catalyses the transfer of cholesteryl esters from HDL to the other plasma lipoproteins. Genetic deficiency of CETP is one of the known causes of elevation of plasma HDL-C (primary hyperalphalipoproteinemia, HALP). We sequenced CETP gene in a group of 24 Italian subjects with primary HALP (HDL-C > 80 mg/dl) suspected to have CETP deficiency. Two unrelated subjects both coming from the same geographical district, were found to be heterozygous for a nucleotide substitution in exon 6 (c.544C > T) and another subject was found to be heterozygous for a C > T transition in exon 9 (c.802C > T). Both mutations introduce a premature stop codon and are predicted to cause the production of truncated proteins (Q165X and R268X, respectively) devoid of function. The fourth proband was found to carry a T > C substitution in intron 15 (c.1407 + 2T > C) predicted to abolish the function of the donor splice site. To define the effect of this mutation on CETP pre-mRNA splicing we analysed CETP mRNA in COS-1 cells expressing a CETP minigene harbouring the mutation. The analysis of minigene transcript in COS-1 cells showed that IVS15 + 2T > C mutation caused the formation of an abnormal mRNA in which exon 14 joins directly to exon 16, predicted to encode a truncated peptide of 435 amino acids. In mutation carriers plasma CETP activity was found to be reduced by 38–60%. These are the first mutations in the CETP gene found in Italian subjects with HALP. © 2008 Elsevier Ireland Ltd. All rights reserved.
1. Introduction The term hyperalphalipoproteinemia (HALP) indicates a plasma lipid abnormality characterized by an increased plasma level of high density lipoprotein cholesterol (HDL-C) above the 90th percentile of the general population [1]. HALP may be associated with various diseases or use of medications (secondary HALP) or may be due to genetic factors (primary HALP) [2]. Primary HALP is a genetically heterogeneous lipoprotein disorder, usually transmitted as a co-dominant trait, (Familial HALP) linked to some candidate genes known to affect HDL metabolism or to genes yet to be identified [1–6]. The best known monogenic cause of primary HALP is cholesteryl ester (CE) transfer protein (CETP) deficiency due to mutations in CETP gene (OMIM 607322) [1–3].
∗ Corresponding author. Tel.: +39 059 2055 416; fax: +39 059 2055 426. ∗∗ Corresponding author. Tel.: +39 091 6552993; fax: +39 091 6552936. E-mail addresses: [email protected] (P. Tarugi), [email protected] (M.R. Averna). 1 These authors contributed equally to this work. 0021-9150/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.atherosclerosis.2008.08.031
Human CETP is a 476-residue hydrophobic plasma glycoprotein that plays a key role in reverse cholesterol transport (RCT) by facilitating the transfer of cholesteryl esters from HDL to low density lipoprotein (LDL) [7]. Decreased or absent CETP activity results in a variable elevation of plasma levels of HDL-C and apolipoprotein A-I (apoA-I). Genetic CETP deficiency is the most common cause of HALP in Japan [2,3]. The subjects with CETP deficiency show a variety of abnormalities in the plasma concentration, composition and size of HDL and, to some extent, of LDL [3]. Although low levels of plasma HDL-C may lead to the development of atherosclerosis, there has been no consensus as to whether subjects with markedly elevated plasma HDL-C due to CETP deficiency are resistant to atherosclerosis. The relationship between reduced CETP function and the susceptibility to atherosclerosis is still a controversial issue: both longevity and increased atherosclerotic coronary artery disease (CAD) risk have been reported in subjects with CETP deficiency (ref. [8] for review). In view of the physiological role of CETP in RCT [7], CETP deficiency may possibly lead to the development of atherosclerosis despite high HDL-C levels.
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
Mutations of CETP gene reported as the cause of HALP were mostly found in the Japanese population where several homozygous individuals have been identified [2]. To our knowledge there are only few reports of CETP deficiency in Caucasians [9–12] and only few homozygous patients with complete CETP deficiency have been reported in Caucasian populations [9–11]. A recent survey of 95 Caucasian subjects with HALP recruited from the Dutch population, led to the identification of only one subject heterozygous for a CETP gene mutation [12]. In the present study we describe four subjects of Italian descent with primary HALP due to mutations in CETP gene predicted to cause CETP deficiency. 2. Subjects and methods 2.1. HALP subjects We investigated 24 (four males and 20 females with an age range from 17 to 74 years, mean age 49.7 ± 15.5 years) unrelated Caucasian subjects who had been referred to lipid clinics for hypercholesterolemia (mean total cholesterol = 277.5 ± 54 mg/dl) in the absence of overt clinical manifestations. A more detailed analysis of plasma lipid profile revealed that they had elevated plasma HDL-C (113 ± 17 mg/dl) not related to the presence of diseases, life style or drug treatment known to be associated with elevation of plasma HDL-C. Table 1 shows the main clinical characteristics of the 24 HALP subjects. Routine laboratory tests, with the exception of plasma lipids, were in the normal range. Written informed consent was obtained from all subjects investigated. The study was approved by the institutional human investigation committee of each participating institution. 2.2. Laboratory investigations Plasma lipids and lipoproteins were measured by routine procedures. The sequence of CETP gene was performed by direct sequencing of the promoter and coding regions [10]. 2.3. CETP activity and mass CETP activity was assessed by measuring the transfer of fluorescent CE from reconstituted HDL (rHDL) to human LDL using probands’ plasma as a source of CETP. BODIPY FL12 (Molecular Probes, Invitrogen, CA, U.S.A.) was used as fluorescent CE analog. Fluorescent rHDL was synthesized as previously described [13]. Briefly, phosphatidylcholine (0.15 mM), sphingomyelin (0.4 mM), cholesterol (0.4 mM), triolein (0.34 M), cholesteryl palmitate (0.14 mM), BODIPY FL12 (50 M) were dissolved in chloroform and dried under a stream of nitrogen. Two ml of Tris-EDTA buffer Table 1 Clinical characteristics of the 24 HALP subjects Age (years) Sex (M/F) BMI (kg/m2 ) TC (mg/dl) TG (mg/dl) HDL-C (mg/dl) LDL-C (mg/dl) Apo A-I (mg/dl) Alcohol users Alcohol intake (g/day range) Current smokers Menopause CHD Family history of CHD
49.7 ± 15.5 4/20 21.17 ± 3.7 277.5 ± 54 76 ± 27 113 ± 17 144 ± 64 172 ± 43 5/24 13–35 3/24 (12.5%) 13/20 (65%) 0/24 1/24
203
