- Email: [email protected]
Novel Nonsynonymous Polymorphisms of the CYP1A1 Gene in Japanese
Drug Metab. Pharmacokin. 18 (3): SNP20 (218)–SNP23 (221) (2003).
SNP Communication Novel Nonsynonymous Polymorphisms of the CYP1A1 Gene in Japanese Tetsuya SAITO 1, Mari EGASHIRA1, Kazuma KIYOTANI 1, Masaki FUJIEDA1, Hiroshi YAMAZAKI 1, Chikako KIYOHARA2, Hideo KUNITOH 3 and Tetsuya KAMATAKI 1 1Laboratory
of Drug Metabolism, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo, Japan 2Department of Preventive Medicine, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan 3National Cancer Center Hospital, Tokyo, Japan
Summary: We found ˆve novel nonsynonymous polymorphisms of the human CYP1A1 gene from Japanese individuals. The ˆve single nucleotide polymorphisms (SNP) in exon 7 (2346ä2347 ins T, 2414TÀA, 2461CÀT, 2500CÀT and 2546CÀG causing premature stop codon, Ile 448Asn, Arg 464Cys, and Arg 477Trp and Pro 492Arg, respectively) were as follows: SNP, 030212Saito001; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-GTCAACCCATCT– W TGAGTTCCTACCT-3?. SNP, 030212Saito002; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-GTGAGAAGGTGAT W ATATCTTTGGCAT-3?. SNP, 030212Saito003; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-GAGACCGTTGCCC W TGCTGGGAGGTCT-3?. SNP, 030212Saito004; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-ATCCTGCTGCAAC W TGGGTGGAATTCA-3?. SNP, 030212Saito005; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-TGGACATGACCCC W GCATCTATGGGCT-3?.
Key words: P450 1A1; genetic polymorphism; aryl hydrocarbon hydroxylase Introduction Human cytochrome P450 1A1 (CYP1A1) is an aryl hydrocarbon hydroxylase (AHH) responsible for the bioactivation of various carcinogens such as benzo[a]pyrene.1) Genetically controlled interindividual variation of AHH activity and its inducibility has been reported in wide ethnic groups.2–4) To date, six nonsynonymous polymorphisms of the CYP1A1 gene have been reported: CYP1A1*2 (Ile 462Val), CYP1A1*4 (Thr 461Asn), CYP1A1*5 (Arg 464Ser), CYP1A1*6 (Met 331Ile), CYP1A1 variant (Gly 45Asp) and CYP1A1 variant (Ile 286Thr) (see http://www.imm.ki.se W On February 12, 2003, the polymorphisms did not appear in the ``Human Cytochrome P450 (CYP) Allele Nomenclature Committee database (http://www.imm.ki.se W CYPalleles W )'', the ``JSNPs data)'' and the ``SNP500CANCER base (http://snp.ims.u-tokyo.ac.jp W database (http://snp500cancer.nci.nih.gov W home.cfm)''.
CYPalleles W , http://snp.ims.u-tokyo.ac.jp W and http://snp500cancer.nci.nih.gov W home.cfm). In this study, we identiˆed ˆve novel nonsynonymous polymorphisms of the CYP1A1 gene in Japanese. The polymorphisms were 2346ä2347 ins T, 2414TÀA, 2461CÀT, 2500CÀT and 2546CÀG causing premature stop codon, Ile 448Asn, Arg 464Cys, and Arg 477Trp and Pro 492Arg, respectively. Materials and Methods Detailed information on the subjects was described previously.4,5) Informed consent was obtained from every volunteer. This study was approved by the ethics committee of Hokkaido University. The sequence of the human CYP1A1 gene described in the GenBank (accession number X02612) was used as a reference. The A of ATG start codon was deˆned as ＋1. The primers used for the speciˆc ampliˆcation and the direct sequencing of all seven exons and exon-intron junctions of the
Received; April 9, 2003, Accepted; May 13, 2003 To whom all correspondence should be addressed : Dr. Tetsuya SAITO, Laboratory of Drug Metabolism, Graduate School of Pharmaceutical Sciences, Hokkaido University, N12W6, Kita-ku, Sapporo, Hokkaido 060-0812, Japan. Tel. & Fax. ＋81-11-706-3235, E-mail: tetsu＠ pharm.hokudai.ac.jp SNP20 (218)
