- Email: [email protected]
Novel peptide nucleic acid-based real-time PCR assay for detection and genotyping of Megalocytivirus
Aquaculture 518 (2020) 734818
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Short communication
Novel peptide nucleic acid-based real-time PCR assay for detection and genotyping of Megalocytivirus Eun Sun Lee, Miyoung Cho, Eun Young Min, Sung Hee Jung, Kwang Il Kim
T
⁎
Pathology Division, National Institute of Fisheries Science, Busan 46083, Republic of Korea
A R T I C LE I N FO
A B S T R A C T
Keywords: Megalocytivirus Red Sea bream iridoviral disease Peptide nucleic acid Genotyping
Megalocytivirus, the causative agent for Red Sea Bream Iridoviral Disease (RSIVD), is classified into three genotypes based on its phylogeny: Red Sea Bream Iridovirus (RSIV), Infectious Spleen and Kidney Necrosis Virus (ISKNV), and Turbot Reddish Body Iridovirus (TRBIV). To overcome drawbacks such as limitation of genotypic variant type discrimination and unexpected PCR reaction from an SYBR green-based genotyping method by high-resolution melting analysis, peptide nucleic acid (PNA)-based real-time PCR assay for detecting and genotyping Megalocytivirus was developed. Compared with DNA hybridization, PNA has more suitable hybridization traits that allowed the difference in melting temperature (Tm) even by a single nucleotide mismatch. Based on the consensus sequences of the viral major capsid protein gene, four PNA probes labeled with respective fluorescence at their 3′ ends were designed as reporter molecules. PNA-based real-time PCR assay allowed quantification of Megalocytivirus copies using a synthetic DNA as standard (detection limit of 103 copies) and discrimination of the genotypes based on Tm in a single-tube reaction. Furthermore, the results of this new method were consistent with those of sequencing analysis of Megalocytivirus-infected field and artificial samples, proving its accuracy and efficiency. The novel PNA-based real-time PCR assay could contribute to the detection as well as discrimination of the genotypes of Megalocytivirus in a single simple assay, and could be used as a highly robust diagnostic tool in the field of aquatic animal diseases.
1. Introduction Megalocytivirus belongs to the family Iridoviridae and is the causative agent of Red Sea Bream Iridoviral Disease (RSIVD), a major cause of mortality in Red Sea bream (Pagrus major) and other marine fish, according to the World Organization for Animal Health (Chinchar et al., 2017; OIE, 2018). Megalocytivirus is one of the most virulent viruses affecting > 30 marine and freshwater fish worldwide. Since the first outbreak of Red Sea Bream Iridovirus (RSIV) observed in Red Sea bream in Japan in 1990 (Inouye et al., 1992), it has rapidly been transmitted to Asian countries, resulting in endemic diseases (Jeong et al., 2003; Kawakami and Nakajima, 2002; He et al., 2000; Sudthongkong et al., 2002; Do et al., 2005). Infection with megalocytiviruses have also been reported from Central America (Lopez-Porras et al., 2018). In Korea, the first RSIVD case was reported in juvenile rock bream in 1998; however, the disease has spread to other marine fish such as Red Sea bream and sea bass (Lateolabrax japonicus) and is now endemic in Korea (Jung and Oh, 2000; Sohn et al., 2000; Jeong et al., 2003; Kim et al., 2019). Based on the major capsid protein (MCP) and adenosine triphosphatase, Megalocytivirus is classified into three genotypes: Red Sea
⁎
Bream Iridovirus (RSIV), Infectious Spleen and Kidney Necrosis Virus (ISKNV), and Turbot Reddish Body Iridovirus (TRBIV) (Kurita and Nakajima, 2012). Since it shows vast genetic diversities in several fish species, the accurate genotyping tool is necessary. Previous studies reported genotyping based on melting curve analysis of PCR amplicon that allowed discrimination of single nucleotide polymorphisms (SNPs) and evaluation of DNA methylation and microsatellites (Wittwer et al., 2003; White et al., 2007; Wojdacz and Dorbrovic, 2007; Mackay et al., 2008). Compared with the sequencing method, the melting curve analysis is simple and robust for differentiating genotypes. Previously, a genotyping method for Megalocytivirus by high-resolution melting analysis has been reported (Kim et al., 2014), however, this method shows some drawbacks such as discriminating limitations of variants and non-specific contamination during PCR amplification with primers and SYBR green dye at low copies. Peptide nucleic acid (PNA) has a favorable hybridization trait, along with chemical and thermal stability that is higher than that in DNA-DNA hybridization (Porcheddu and Giacomelli, 2005). In the present study, to supplement and overcome the weakness of SYBR green based-method, PNA-based real-time PCR assay for detecting and simultaneously discriminating Megalocytivirus
Corresponding author. E-mail address: [email protected] (K.I. Kim).