was added and the mixture was sonicated in ice for 45 min in a Branson Sonifier 250 (Branson, U.S.A.). Three milligrams of HDL3 apolipoproteins were added and the mixture was sonicated for further 15 min. The rHDL particles of the appropriate size were isolated by FPLC using two Superose 6 columns (GE Healthcare Life Sciences, U.S.A.) as described in ref. [14]. The fluorescence of rHDL was detected in Shimadzu RXL10 (Shimadzu, Tokyo, Japan) spectrofluorimeter. rHDL (9000 fluorescence units) were incubated with 10 l of proband plasma, 50 g of normal LDL in 500 l of Tris-EDTA buffer pH 7.4. Samples were incubated for 16 h at 37 ◦ C; a parallel incubation was also performed at 4 ◦ C to measure the non-enzymatic fluorescent CE transfer between lipoproteins. After incubation samples were subjected to Superose 6 gel filtration chromatography; 0.5 ml fractions were collected and the fluorescence was measured by spectrofluorimetry. The fluorescence areas in the HDL and LDL peak were analysed by gaussian fitting using the SAAM II software (RFKA, Seattle, U.S.A.) and expressed as arbitrary fluorescence units (AFU) as percent of the total area. CE transfer rates (CETRs) were calculated as percent of LDL fluorescence area divided by total fluorescence area after incubation. CETR values were corrected by subtracting the percent LDL fluorescence area found in samples incubated at 4 ◦ C. Plasma CETP concentration was measured by ELISA as previously described [15]. 2.4. HDL size HDL particle size distribution was analyzed by nondenaturing PAGE using precast 4–30% slab gels (Pharmacia Biotec) [14] Aliquots of the d < 1.21 g/ml plasma fraction which had been isolated by ultracentrifugation at 100,000 rpm for 3 h at 4 ◦ C in a Beckman TL 100.3 rotor, were applied to the gels. The gels were scanned by an LKB Ultroscan XL laser densitometer (Pharmacia Biotech) and particle sizes calculated with the LKB 2400 Gelscan XL software, with the use of thyroglobulin, apoferritin, lactate dehydrogenase, and bovine serum albumin as calibration proteins. Five HDL subpopulations were identified and classified according to the criteria proposed by Verdery et al. [16] as follows: HDL2b , 9.7–2.9 nm; HDL2a , 8.8–9.7 nm; HDL3a , 8.2–8.8 nm; HDL3b , 7.8–8.2 nm, and HDL3c , 7.2–7.8 nm. To calculate the percentage distribution of HDL subpopulations, areas under the scanning curves were integrated by dropping vertical lines corresponding to the subpopulation size limits; the total integrated area in the 7.2–12.9 nm size-interval was considered to be 100% [16]. 2.5. Construction of CETP minigenes and their expression in transfected cells To investigate the effect of a splice site mutation in intron 15 (c.1407 + 2T > C, IVS15 + 2C > T) identified in subject HPLA-650 (see below) we adopted an in vitro strategy. This procedure included, as a first step, the construction of wild-type and mutant CETP minigenes by the amplification of the appropriate CETP gene region (encompassing the splice site harbouring the mutation) from the proband’s genomic DNA. The minigene (1476 bp) contained the 3 half of exon 14 (52 bp), intron 14, exon 15, intron 15, and the 5 half exon 16 (70 bp). The primer pairs used for amplification were: 5 AGCTTCCTGCAGTCAATGATCACC 3 (forward primer) and 5 TCAAGCTCTGGAGGAAATCCACC 3 (reverse primer); the amplification conditions were 30 cycles at 95 ◦ C for 1.5 min, 65 ◦ C for 1 min, 68 ◦ C for 1.30 min, and 68 ◦ C for 10 min. The minigenes were cloned in the pTargeTTM (Promega, Madison, WI, U.S.A.) expression
204
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
vector and then transfected into COS-1 cells as previously described [17].
changes at CETP level are described according to NCBI reference sequence (NP 000069.2).
2.6. Expression of CETP minigenes in transfected cells
3. Results
COS-1 cells maintained in the DMEM containing 5% FBS were used for transfection. Cells (1 × 106 ) were plated in 60 mm dishes. After 24 h 8 g of plasmids containing either wild-type or mutant minigene was transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, U.S.A.). Forty two hours after transfection total RNA was extracted with Eurozol (Euroclone, Paigton, Devon, UK) and treated with RNase-free DNase (Promega, Madison, WI, U.S.A.). RT-PCR amplification of CETP minigene mRNAs was performed using primers and conditions reported above. The RT-PCR products were separated by electrophoresis in 2% agarose gel and sequenced as described above using appropriate primers. To provide an internal control for transfection efficiency, the mRNA of Neomycin resistance gene (present in the vector) was reverse transcribed and PCR amplified using appropriate primers [17].
3.1. Analysis of CETP gene
2.7. Mutation nomenclature All mutations are described according to mutation nomenclature [18,19] (http://www.hgvs.org/munomen/). Nucleotide numbers are derived from cDNA CETP sequence (GenBank accession number NT 000078). For cDNA numbering +1 corresponds to the A of the ATG translation initiation codon. Amino acid sequence
The CETP gene was analysed in the 24 subjects with HALP. Four unrelated subjects (designated HALP-650, HALP-714, HALP-1042 and HALP-1767, respectively) were found to carry CETP gene mutations. Proband HALP-650 was found to be heterozygous for a T > C substitution in the donor splice site of intron 15 (c.1407 + 2T > C) of CETP gene. This mutation is predicted to abolish the function of the corresponding site (automated splice site analysis, https://splice.uwo.ca). To define its effect on CETP pre-mRNA splicing we analysed the CETP transcript in COS-1 cells expressing a minigene harbouring the mutation. This analysis showed that c.1407 + 2T > C mutation caused the formation of an abnormal mRNA devoid of exon 15 predicted to encode a truncated CETP protein of 435 amino acids (Fig. 1). Two apparently unrelated subjects (HALP-714 and HALP-1042), both coming from Sicily, were found to be heterozygous for a single nucleotide substitution in exon 6 (c.544C > T) resulting in the conversion of glutamine codon at position 165 into a premature stop codon (Q165X). The sister of proband HALP-714 (designated HALP1765) was found to carry the Q165X mutation, however her plasma HDL-C level was within the normal range (54 mg/dl) (Table 2).
Fig. 1. Analysis of transcription product of mutant CETP minigene harbouring the c.1407 + 2T > C mutation in intron 15. RNA isolated from COS-1 cells transfected with wild-type and mutant CETP minigene, respectively, was reverse transcribed and the cDNA region spanning from the 3 half of exon 14 to the 5 half of exon 16, was amplified by PCR. Panel A: untrasfected cells (lanes 1–3); DNA size marker (lanes 4 and 9); CETP cDNA in cells transfected with wild-type (lane 5) and mutant minigene (lane 6); PCR-amplification of wild-type (lane 7) and mutant minigenes obtained from genomic DNA (lane 8); cDNA of neomycin resistance gene in cells transfected with wild-type (lane 10) and mutant minigene (lane 11); “mock” RT-PCR in cells transfected with wild-type (lane 12) and mutant minigene (lane 13). Panel B: partial nucleotide sequence of the cDNA generated by the mutant CETP minigene harbouring the c.1407 + 2T > C mutation in intron 15. The upper panel shows the junction between exons 14–15 and exons 15–16 in the cDNA generated by wild-type minigene. The lower panel shows that in mutant cDNA exon 14 joins to exon 16. This junction causes a frame shift leading to a premature stop codon (the novel amino acids are shown in italics).
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
205
Table 2 Plasma lipids and lipoproteins in HALP subjects with CETP mutations Subject ID
Age (year)
Gender
Total cholesterol
Triglycerides
HDL-C
LDL-C
Apo A-I
Apo B
HALP-650 HALP- 714 HALP-1765 HALP-1042 HALP-1199 HALP-1201 HALP-1202 HALP-1767 All carriers n. 8 HALP without CETP mutations n. 20
60 59 60 33 65 60 62 56 57 ± 9* 49 ± 16*
F F F F F F F F
278 251 226 301 285 193 247 300 260 ± 35* 277 ± 57*
122 76 186 38 127 85 95 69 100 ± 42* 77 ± 28*
162 91 54 159 75 60 63 96 95 ± 40* 111 ± 12*
92 145 135 134 185 116 165 191 145 ± 31* 143 ± 67*
210 207 137 140 185 132 135 251 175 ± 42* 183 ± 53*
76 103 101 39 107 51 67 109 82 ± 25* 81 ± 15*
Total cholesterol, triglycerides, HDL-C, LDL-C, Apo A-I and Apo B are expressed in mg/dl. * Mean ± standard deviation.