SNP21 (219)
Coding Variants of CYP1A1 Table 1. Primers 1A1 1A1 1A1 1A1 1A1 1A1 1A1 1A1 1A1 1A1
462
I V-S I 462V-A ex1-S ex1-A ex2-S ex2-A ex3-S ex6-A ex7-S ex7-A
Primers used for the speciˆc ampliˆcation and direct sequencing analysis of the human CYP1A1 gene Primer sequence (5?-3? orientation)
Location
GCTGCTTGCCTGTCCTCTAT AGGCATGC T T CA TGGT TAGC CCGAGT CC TGGTAGGC TGTA CC TGCAG T TGGCAAT C TGT C CCCACAG TGGTAGT T CAACA CCC TGCCAAGGAAGAAGAC T AGAGCC T TGCAGAGGCAGAG GGCAATGGT C T CACCGATAC AGC TATGGGT CAACCCAT C T T C T T C T T CC T CCC TACAGTA
intron 6 exon 7 5?-‰anking intron 1 intron 1 intron 2 intron 2 exon 7 exon 7 intron 7
Ampliˆed exon exon 7 exon 1 exon 2 exons 3–7 exon 7
Fig. 1. The nucleotide sequences of the human CYP1A1 gene at exon 7 containing 2546CÀG polymorphism (Pro 492Arg). The sequences are shown for sense strands. Arrows indicate the variant nucleotide positions.
human CYP1A1 gene are shown in Table 1. PCR for each region of the CYP1A1 gene was conducted in a 25 mL reaction mixture containing 100 ng of genomic DNA, KOD-plus-buŠer, 1.0 mM MgSO4, 5.0z DMSO, 0.2 mM dNTPs, 5.0 pmol of each primer and 1.0 U KOD-plus-DNA polymerase. PCR conditions consisted C for 2 min, followed of an initial denaturation at 949 C for 15 s, annealing by 35 cycles of denaturation at 949 at 609C for 30 s and extension at 689C for 2 min except for Ile 462Val genotyping primer (I 462V-S and I 462V-A, 689 C for 1 min). Sequences were determined using ABI PRISM 3100 genetic analyzer (Applied Biosystems). Results and Discussion During the course of genotyping for a known Ile 462Val polymorphism of the human CYP1A1 gene in 261 Japanese individuals, we found a novel nonsynonymous SNP as follows: SNP, 030212Saito005; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?GCATCTATGGGCT-3?. TGGACATGACCCC W The SNP was 2546CÀG in exon 7 resulting in an amino acid change of Pro 492Arg (Fig. 1). Four out of 261 individuals were heterozygous for the SNP, suggesting that the allele frequency was 0.8z in Japanese. Direct sequencing of the entire exons and exon-intron
boundaries of the CYP1A1 gene from the four subjects revealed no genetic linkage of the SNP with known CYP1A1 polymorphisms including Msp I polymorphism. Then, the SNP was registered as a new CYP1A1 allele, CYP1A1*11. Additionally, we identiˆed four nonsynonymous variants of the CYP1A1 gene, although only one heterozygote was found for each variant. Identiˆed variants were 2346ä2347 ins T, 2414TÀA, 2461CÀT and 2500CÀT causing premature stop codon, Ile 448Asn, Arg 464Cys and Arg 477Trp, respectively (Fig. 2). The allele names of these variants were CYP1A1*7, CYP1A1*8, CYP1A1*9 and CYP1A1*10, respectively. These four variants in addition to 2346ä2347 ins T generating premature stop codon, like a known Ile 462Val, are closely located in the heme-binding region. Thus, these amino acid substitutions are expected to alter the catalytic activity of CYP1A1.6) Acknowledgements: This work was supported in part by a Grant-in-Aid (No. 99-2) from the Organization for Pharmaceutical Safety and Research (OPSR) and Ministry of Education, Science, Sports and Culture of Japan. This work was also supported in part by a Grantin-Aid for Cancer Research from the Ministry of Health, Labor and Welfare of Japan, a Grant-in-Aid
SNP22 (220)
Tetsuya SAITO, et al.