https://doi.org/10.1016/j.aquaculture.2019.734818 Received 28 August 2019; Received in revised form 1 December 2019; Accepted 3 December 2019 Available online 05 December 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Table 1 Primers and PNA probes used in this study for qPCR assay. qPCR assay
Primer name
Target
Sequence (5′ to 3′)
Final concentrations (nM)
PNA probe
Irido-F4 Irido-inner-R6 Irido-inner-F7 Irido-R5 RSIV-sub.1 probe RSIV-sub.2 probe ISKNV probe TRBIV probe qM1F qM1R
Megalocytivirus all genotypes
RSIV subtype 1
GGTGTCGGTGTCATTTAACG TACAACGAGGTGCGCATCC GTCTAGCCGTAGCATGCTC CTCATTTACGAGAACACCCC Dabcyl-CAATTACACTGCGGC-FAM
RSIV subtype 2 ISNKV-type TRBIV-type Megalocytivirus all genotypes
SYBR Green
Melting temperature (°C)
References GenBank No. (position)
50 500 50 500 500
68
AB104413 AB104413 AB104413 AB104413 AB104413
Dabcyl-ATGTCACTCACCGCA-HEX
500
65
AT532606 (905–919)
BHQ3-CAACGGCCAGACTAT-TxR BHQ3-GTTCAGTCATCCCGTCA-Cy5 GGCGACTACCTCATTAATGT CCACCAGGTCGTTAAATGA
500 500 500 500
77 71
AF371960 (480–494) GQ273492 (864–880) Jin et al. (2017)
(333–352) (577–595) (771–789) (1015–1034) (930–944)
Fig. 1. Megalocytivirus genotyping based on differences in melting temperature (Tm) and fluorescence signal of PNA probes. Fluorescence signals and perfectly matched Tm were generated for respective genotypes, (A) 68 °C for RSIV subtype 1 with FAM; (B) 65 °C for RSIV subtype 2 with HEX; (C) 77 °C for ISKNV-type with Texas-red; (D) 71 °C for TRBIV-type with Cy5. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
10 mL of 0.25% trypsin ethylenediaminetetraacetic acid solution (Gibco, USA) and incubated with shaking (450 rpm) at 25 °C for 30 min. Subsequently, the trypsinized cells were collected following filtration with cell strainer (100-μm pore size) and centrifugation at 1000 ×g for 10 min. Pelleted cells were suspended in L-15 medium (Gibco, USA) containing 20% FBS (performance plus glade; Gibco, USA) and 1× antibiotic-antimycotic solution, and 1 × 106 cells mL−1 were seeded into a 25-cm2 flask (Greiner Bio-one, Germany) and incubated at 25 °C. Primary cultured cells were maintained in L-15 medium containing 20% FBS (Gibco, USA) and 1× antibiotic-antimycotic solution and subcultured at a split ratio of 1:2 every 10–14 days.
genotypes was developed, and was evaluated the method. 2. Materials and methods 2.1. Primary cell culture Rock bream (Oplegnathus fasciatus) (4.5 ± 1.3 cm) that was confirmed to be free of megalocytiviruses by PCR was used for the primary culture. The fish body surface was wiped with 70% ethanol, and caudal fin tissue was cut aseptically from three fish and washed with phosphate saline buffer (PBS) containing 2× antibiotic-antimycotic solution (Gibco, USA). The tissues were transferred into a Petri dish (SPL, South Korea) with PBS and minced into small pieces (approximately 1 mm3), and then gently washed three times with PBS. Tissue fragments (300–500 mg) were then transferred into a new Petri dish containing
2.2. Virus culture In this study, megalocytiviruses obtained from the following 2
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Table 2 Genotyping and quantitative results using PNA probe in different diseased fish between 2012 and 2018. Isolate
RB2-YS SM1-SC SB1-TY RB3-JJ RB4-SC RB5-NH OF1-JH RS2-TY RB6-YS SB2-YS RB7-NH RB8-WD RB9-WD RB10-GH RB11-GH RB16-YS RB17-YS RB18-TY SB3-GH RB19-GJ SB4-GH TF1-GS SB5-TY RB20-SA RB21-NH SB6-NH RB22-SC SM2-HD RB23-TY RB24-GS RB25-GJ RB26-GJ SF1-PH RB27-YS RB28-YS GM2-SC a
Biological source
Oplegnathus fasciatus Planiliza haematocheila Latolabrax japonicus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Paralichthys olivaceus Pagrus major Oplegnathus fasciatus Latolabrax japonicus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Latolabrax japonicus Oplegnathus fasciatus Latolabrax japonicus Stephanolepis cirrhifer Latolabrax japonicus Oplegnathus fasciatus Oplegnathus fasciatus Latolabrax japonicus Oplegnathus fasciatus Planiliza haematocheila Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Platichthys stellatus Oplegnathus fasciatus Oplegnathus fasciatus Siniperca scherzeri