Members of probands’ families were not willing to participate in clinical and laboratory testing with the exception of: (i) two siblings of proband HALP-714 and (ii) four relatives of proband HALP-1042 (three aunts and one second cousin). These family members gave their consent only for biochemical and for DNA testing. Three (HALP-1199, HALP-1201 and HALP-1202) out of the four relatives of HALP-1042 and one sister of HALP-714 (HALP-1765) were found to carry the CETP mutation (Table 2). Proband HALP-1767 was found to be heterozygous for a C > T transition in exon 9 (c.802C > T) resulting in the conversion of arginine codon into a stop codon (R268X). 3.2. Clinical and biochemical features of CETP gene mutation carriers Probands HALP-714 and HALP-1042 were free of clinical sign and/or symptoms of cardiovascular disease. In proband HALP-650 supra-aortic duplex scanning disclosed fibrous plaques determining a mild stenosis (30% at right and 20% at left internal carotid artery). Subject HALP-1767 had a positive family history for coronary heart disease but had no clinical manifestations related to cardiovascular disease nor ultrasonographic signs of carotid atherosclerosis. Table 2 shows the plasma lipid and apolipoprotein levels of CETP mutation carriers and of the 20 HALP subjects without CETP mutations. 3.3. CETP activity and plasma HDL Table 3 shows the CETP mass and activity in CETP mutation carriers. The CETP mass was close to or below the lower limit of the normal range. Fig. 2 shows the CETR activity expressed as percent of the average of two control subjects. CETR activity was slightly reduced in
Fig. 2. CETP-mediated transfer of fluorescent cholesteryl ester between reconstituted HDL and human plasma LDL in four CETP mutation carriers and in two unaffected normal controls. Cholesterol ester transfer rates (CETR) are calculated as percent of fluorescence detected in the LDL peak area after 16 h of incubation with fresh plasma. CETR activities, adjusted by subtracting the LDL fluorescence detected at 4 ◦ C, are expressed as percent of the average CETR activity of two normal control samples assayed in duplicate. Standard deviations are shown.
the 20 HALP subjects without CETP mutations (71 ± 12% of the control value as shown in Table 3). All CETP mutation carriers showed reduced CETR activity, with a broad variability (between 31% and 67% of the control value) (Table 3). In four CETP mutation carriers we measured the HDL size. The size of HDL-2 and HDL-3 was within the normal range in all probands, but HDL subclass distribution was characterized by an increased percentage of the large HDL fraction, which was particularly evident in subject HALP-1042 (Supplementary Table 1). The HDL distribution was also analysed in subject HALP-1765, a carrier of Q165X mutation who had normal levels of plasma HDLC. In this subject, however, HDL-2 distribution was comparable to that of the other CETP mutation carriers.
Table 3 CETP activity and CETP mass in HALP subjects with and without CETP mutations Subject ID
Mutation
Status
CETP activity (% CE transfer)
CETP mass (g/mL)*
HALP-650 HALP-714 HALP-1042 HALP-1765 HALP-1767 HALP-1199 HALP-1201 HALP-1202 HALP without CETP mutations n. 20
IVS15 + 2T/C Q165X Q165X Q165X R268X Q165X Q165X Q165X
Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote
38 51 31 67 NA 58 64 65 71 ± 12◦
0.88 0.89 1.16 1.21 NA 1.14 1.20 1.29 1.52 ± 0.29◦
*
Reference values (0.8–2.2 ug/mL); ◦ Mean ± standard deviation; NA: not available.
206
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
4. Discussion In the present study we analysed the CETP gene in 24 Italian subjects with primary hyperalphalipoproteinemia and identified four carriers of CETP mutations predicted to result in truncated inactive proteins. In one proband we identified a novel mutation (c.1407 + 2T > C) involving the donor splice site of intron 15 (IVS15 + 2T > C) and demonstrated its pathogenic effect on CETP pre-mRNA splicing in vitro. We show that this mutation causes the formation of an abnormal mRNA devoid of exon 15 predicted to encode a truncated CETP protein of 435 amino acids as opposed to the 476 amino acid of the wild type protein. This truncated protein may be synthesized in small amounts, in view of the rapid degradation of the corresponding mRNA carrying a premature stop codon (nonsense mediated mRNA decay) and/or may not be secreted due its retention in the endoplasmic reticulum followed by rapid degradation. A truncated CETP protein of similar size (402 amino acids), resulting from another splice site mutation (IVS14 + 1G > A), was found to be rapidly degraded intracellularly in the transfected COS-1 cells [3]. If secreted into the plasma the truncated 435 amino acid protein might have a reduced capacity to bind cholesteryl esters. The functional role of the C-terminal end of CETP is demonstrated by three observations: (i) the monoclonal antibody mAB TP2 that recognizes an epitope in the carboxyl-terminus of CETP is able to neutralize CETP activity [20]; (ii) mutagenesis of the carboxyl-terminal region abolishes CETP activity [21]; (iii) the crystal structure of CETP has revealed that one CETP molecule is capable of binding two CE molecules at the N- and C-terminal domains, respectively [22]. Therefore the deletion of 41 amino acids in the C-terminal domain could drastically impair the CE binding capacity of mutant CETP protein. In two apparently unrelated probands from Sicily we identified a nonsense mutations predicted to result in short truncated CETP proteins (Q165X) devoid of function. This mutation was recently reported in a compound heterozygote from Greece with complete CETP deficiency [11]. Since the island of Sicily has had prolonged contacts with Greece over the centuries one might speculate about a common origin of this mutation in the Mediterranean area. The Q165X mutation was found in two kindred with a different HALP phenotype. Although the two probands (HALP-714 and HALP-1042) showed a lipoprotein phenotype consistent with HALP (HDL-C > 80 mg/dl), they differ in term of the HDL-C levels. Proband HALP-1042 had a marked HDL-C elevation (HDL-C = 159 mg/dl) while proband HALP-714 and her sister (HALP-1765) had much lower HDL-C levels (91 and 54 mg/dl, respectively). This different expression of HALP phenotype was associated with a broad variability of CETP activity measured by a FPLC-based assay; the lowest CETP activity (31% of normal) was observed in proband HALP-1042 which showed the highest plasma HDL-C levels (159 mg/dl) while the highest activity was observed in the proband HALP-714 and her sister (HALP-1765) who had the lowest HDL-C level. Though CETP mass is generally reduced in all CETP gene mutations carriers, CETP activity is not decreased to the same extent in all of them. A possible explanation of this discrepancy could be a different CE transfer rate from LDL towards HDLs in HALP subjects, a condition that may affect the net CE transfer rate towards LDL. The variable CETP activity/mass in heterozygous carriers of null CETP allele (as in the case of the subjects reported in this study) has been a common observation in large studies, which showed that the CETP activity in heterozygotes for CETP gene mutations was 56–68% of controls [2]. This suggests that there might be an over-expression of the wild type allele or a reduced catabolism of the wild type protein, as a compensatory mechanism for the lack of expression of the mutant allele. In subjects homozygotes