Fig. 2. The nucleotide sequences of the human CYP1A1 gene at exon 7 containing the variants found in only one subject. The sequences are shown for sense strands. Arrows indicate the variant nucleotide positions.
Coding Variants of CYP1A1
from the Core Research for Evolutional Science and Technology, and an SRF Grant for Biomedical Research in Japan.
4)
References 1)
2)
3)
Shimada, T., Yun, C. H., Yamazaki, H., Gautier, J. C., Beaune, P. H. and Guengerich, F. P.: Characterization of human lung microsomal cytochrome P-450 1A1 and its role in the oxidation of chemical carcinogens. Mol. Pharmacol., 41: 856–864 (1992). Kellermann, G., Shaw, C. R. and Luyten-Kellermann, M.: Aryl hydrocarbon hydroxylase inducibility and bronchogenic carcinoma. N. Engl. J. Med., 289: 934–937 (1973). Catteau, A., Douriez, E., Beaune, P., Poisson, N., Bonaiti-Pelli áe, C. and Laurent, P.: Genetic polymorphism of induction of CYP1A1 (EROD) activity. Phar-
5)
6)
SNP23 (221)
macogenetics, 5: 110–119 (1995). Kiyohara, C., Hirohata, T. and Inutsuka, S.: The relationship between aryl hydrocarbon hydroxylase and polymorphisms of the CYP1A1 gene. Jpn. J. Cancer Res., 87: 18–24 (1996). Ariyoshi, N., Miyamoto, M., Umetsu, U., Kunitoh, H., Dosaka-Akita, H., Sawamura, Y., Yokota, J., Nemoto, N., Sato, K. and Kamataki, T.: Genetic polymorphism of CYP2A6 gene and tobacco-induced lung cancer risk in male smokers. Cancer Epidemiol. Biomarkers Prev., 11: 890–894 (2002). Hayashi, S., Watanabe, J., Nakachi, K. and Kawajiri, K.: Genetic linkage of lung cancer-associated Msp I polymorphisms with amino acid replacement in the heme binding region of the human Cytochrome P450 1A1 gene. J. Biochem. (Tokyo), 110: 407–411 (1991).
SNP Communication Novel Nonsynonymous Polymorphisms of the CYP1A1 Gene in Japanese Tetsuya SAITO 1, Mari EGASHIRA1, Kazuma KIYOTANI 1, Masaki FUJIEDA1, Hiroshi YAMAZAKI 1, Chikako KIYOHARA2, Hideo KUNITOH 3 and Tetsuya KAMATAKI 1 1Laboratory
of Drug Metabolism, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo, Japan 2Department of Preventive Medicine, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan 3National Cancer Center Hospital, Tokyo, Japan
Summary: We found ˆve novel nonsynonymous polymorphisms of the human CYP1A1 gene from Japanese individuals. The ˆve single nucleotide polymorphisms (SNP) in exon 7 (2346ä2347 ins T, 2414TÀA, 2461CÀT, 2500CÀT and 2546CÀG causing premature stop codon, Ile 448Asn, Arg 464Cys, and Arg 477Trp and Pro 492Arg, respectively) were as follows: SNP, 030212Saito001; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-GTCAACCCATCT– W TGAGTTCCTACCT-3?. SNP, 030212Saito002; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-GTGAGAAGGTGAT W ATATCTTTGGCAT-3?. SNP, 030212Saito003; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-GAGACCGTTGCCC W TGCTGGGAGGTCT-3?. SNP, 030212Saito004; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-ATCCTGCTGCAAC W TGGGTGGAATTCA-3?. SNP, 030212Saito005; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?-TGGACATGACCCC W GCATCTATGGGCT-3?.