for null alleles (e.g. homozygotes for IVS14 + 1G > A) the complete deficiency of CETP activity/mass has been associated with a 2–5 fold increase of HDL-C relative to controls [2]. In heterozygotes for these mutations the impact of partial CETP deficiency on HDL levels is much less dramatic (25–80%) increase as compared to control subjects) [2]. Genetic CETP deficiency is the most important and common cause of HALP in the Japanese population [2,3]. Twelve mutations of the CETP gene have been demonstrated to be the cause of HALP, in this population, including two common mutations: a splicing defect (IVS14 + 1G > A) [2,3] and a missense mutation (D442G), respectively [2]. In homozygous form the IVS14 + 1G > A mutation causes a complete CETP deficiency and a marked elevation of plasma HDL-C and apoA-I. Homozygosity for the D442G mutation causes a partial CETP deficiency and a less pronounced increase of HDL-C and apoA-I. CETP deficiency due to mutations in CETP gene are thought to be rare among Caucasians. However in our survey of 24 subjects attending the lipid clinic with the clinical diagnosis of hypercholesterolemia and found to have elevated plasma HDL-C, we identified four subjects heterozygous for CETP null allele. In view of this observation we are tempted to suggest that in the Italian population CETP gene mutations might be more frequent than presently believed. Population screening for the mutations reported in this study are now in progress. The assessment of the clinical phenotype in subjects with hyperalphalipoproteinemia with and without CETP deficiency is a relevant point specifically with regard to cardiovascular disease. We cannot draw any conclusion on this aspect since the clinical data of our HALP subjects are preliminary and further long term prospective studies are needed. Acknowledgements University of Palermo, Italy; Contract grant number: “60%” to Averna MR. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.atherosclerosis.2008.08.031. References [1] Tall AR, Breslow JL, Rubin EM. Genetic disorders affecting plasma high-density lipoproteins. In: Scriver CR, Beaudet AL, Valle D, Sly WS, editors. The metabolic and molecular bases of inherited disease, vol. II, 8th ed. New York: McGraw Hill; 2001. p. 2915–36. [2] Maruyama T, Sakai N, Ishigami M, et al. Prevalence and phenotypic spectrum of cholesteryl ester transfer protein gene mutations in Japanese hyperalphalipoproteinemia. Atherosclerosis 2003;166:177–85. [3] Nagano M, Yamashita S, Hirano K, et al. Molecular mechanisms of cholesteryl ester transfer protein deficiency in Japanese. J Atheroscler Thromb 2004;11:110–21. [4] von Eckardstein A, Holz H, Sandkamp M, Weng W, Funke H, Assmann G. Apolipoprotein C-III(Lys58–Glu). Identification of an apolipoprotein C-III variant in a family with hyperalphalipoproteinemia. J Clin Invest 1991;87:1724–31. [5] Canizales-Quinteros S, Aguilar-Salinas CA, Reyes-Rodríguez E, et al. Locus on chromosome 6p linked to elevated HDL cholesterol serum levels and to protection against premature atherosclerosis in a kindred with familial hypercholesterolemia. Circ Res 2003;92:569–76. [6] Heijmans BT, Beekman M, Putter H, et al. Meta-analysis of four new genome scans for lipid parameters and analysis of positional candidates in positive linkage regions. Eur J Hum Genet 2005;13:1143–53. [7] Barter PJ. Hugh sinclair lecture: the regulation and remodelling of HDL by plasma factors. Atheroscler Suppl 2002;3:39–47. [8] de Grooth GJ, Klerkx AHEM, Stroes ESG, Stalenhoef AFH, Kastelein JJP, Kuivenhoven JA. A review of CETP and its relation to atherosclerosis. J Lipid Res 2004;45:1967–74. [9] Funke H, Wiebusch H, Fuer L, Muntoni S, Schulte H, Assmann G. Identification of mutations in the cholesteryl ester transfer protein in Europeans
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
[10]
[11]
[12]
[13] [14]
[15]
with elevated high density lipoprotein cholesterol. Circulation 1994;90. I-241 [Abstract]. Teh EM, Dolphin PJ, Breckenridge WC, Tan M-H. Human Plasma CETP deficiency: identification of a novel mutation in exon 9 of the CETP gene in a Caucasian subject from North America. J Lipid Res 1998;39:442–56. Rhyne J, Ryan MJ, White C, Chimonas T, Miller M. The two novel CETP mutations Gln87X and Gln165X in a compound heterozygous state are associated with marked hyperalphalipoproteinemia and absence of significant coronary artery disease. J Mol Med 2006;84:647–50. van der Steeg WA, Hovingh GK, Klerkx AHEM, et al. Cholesteryl ester transfer protein and hyperalphalipoproteinemia in Caucasians. J Lipid Res 2007;48:674–82. Reaven E, Tsai L, Azhar S. Cholesterol uptake by the ‘selective’ pathway of ovarian granulosa cells: early intracellular events. J Lipid Res 1995;36:1602–17. Averna M, Marcovina SM, Noto D, Cole TG, Krul ES, Schonfeld G. Familial hypobetalipoproteinemia is not associated with low levels of lipoprotein(a). Arterioscler Thromb Vasc Biol 1995;15:2165–75. Murakami T, Michelagnoli S, Longhi R, et al. Triglycerides are major determinants of cholesterol esterification/transfer and HDL remodeling in human plasma. Arterioscler Thromb Vasc Biol 1995;15:1819–28.
207
[16] Verdery RB, Benham DF, Baldwin HL, Goldberg AP, Nichols AV. Measurement of normative HDL subfraction cholesterol levels by Gaussian summation analysis of gradient gels. J Lipid Res 1989;30:1085–95. [17] Di Leo E, Magnolo L, Lancellotti S, et al. Abnormal apolipoprotein B premRNA splicing in patients with familial hypobetalipoproteinaemia. J Med Genet 2007;44:219–24. [18] den Dunnen JT, Antonarakis SE. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 2000;15:7–12. [19] den Dunnen JT, Paalman MH. Standardizing mutation nomenclature: why bother? Hum Mutat 2003;22:181–2. [20] Roy P, MacKenzie R, Hirama T, et al. Structure-function relationships of human cholesteryl ester transfer protein: analysis using monoclonal antibodies. J Lipid Res 1996;37:22–34. [21] Wang S, Wang X, Deng L, Rassart E, Milne RW, Tall AR. Point mutagenesis of carboxyl-terminal amino acids of cholesteryl ester transfer protein. Opposite faces of an amphipathic helix important for cholesteryl ester transfer or for binding neutralizing antibody. J Biol Chem 1993;268:1955–9. [22] Qiu X, Mistry A, Ammirati MJ, et al. Crystal structure of cholesteryl ester transfer protein reveals a long tunnel and four bound lipid molecules. Nat Struct Mol Biol 2007;14:106–13.
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
Novel mutations of CETP gene in Italian subjects with hyeralphalipoproteinemia Angelo B. Cefalù a,1 , Davide Noto a,1 , Lucia Magnolo b , Elisa Pinotti b , Monica Gomaraschi c , Scipione Martini d , Giovanni B. Vigna e , Laura Calabresi c , Patrizia Tarugi b,∗ , Maurizio R. Averna a,∗∗ a
Department of Clinical Medicine and Emerging Diseases, Policlinico “Paolo Giaccone”, University of Palermo, Via del Vespro 141, 90127 Palermo, Italy Department of Biomedical Sciences, University of Modena and Reggio Emilia, Via Campi 287, I-41100 Modena, Italy c Center E. Grossi Paoletti, Department of Pharmacological Sciences, University of Milan, Italy d Department of Medical Sciences, University of Padua, Padua, Italy e Department of Clinical and Experimental Medicine, University of Ferrara, Italy b
a r t i c l e
i n f o
Article history: Received 6 May 2008 Received in revised form 20 August 2008 Accepted 22 August 2008 Available online 4 September 2008 Keywords: Familial hyperalphalipoproteinemia CETP gene mutations CETP activity HDL size
a b s t r a c t Cholesteryl ester transfer protein (CETP) is a plasma glycoprotein that catalyses the transfer of cholesteryl esters from HDL to the other plasma lipoproteins. Genetic deficiency of CETP is one of the known causes of elevation of plasma HDL-C (primary hyperalphalipoproteinemia, HALP). We sequenced CETP gene in a group of 24 Italian subjects with primary HALP (HDL-C > 80 mg/dl) suspected to have CETP deficiency. Two unrelated subjects both coming from the same geographical district, were found to be heterozygous for a nucleotide substitution in exon 6 (c.544C > T) and another subject was found to be heterozygous for a C > T transition in exon 9 (c.802C > T). Both mutations introduce a premature stop codon and are predicted to cause the production of truncated proteins (Q165X and R268X, respectively) devoid of function. The fourth proband was found to carry a T > C substitution in intron 15 (c.1407 + 2T > C) predicted to abolish the function of the donor splice site. To define the effect of this mutation on CETP pre-mRNA splicing we analysed CETP mRNA in COS-1 cells expressing a CETP minigene harbouring the mutation. The analysis of minigene transcript in COS-1 cells showed that IVS15 + 2T > C mutation caused the formation of an abnormal mRNA in which exon 14 joins directly to exon 16, predicted to encode a truncated peptide of 435 amino acids. In mutation carriers plasma CETP activity was found to be reduced by 38–60%. These are the first mutations in the CETP gene found in Italian subjects with HALP. © 2008 Elsevier Ireland Ltd. All rights reserved.
1. Introduction The term hyperalphalipoproteinemia (HALP) indicates a plasma lipid abnormality characterized by an increased plasma level of high density lipoprotein cholesterol (HDL-C) above the 90th percentile of the general population [1]. HALP may be associated with various diseases or use of medications (secondary HALP) or may be due to genetic factors (primary HALP) [2]. Primary HALP is a genetically heterogeneous lipoprotein disorder, usually transmitted as a co-dominant trait, (Familial HALP) linked to some candidate genes known to affect HDL metabolism or to genes yet to be identified [1–6]. The best known monogenic cause of primary HALP is cholesteryl ester (CE) transfer protein (CETP) deficiency due to mutations in CETP gene (OMIM 607322) [1–3].
∗ Corresponding author. Tel.: +39 059 2055 416; fax: +39 059 2055 426. ∗∗ Corresponding author. Tel.: +39 091 6552993; fax: +39 091 6552936. E-mail addresses: [email protected] (P. Tarugi), [email protected] (M.R. Averna). 1 These authors contributed equally to this work. 0021-9150/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.atherosclerosis.2008.08.031
Human CETP is a 476-residue hydrophobic plasma glycoprotein that plays a key role in reverse cholesterol transport (RCT) by facilitating the transfer of cholesteryl esters from HDL to low density lipoprotein (LDL) [7]. Decreased or absent CETP activity results in a variable elevation of plasma levels of HDL-C and apolipoprotein A-I (apoA-I). Genetic CETP deficiency is the most common cause of HALP in Japan [2,3]. The subjects with CETP deficiency show a variety of abnormalities in the plasma concentration, composition and size of HDL and, to some extent, of LDL [3]. Although low levels of plasma HDL-C may lead to the development of atherosclerosis, there has been no consensus as to whether subjects with markedly elevated plasma HDL-C due to CETP deficiency are resistant to atherosclerosis. The relationship between reduced CETP function and the susceptibility to atherosclerosis is still a controversial issue: both longevity and increased atherosclerotic coronary artery disease (CAD) risk have been reported in subjects with CETP deficiency (ref. [8] for review). In view of the physiological role of CETP in RCT [7], CETP deficiency may possibly lead to the development of atherosclerosis despite high HDL-C levels.
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
Mutations of CETP gene reported as the cause of HALP were mostly found in the Japanese population where several homozygous individuals have been identified [2]. To our knowledge there are only few reports of CETP deficiency in Caucasians [9–12] and only few homozygous patients with complete CETP deficiency have been reported in Caucasian populations [9–11]. A recent survey of 95 Caucasian subjects with HALP recruited from the Dutch population, led to the identification of only one subject heterozygous for a CETP gene mutation [12]. In the present study we describe four subjects of Italian descent with primary HALP due to mutations in CETP gene predicted to cause CETP deficiency. 2. Subjects and methods 2.1. HALP subjects We investigated 24 (four males and 20 females with an age range from 17 to 74 years, mean age 49.7 ± 15.5 years) unrelated Caucasian subjects who had been referred to lipid clinics for hypercholesterolemia (mean total cholesterol = 277.5 ± 54 mg/dl) in the absence of overt clinical manifestations. A more detailed analysis of plasma lipid profile revealed that they had elevated plasma HDL-C (113 ± 17 mg/dl) not related to the presence of diseases, life style or drug treatment known to be associated with elevation of plasma HDL-C. Table 1 shows the main clinical characteristics of the 24 HALP subjects. Routine laboratory tests, with the exception of plasma lipids, were in the normal range. Written informed consent was obtained from all subjects investigated. The study was approved by the institutional human investigation committee of each participating institution. 2.2. Laboratory investigations Plasma lipids and lipoproteins were measured by routine procedures. The sequence of CETP gene was performed by direct sequencing of the promoter and coding regions [10]. 2.3. CETP activity and mass CETP activity was assessed by measuring the transfer of fluorescent CE from reconstituted HDL (rHDL) to human LDL using probands’ plasma as a source of CETP. BODIPY FL12 (Molecular Probes, Invitrogen, CA, U.S.A.) was used as fluorescent CE analog. Fluorescent rHDL was synthesized as previously described [13]. Briefly, phosphatidylcholine (0.15 mM), sphingomyelin (0.4 mM), cholesterol (0.4 mM), triolein (0.34 M), cholesteryl palmitate (0.14 mM), BODIPY FL12 (50 M) were dissolved in chloroform and dried under a stream of nitrogen. Two ml of Tris-EDTA buffer Table 1 Clinical characteristics of the 24 HALP subjects Age (years) Sex (M/F) BMI (kg/m2 ) TC (mg/dl) TG (mg/dl) HDL-C (mg/dl) LDL-C (mg/dl) Apo A-I (mg/dl) Alcohol users Alcohol intake (g/day range) Current smokers Menopause CHD Family history of CHD