Key words: P450 1A1; genetic polymorphism; aryl hydrocarbon hydroxylase Introduction Human cytochrome P450 1A1 (CYP1A1) is an aryl hydrocarbon hydroxylase (AHH) responsible for the bioactivation of various carcinogens such as benzo[a]pyrene.1) Genetically controlled interindividual variation of AHH activity and its inducibility has been reported in wide ethnic groups.2–4) To date, six nonsynonymous polymorphisms of the CYP1A1 gene have been reported: CYP1A1*2 (Ile 462Val), CYP1A1*4 (Thr 461Asn), CYP1A1*5 (Arg 464Ser), CYP1A1*6 (Met 331Ile), CYP1A1 variant (Gly 45Asp) and CYP1A1 variant (Ile 286Thr) (see http://www.imm.ki.se W On February 12, 2003, the polymorphisms did not appear in the ``Human Cytochrome P450 (CYP) Allele Nomenclature Committee database (http://www.imm.ki.se W CYPalleles W )'', the ``JSNPs data)'' and the ``SNP500CANCER base (http://snp.ims.u-tokyo.ac.jp W database (http://snp500cancer.nci.nih.gov W home.cfm)''.
CYPalleles W , http://snp.ims.u-tokyo.ac.jp W and http://snp500cancer.nci.nih.gov W home.cfm). In this study, we identiˆed ˆve novel nonsynonymous polymorphisms of the CYP1A1 gene in Japanese. The polymorphisms were 2346ä2347 ins T, 2414TÀA, 2461CÀT, 2500CÀT and 2546CÀG causing premature stop codon, Ile 448Asn, Arg 464Cys, and Arg 477Trp and Pro 492Arg, respectively. Materials and Methods Detailed information on the subjects was described previously.4,5) Informed consent was obtained from every volunteer. This study was approved by the ethics committee of Hokkaido University. The sequence of the human CYP1A1 gene described in the GenBank (accession number X02612) was used as a reference. The A of ATG start codon was deˆned as ＋1. The primers used for the speciˆc ampliˆcation and the direct sequencing of all seven exons and exon-intron junctions of the
Received; April 9, 2003, Accepted; May 13, 2003 To whom all correspondence should be addressed : Dr. Tetsuya SAITO, Laboratory of Drug Metabolism, Graduate School of Pharmaceutical Sciences, Hokkaido University, N12W6, Kita-ku, Sapporo, Hokkaido 060-0812, Japan. Tel. & Fax. ＋81-11-706-3235, E-mail: tetsu＠ pharm.hokudai.ac.jp SNP20 (218)
SNP21 (219)
Coding Variants of CYP1A1 Table 1. Primers 1A1 1A1 1A1 1A1 1A1 1A1 1A1 1A1 1A1 1A1
462
I V-S I 462V-A ex1-S ex1-A ex2-S ex2-A ex3-S ex6-A ex7-S ex7-A
Primers used for the speciˆc ampliˆcation and direct sequencing analysis of the human CYP1A1 gene Primer sequence (5?-3? orientation)
Location
GCTGCTTGCCTGTCCTCTAT AGGCATGC T T CA TGGT TAGC CCGAGT CC TGGTAGGC TGTA CC TGCAG T TGGCAAT C TGT C CCCACAG TGGTAGT T CAACA CCC TGCCAAGGAAGAAGAC T AGAGCC T TGCAGAGGCAGAG GGCAATGGT C T CACCGATAC AGC TATGGGT CAACCCAT C T T C T T C T T CC T CCC TACAGTA
intron 6 exon 7 5?-‰anking intron 1 intron 1 intron 2 intron 2 exon 7 exon 7 intron 7
Ampliˆed exon exon 7 exon 1 exon 2 exons 3–7 exon 7
Fig. 1. The nucleotide sequences of the human CYP1A1 gene at exon 7 containing 2546CÀG polymorphism (Pro 492Arg). The sequences are shown for sense strands. Arrows indicate the variant nucleotide positions.