49.7 ± 15.5 4/20 21.17 ± 3.7 277.5 ± 54 76 ± 27 113 ± 17 144 ± 64 172 ± 43 5/24 13–35 3/24 (12.5%) 13/20 (65%) 0/24 1/24
203
was added and the mixture was sonicated in ice for 45 min in a Branson Sonifier 250 (Branson, U.S.A.). Three milligrams of HDL3 apolipoproteins were added and the mixture was sonicated for further 15 min. The rHDL particles of the appropriate size were isolated by FPLC using two Superose 6 columns (GE Healthcare Life Sciences, U.S.A.) as described in ref. [14]. The fluorescence of rHDL was detected in Shimadzu RXL10 (Shimadzu, Tokyo, Japan) spectrofluorimeter. rHDL (9000 fluorescence units) were incubated with 10 l of proband plasma, 50 g of normal LDL in 500 l of Tris-EDTA buffer pH 7.4. Samples were incubated for 16 h at 37 ◦ C; a parallel incubation was also performed at 4 ◦ C to measure the non-enzymatic fluorescent CE transfer between lipoproteins. After incubation samples were subjected to Superose 6 gel filtration chromatography; 0.5 ml fractions were collected and the fluorescence was measured by spectrofluorimetry. The fluorescence areas in the HDL and LDL peak were analysed by gaussian fitting using the SAAM II software (RFKA, Seattle, U.S.A.) and expressed as arbitrary fluorescence units (AFU) as percent of the total area. CE transfer rates (CETRs) were calculated as percent of LDL fluorescence area divided by total fluorescence area after incubation. CETR values were corrected by subtracting the percent LDL fluorescence area found in samples incubated at 4 ◦ C. Plasma CETP concentration was measured by ELISA as previously described [15]. 2.4. HDL size HDL particle size distribution was analyzed by nondenaturing PAGE using precast 4–30% slab gels (Pharmacia Biotec) [14] Aliquots of the d < 1.21 g/ml plasma fraction which had been isolated by ultracentrifugation at 100,000 rpm for 3 h at 4 ◦ C in a Beckman TL 100.3 rotor, were applied to the gels. The gels were scanned by an LKB Ultroscan XL laser densitometer (Pharmacia Biotech) and particle sizes calculated with the LKB 2400 Gelscan XL software, with the use of thyroglobulin, apoferritin, lactate dehydrogenase, and bovine serum albumin as calibration proteins. Five HDL subpopulations were identified and classified according to the criteria proposed by Verdery et al. [16] as follows: HDL2b , 9.7–2.9 nm; HDL2a , 8.8–9.7 nm; HDL3a , 8.2–8.8 nm; HDL3b , 7.8–8.2 nm, and HDL3c , 7.2–7.8 nm. To calculate the percentage distribution of HDL subpopulations, areas under the scanning curves were integrated by dropping vertical lines corresponding to the subpopulation size limits; the total integrated area in the 7.2–12.9 nm size-interval was considered to be 100% [16]. 2.5. Construction of CETP minigenes and their expression in transfected cells To investigate the effect of a splice site mutation in intron 15 (c.1407 + 2T > C, IVS15 + 2C > T) identified in subject HPLA-650 (see below) we adopted an in vitro strategy. This procedure included, as a first step, the construction of wild-type and mutant CETP minigenes by the amplification of the appropriate CETP gene region (encompassing the splice site harbouring the mutation) from the proband’s genomic DNA. The minigene (1476 bp) contained the 3 half of exon 14 (52 bp), intron 14, exon 15, intron 15, and the 5 half exon 16 (70 bp). The primer pairs used for amplification were: 5 AGCTTCCTGCAGTCAATGATCACC 3 (forward primer) and 5 TCAAGCTCTGGAGGAAATCCACC 3 (reverse primer); the amplification conditions were 30 cycles at 95 ◦ C for 1.5 min, 65 ◦ C for 1 min, 68 ◦ C for 1.30 min, and 68 ◦ C for 10 min. The minigenes were cloned in the pTargeTTM (Promega, Madison, WI, U.S.A.) expression
204
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
vector and then transfected into COS-1 cells as previously described [17].
changes at CETP level are described according to NCBI reference sequence (NP 000069.2).
2.6. Expression of CETP minigenes in transfected cells
3. Results
COS-1 cells maintained in the DMEM containing 5% FBS were used for transfection. Cells (1 × 106 ) were plated in 60 mm dishes. After 24 h 8 g of plasmids containing either wild-type or mutant minigene was transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, U.S.A.). Forty two hours after transfection total RNA was extracted with Eurozol (Euroclone, Paigton, Devon, UK) and treated with RNase-free DNase (Promega, Madison, WI, U.S.A.). RT-PCR amplification of CETP minigene mRNAs was performed using primers and conditions reported above. The RT-PCR products were separated by electrophoresis in 2% agarose gel and sequenced as described above using appropriate primers. To provide an internal control for transfection efficiency, the mRNA of Neomycin resistance gene (present in the vector) was reverse transcribed and PCR amplified using appropriate primers [17].
3.1. Analysis of CETP gene
2.7. Mutation nomenclature All mutations are described according to mutation nomenclature [18,19] (http://www.hgvs.org/munomen/). Nucleotide numbers are derived from cDNA CETP sequence (GenBank accession number NT 000078). For cDNA numbering +1 corresponds to the A of the ATG translation initiation codon. Amino acid sequence
The CETP gene was analysed in the 24 subjects with HALP. Four unrelated subjects (designated HALP-650, HALP-714, HALP-1042 and HALP-1767, respectively) were found to carry CETP gene mutations. Proband HALP-650 was found to be heterozygous for a T > C substitution in the donor splice site of intron 15 (c.1407 + 2T > C) of CETP gene. This mutation is predicted to abolish the function of the corresponding site (automated splice site analysis, https://splice.uwo.ca). To define its effect on CETP pre-mRNA splicing we analysed the CETP transcript in COS-1 cells expressing a minigene harbouring the mutation. This analysis showed that c.1407 + 2T > C mutation caused the formation of an abnormal mRNA devoid of exon 15 predicted to encode a truncated CETP protein of 435 amino acids (Fig. 1). Two apparently unrelated subjects (HALP-714 and HALP-1042), both coming from Sicily, were found to be heterozygous for a single nucleotide substitution in exon 6 (c.544C > T) resulting in the conversion of glutamine codon at position 165 into a premature stop codon (Q165X). The sister of proband HALP-714 (designated HALP1765) was found to carry the Q165X mutation, however her plasma HDL-C level was within the normal range (54 mg/dl) (Table 2).
Fig. 1. Analysis of transcription product of mutant CETP minigene harbouring the c.1407 + 2T > C mutation in intron 15. RNA isolated from COS-1 cells transfected with wild-type and mutant CETP minigene, respectively, was reverse transcribed and the cDNA region spanning from the 3 half of exon 14 to the 5 half of exon 16, was amplified by PCR. Panel A: untrasfected cells (lanes 1–3); DNA size marker (lanes 4 and 9); CETP cDNA in cells transfected with wild-type (lane 5) and mutant minigene (lane 6); PCR-amplification of wild-type (lane 7) and mutant minigenes obtained from genomic DNA (lane 8); cDNA of neomycin resistance gene in cells transfected with wild-type (lane 10) and mutant minigene (lane 11); “mock” RT-PCR in cells transfected with wild-type (lane 12) and mutant minigene (lane 13). Panel B: partial nucleotide sequence of the cDNA generated by the mutant CETP minigene harbouring the c.1407 + 2T > C mutation in intron 15. The upper panel shows the junction between exons 14–15 and exons 15–16 in the cDNA generated by wild-type minigene. The lower panel shows that in mutant cDNA exon 14 joins to exon 16. This junction causes a frame shift leading to a premature stop codon (the novel amino acids are shown in italics).
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
205
Table 2 Plasma lipids and lipoproteins in HALP subjects with CETP mutations Subject ID
Age (year)
Gender
Total cholesterol
Triglycerides
HDL-C
LDL-C
Apo A-I
Apo B
HALP-650 HALP- 714 HALP-1765 HALP-1042 HALP-1199 HALP-1201 HALP-1202 HALP-1767 All carriers n. 8 HALP without CETP mutations n. 20
60 59 60 33 65 60 62 56 57 ± 9* 49 ± 16*
F F F F F F F F
278 251 226 301 285 193 247 300 260 ± 35* 277 ± 57*
122 76 186 38 127 85 95 69 100 ± 42* 77 ± 28*
162 91 54 159 75 60 63 96 95 ± 40* 111 ± 12*
92 145 135 134 185 116 165 191 145 ± 31* 143 ± 67*
210 207 137 140 185 132 135 251 175 ± 42* 183 ± 53*
76 103 101 39 107 51 67 109 82 ± 25* 81 ± 15*
Total cholesterol, triglycerides, HDL-C, LDL-C, Apo A-I and Apo B are expressed in mg/dl. * Mean ± standard deviation.
Members of probands’ families were not willing to participate in clinical and laboratory testing with the exception of: (i) two siblings of proband HALP-714 and (ii) four relatives of proband HALP-1042 (three aunts and one second cousin). These family members gave their consent only for biochemical and for DNA testing. Three (HALP-1199, HALP-1201 and HALP-1202) out of the four relatives of HALP-1042 and one sister of HALP-714 (HALP-1765) were found to carry the CETP mutation (Table 2). Proband HALP-1767 was found to be heterozygous for a C > T transition in exon 9 (c.802C > T) resulting in the conversion of arginine codon into a stop codon (R268X). 3.2. Clinical and biochemical features of CETP gene mutation carriers Probands HALP-714 and HALP-1042 were free of clinical sign and/or symptoms of cardiovascular disease. In proband HALP-650 supra-aortic duplex scanning disclosed fibrous plaques determining a mild stenosis (30% at right and 20% at left internal carotid artery). Subject HALP-1767 had a positive family history for coronary heart disease but had no clinical manifestations related to cardiovascular disease nor ultrasonographic signs of carotid atherosclerosis. Table 2 shows the plasma lipid and apolipoprotein levels of CETP mutation carriers and of the 20 HALP subjects without CETP mutations. 3.3. CETP activity and plasma HDL Table 3 shows the CETP mass and activity in CETP mutation carriers. The CETP mass was close to or below the lower limit of the normal range. Fig. 2 shows the CETR activity expressed as percent of the average of two control subjects. CETR activity was slightly reduced in
Fig. 2. CETP-mediated transfer of fluorescent cholesteryl ester between reconstituted HDL and human plasma LDL in four CETP mutation carriers and in two unaffected normal controls. Cholesterol ester transfer rates (CETR) are calculated as percent of fluorescence detected in the LDL peak area after 16 h of incubation with fresh plasma. CETR activities, adjusted by subtracting the LDL fluorescence detected at 4 ◦ C, are expressed as percent of the average CETR activity of two normal control samples assayed in duplicate. Standard deviations are shown.
the 20 HALP subjects without CETP mutations (71 ± 12% of the control value as shown in Table 3). All CETP mutation carriers showed reduced CETR activity, with a broad variability (between 31% and 67% of the control value) (Table 3). In four CETP mutation carriers we measured the HDL size. The size of HDL-2 and HDL-3 was within the normal range in all probands, but HDL subclass distribution was characterized by an increased percentage of the large HDL fraction, which was particularly evident in subject HALP-1042 (Supplementary Table 1). The HDL distribution was also analysed in subject HALP-1765, a carrier of Q165X mutation who had normal levels of plasma HDLC. In this subject, however, HDL-2 distribution was comparable to that of the other CETP mutation carriers.
Table 3 CETP activity and CETP mass in HALP subjects with and without CETP mutations Subject ID
Mutation
Status
CETP activity (% CE transfer)
CETP mass (g/mL)*
HALP-650 HALP-714 HALP-1042 HALP-1765 HALP-1767 HALP-1199 HALP-1201 HALP-1202 HALP without CETP mutations n. 20
IVS15 + 2T/C Q165X Q165X Q165X R268X Q165X Q165X Q165X
Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote Heterozygote
38 51 31 67 NA 58 64 65 71 ± 12◦
0.88 0.89 1.16 1.21 NA 1.14 1.20 1.29 1.52 ± 0.29◦
*
Reference values (0.8–2.2 ug/mL); ◦ Mean ± standard deviation; NA: not available.
206
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
4. Discussion In the present study we analysed the CETP gene in 24 Italian subjects with primary hyperalphalipoproteinemia and identified four carriers of CETP mutations predicted to result in truncated inactive proteins. In one proband we identified a novel mutation (c.1407 + 2T > C) involving the donor splice site of intron 15 (IVS15 + 2T > C) and demonstrated its pathogenic effect on CETP pre-mRNA splicing in vitro. We show that this mutation causes the formation of an abnormal mRNA devoid of exon 15 predicted to encode a truncated CETP protein of 435 amino acids as opposed to the 476 amino acid of the wild type protein. This truncated protein may be synthesized in small amounts, in view of the rapid degradation of the corresponding mRNA carrying a premature stop codon (nonsense mediated mRNA decay) and/or may not be secreted due its retention in the endoplasmic reticulum followed by rapid degradation. A truncated CETP protein of similar size (402 amino acids), resulting from another splice site mutation (IVS14 + 1G > A), was found to be rapidly degraded intracellularly in the transfected COS-1 cells [3]. If secreted into the plasma the truncated 435 amino acid protein might have a reduced capacity to bind cholesteryl esters. The functional role of the C-terminal end of CETP is demonstrated by three observations: (i) the monoclonal antibody mAB TP2 that recognizes an epitope in the carboxyl-terminus of CETP is able to neutralize CETP activity [20]; (ii) mutagenesis of the carboxyl-terminal region abolishes CETP activity [21]; (iii) the crystal structure of CETP has revealed that one CETP molecule is capable of binding two CE molecules at the N- and C-terminal domains, respectively [22]. Therefore the deletion of 41 amino acids in the C-terminal domain could drastically impair the CE binding capacity of mutant CETP protein. In two apparently unrelated probands from Sicily we identified a nonsense mutations predicted to result in short truncated CETP proteins (Q165X) devoid of function. This mutation was recently reported in a compound heterozygote from Greece with complete CETP deficiency [11]. Since the island of Sicily has had prolonged contacts with Greece over the centuries one might speculate about a common origin of this mutation in the Mediterranean area. The Q165X mutation was found in two kindred with a different HALP phenotype. Although the two probands (HALP-714 and HALP-1042) showed a lipoprotein phenotype consistent with HALP (HDL-C > 80 mg/dl), they differ in term of the HDL-C levels. Proband HALP-1042 had a marked HDL-C elevation (HDL-C = 159 mg/dl) while proband HALP-714 and her sister (HALP-1765) had much lower HDL-C levels (91 and 54 mg/dl, respectively). This different expression of HALP phenotype was associated with a broad variability of CETP activity measured by a FPLC-based assay; the lowest CETP activity (31% of normal) was observed in proband HALP-1042 which showed the highest plasma HDL-C levels (159 mg/dl) while the highest activity was observed in the proband HALP-714 and her sister (HALP-1765) who had the lowest HDL-C level. Though CETP mass is generally reduced in all CETP gene mutations carriers, CETP activity is not decreased to the same extent in all of them. A possible explanation of this discrepancy could be a different CE transfer rate from LDL towards HDLs in HALP subjects, a condition that may affect the net CE transfer rate towards LDL. The variable CETP activity/mass in heterozygous carriers of null CETP allele (as in the case of the subjects reported in this study) has been a common observation in large studies, which showed that the CETP activity in heterozygotes for CETP gene mutations was 56–68% of controls [2]. This suggests that there might be an over-expression of the wild type allele or a reduced catabolism of the wild type protein, as a compensatory mechanism for the lack of expression of the mutant allele. In subjects homozygotes