human CYP1A1 gene are shown in Table 1. PCR for each region of the CYP1A1 gene was conducted in a 25 mL reaction mixture containing 100 ng of genomic DNA, KOD-plus-buŠer, 1.0 mM MgSO4, 5.0z DMSO, 0.2 mM dNTPs, 5.0 pmol of each primer and 1.0 U KOD-plus-DNA polymerase. PCR conditions consisted C for 2 min, followed of an initial denaturation at 949 C for 15 s, annealing by 35 cycles of denaturation at 949 at 609C for 30 s and extension at 689C for 2 min except for Ile 462Val genotyping primer (I 462V-S and I 462V-A, 689 C for 1 min). Sequences were determined using ABI PRISM 3100 genetic analyzer (Applied Biosystems). Results and Discussion During the course of genotyping for a known Ile 462Val polymorphism of the human CYP1A1 gene in 261 Japanese individuals, we found a novel nonsynonymous SNP as follows: SNP, 030212Saito005; GENE NAME, CYP1A1 ; ACCESSION NUMBER, X02612; LENGTH, 25 base; 5?GCATCTATGGGCT-3?. TGGACATGACCCC W The SNP was 2546CÀG in exon 7 resulting in an amino acid change of Pro 492Arg (Fig. 1). Four out of 261 individuals were heterozygous for the SNP, suggesting that the allele frequency was 0.8z in Japanese. Direct sequencing of the entire exons and exon-intron
boundaries of the CYP1A1 gene from the four subjects revealed no genetic linkage of the SNP with known CYP1A1 polymorphisms including Msp I polymorphism. Then, the SNP was registered as a new CYP1A1 allele, CYP1A1*11. Additionally, we identiˆed four nonsynonymous variants of the CYP1A1 gene, although only one heterozygote was found for each variant. Identiˆed variants were 2346ä2347 ins T, 2414TÀA, 2461CÀT and 2500CÀT causing premature stop codon, Ile 448Asn, Arg 464Cys and Arg 477Trp, respectively (Fig. 2). The allele names of these variants were CYP1A1*7, CYP1A1*8, CYP1A1*9 and CYP1A1*10, respectively. These four variants in addition to 2346ä2347 ins T generating premature stop codon, like a known Ile 462Val, are closely located in the heme-binding region. Thus, these amino acid substitutions are expected to alter the catalytic activity of CYP1A1.6) Acknowledgements: This work was supported in part by a Grant-in-Aid (No. 99-2) from the Organization for Pharmaceutical Safety and Research (OPSR) and Ministry of Education, Science, Sports and Culture of Japan. This work was also supported in part by a Grantin-Aid for Cancer Research from the Ministry of Health, Labor and Welfare of Japan, a Grant-in-Aid
SNP22 (220)
Tetsuya SAITO, et al.
Fig. 2. The nucleotide sequences of the human CYP1A1 gene at exon 7 containing the variants found in only one subject. The sequences are shown for sense strands. Arrows indicate the variant nucleotide positions.
Coding Variants of CYP1A1
from the Core Research for Evolutional Science and Technology, and an SRF Grant for Biomedical Research in Japan.
4)
References 1)
2)
3)
Shimada, T., Yun, C. H., Yamazaki, H., Gautier, J. C., Beaune, P. H. and Guengerich, F. P.: Characterization of human lung microsomal cytochrome P-450 1A1 and its role in the oxidation of chemical carcinogens. Mol. Pharmacol., 41: 856–864 (1992). Kellermann, G., Shaw, C. R. and Luyten-Kellermann, M.: Aryl hydrocarbon hydroxylase inducibility and bronchogenic carcinoma. N. Engl. J. Med., 289: 934–937 (1973). Catteau, A., Douriez, E., Beaune, P., Poisson, N., Bonaiti-Pelli áe, C. and Laurent, P.: Genetic polymorphism of induction of CYP1A1 (EROD) activity. Phar-
5)
6)
SNP23 (221)
macogenetics, 5: 110–119 (1995). Kiyohara, C., Hirohata, T. and Inutsuka, S.: The relationship between aryl hydrocarbon hydroxylase and polymorphisms of the CYP1A1 gene. Jpn. J. Cancer Res., 87: 18–24 (1996). Ariyoshi, N., Miyamoto, M., Umetsu, U., Kunitoh, H., Dosaka-Akita, H., Sawamura, Y., Yokota, J., Nemoto, N., Sato, K. and Kamataki, T.: Genetic polymorphism of CYP2A6 gene and tobacco-induced lung cancer risk in male smokers. Cancer Epidemiol. Biomarkers Prev., 11: 890–894 (2002). Hayashi, S., Watanabe, J., Nakachi, K. and Kawajiri, K.: Genetic linkage of lung cancer-associated Msp I polymorphisms with amino acid replacement in the heme binding region of the human Cytochrome P450 1A1 gene. J. Biochem. (Tokyo), 110: 407–411 (1991).