for null alleles (e.g. homozygotes for IVS14 + 1G > A) the complete deficiency of CETP activity/mass has been associated with a 2–5 fold increase of HDL-C relative to controls [2]. In heterozygotes for these mutations the impact of partial CETP deficiency on HDL levels is much less dramatic (25–80%) increase as compared to control subjects) [2]. Genetic CETP deficiency is the most important and common cause of HALP in the Japanese population [2,3]. Twelve mutations of the CETP gene have been demonstrated to be the cause of HALP, in this population, including two common mutations: a splicing defect (IVS14 + 1G > A) [2,3] and a missense mutation (D442G), respectively [2]. In homozygous form the IVS14 + 1G > A mutation causes a complete CETP deficiency and a marked elevation of plasma HDL-C and apoA-I. Homozygosity for the D442G mutation causes a partial CETP deficiency and a less pronounced increase of HDL-C and apoA-I. CETP deficiency due to mutations in CETP gene are thought to be rare among Caucasians. However in our survey of 24 subjects attending the lipid clinic with the clinical diagnosis of hypercholesterolemia and found to have elevated plasma HDL-C, we identified four subjects heterozygous for CETP null allele. In view of this observation we are tempted to suggest that in the Italian population CETP gene mutations might be more frequent than presently believed. Population screening for the mutations reported in this study are now in progress. The assessment of the clinical phenotype in subjects with hyperalphalipoproteinemia with and without CETP deficiency is a relevant point specifically with regard to cardiovascular disease. We cannot draw any conclusion on this aspect since the clinical data of our HALP subjects are preliminary and further long term prospective studies are needed. Acknowledgements University of Palermo, Italy; Contract grant number: “60%” to Averna MR. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.atherosclerosis.2008.08.031. References [1] Tall AR, Breslow JL, Rubin EM. Genetic disorders affecting plasma high-density lipoproteins. In: Scriver CR, Beaudet AL, Valle D, Sly WS, editors. The metabolic and molecular bases of inherited disease, vol. II, 8th ed. New York: McGraw Hill; 2001. p. 2915–36. [2] Maruyama T, Sakai N, Ishigami M, et al. Prevalence and phenotypic spectrum of cholesteryl ester transfer protein gene mutations in Japanese hyperalphalipoproteinemia. Atherosclerosis 2003;166:177–85. [3] Nagano M, Yamashita S, Hirano K, et al. Molecular mechanisms of cholesteryl ester transfer protein deficiency in Japanese. J Atheroscler Thromb 2004;11:110–21. [4] von Eckardstein A, Holz H, Sandkamp M, Weng W, Funke H, Assmann G. Apolipoprotein C-III(Lys58–Glu). Identification of an apolipoprotein C-III variant in a family with hyperalphalipoproteinemia. J Clin Invest 1991;87:1724–31. [5] Canizales-Quinteros S, Aguilar-Salinas CA, Reyes-Rodríguez E, et al. Locus on chromosome 6p linked to elevated HDL cholesterol serum levels and to protection against premature atherosclerosis in a kindred with familial hypercholesterolemia. Circ Res 2003;92:569–76. [6] Heijmans BT, Beekman M, Putter H, et al. Meta-analysis of four new genome scans for lipid parameters and analysis of positional candidates in positive linkage regions. Eur J Hum Genet 2005;13:1143–53. [7] Barter PJ. Hugh sinclair lecture: the regulation and remodelling of HDL by plasma factors. Atheroscler Suppl 2002;3:39–47. [8] de Grooth GJ, Klerkx AHEM, Stroes ESG, Stalenhoef AFH, Kastelein JJP, Kuivenhoven JA. A review of CETP and its relation to atherosclerosis. J Lipid Res 2004;45:1967–74. [9] Funke H, Wiebusch H, Fuer L, Muntoni S, Schulte H, Assmann G. Identification of mutations in the cholesteryl ester transfer protein in Europeans
A.B. Cefalù et al. / Atherosclerosis 204 (2009) 202–207
[10]
[11]
[12]
[13] [14]
[15]
with elevated high density lipoprotein cholesterol. Circulation 1994;90. I-241 [Abstract]. Teh EM, Dolphin PJ, Breckenridge WC, Tan M-H. Human Plasma CETP deficiency: identification of a novel mutation in exon 9 of the CETP gene in a Caucasian subject from North America. J Lipid Res 1998;39:442–56. Rhyne J, Ryan MJ, White C, Chimonas T, Miller M. The two novel CETP mutations Gln87X and Gln165X in a compound heterozygous state are associated with marked hyperalphalipoproteinemia and absence of significant coronary artery disease. J Mol Med 2006;84:647–50. van der Steeg WA, Hovingh GK, Klerkx AHEM, et al. Cholesteryl ester transfer protein and hyperalphalipoproteinemia in Caucasians. J Lipid Res 2007;48:674–82. Reaven E, Tsai L, Azhar S. Cholesterol uptake by the ‘selective’ pathway of ovarian granulosa cells: early intracellular events. J Lipid Res 1995;36:1602–17. Averna M, Marcovina SM, Noto D, Cole TG, Krul ES, Schonfeld G. Familial hypobetalipoproteinemia is not associated with low levels of lipoprotein(a). Arterioscler Thromb Vasc Biol 1995;15:2165–75. Murakami T, Michelagnoli S, Longhi R, et al. Triglycerides are major determinants of cholesterol esterification/transfer and HDL remodeling in human plasma. Arterioscler Thromb Vasc Biol 1995;15:1819–28.
207
[16] Verdery RB, Benham DF, Baldwin HL, Goldberg AP, Nichols AV. Measurement of normative HDL subfraction cholesterol levels by Gaussian summation analysis of gradient gels. J Lipid Res 1989;30:1085–95. [17] Di Leo E, Magnolo L, Lancellotti S, et al. Abnormal apolipoprotein B premRNA splicing in patients with familial hypobetalipoproteinaemia. J Med Genet 2007;44:219–24. [18] den Dunnen JT, Antonarakis SE. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 2000;15:7–12. [19] den Dunnen JT, Paalman MH. Standardizing mutation nomenclature: why bother? Hum Mutat 2003;22:181–2. [20] Roy P, MacKenzie R, Hirama T, et al. Structure-function relationships of human cholesteryl ester transfer protein: analysis using monoclonal antibodies. J Lipid Res 1996;37:22–34. [21] Wang S, Wang X, Deng L, Rassart E, Milne RW, Tall AR. Point mutagenesis of carboxyl-terminal amino acids of cholesteryl ester transfer protein. Opposite faces of an amphipathic helix important for cholesteryl ester transfer or for binding neutralizing antibody. J Biol Chem 1993;268:1955–9. [22] Qiu X, Mistry A, Ammirati MJ, et al. Crystal structure of cholesteryl ester transfer protein reveals a long tunnel and four bound lipid molecules. Nat Struct Mol Biol 2007;14:106–13.