Year
2012 2013 2013 2013 2014 2014 2014 2014 2014 2015 2015 2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2018
Genotypea
Sampling site
Yeosu Sachun TongYeong Jeju Sachun Namhae Jangheung TongYeong Yeosu Yeosu Namhae Wando Wando Goheung Goheung Yeosu Yeosu TongYeong Goheung GeoJe Goheung Goseong TongYeong Shinan Namhae Namhae Sachun Hadong TongYeong Goseong GeoJe GeoJe Pohang Yeosu Yeosu Sancheong
RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 TRBIV RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.1 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2
Melt curve
RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 TRBIV RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.1 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2
Viral genome copies mg−1 tissue PNA probe
SYBR Green
5.59E+08 2.59E+05 3.72E+08 4.78E+08 5.47E+08 2.14E+09 7.32E+06 2.57E+07 4.05E+08 2.45E+08 3.24E+08 6.48E+07 6.23E+05 6.09E+07 8.18E+08 3.91E+09 3.52E+09 2.41E+08 2.26E+09 8.05E+08 3.78E+07 1.93E+03 1.55E+08 6.03E+08 5.99E+08 1.30E+05 7.52E+08 1.09E+08 1.31E+07 1.44E+07 4.42E+08 1.67E+08 2.59E+08 3.74E+08 7.81E+05 1.31E+08
5.32E+08 3.70E+05 4.20E+08 4.50E+08 5.50E+08 1.98E+09 7.02E+06 2.20E+07 3.50E+08 2.10E+08 2.15E+08 5.40E+07 3.23E+05 5.05E+07 6.89E+08 1.95E+09 3.24E+09 3.75E+08 1.05E+09 7.02E+08 5.89E+07 2.52E+03 2.72E+08 3.03E+08 2.58E+08 2.74E+05 5.23E+08 3.75E+08 2.43E+07 3.42E+07 5.23E+08 2.45E+08 4.78E+08 1.45E+08 5.15E+05 2.89E+08
Phylogenetic analysis of major capsid protein gene (Kim et al., 2019)
hexachlorofluorescein (HEX) for the RSIV subtype 2 probe, sulforhodamine 101 acid chloride (Texas-Red) for the ISKNV-type probe, and Cy 5 for the TRBIV-type probe. Furthermore, two different quenchers were labeled at the 5′ end, namely Dabcyl for the RSIV subtypes, and BHQ3 for the ISKNV and TRBIV-type probes.
primary cells were used: SB5-TY (RSIV subtype I) derived from sea bass and RB24-GS (RSIV subtype II) derived from rock bream (Kim et al., 2019), PGIV (ISKNV-type) derived from pearl gourami (Trichogaster leeri; see Jeong et al., 2008), and FLIV (TRBIV-type) derived from olive flounder (Paralichthys olivaceus; see Kim et al., 2014). Infections were induced in 25-cm2 culture flasks containing monolayers of primary cells at a multiplicity of infection (MOI) of 1. Megalocytiviruses were propagated at 25 °C in L-15 medium (Gibco, USA) supplemented with 5% fetal bovine serum and 1× antibioticantimycotic solution (Gibco, USA). Inoculated cells were incubated at 25 °C and monitored daily for 10 days. After the appearance of degenerative changes in fibroblast-like cells as the cytopathic effect (CPE), the supernatant was collected following centrifugation at 1500 ×g for 10 min and stored at −80 °C.
2.4. Quantitative and qualitative analysis For the quantitative analysis, a synthetic oligonucleotide was used as a standard DNA. A synthetic DNA was constructed with the green fluorescent protein (GFP) sequence (total 1362 bp) containing primers and PNA-probe sequences at each site described in Table 1. Standards (102 to 107 viral genome copies μL−1 of fragmented MCP gene) were generated by 10-fold dilution with 1× TE buffer (Fig. 3A). Real-time PCR was performed with a reagent mixture containing 1 μL DNA (50 ng), 50–500 nM of each primer and probe, and 2× probe premix (TNS, Korea) using CFX 96 Touch Real-time PCR detection system (BioRad, USA) according to the manufacturer's instructions. The real-time PCR was performed under the following conditions to amplify the fragmented MCP gene: denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 54 °C for 40 s and 76 °C for 50 s. Next, to hybridize to the PNA probe and obtain melting curves, fluorescence was measured under the following conditions: denaturation at 95 °C for 5 min, followed by holding at 75 °C for 1 min, 55 °C for 1 min and 45 °C for 1 min, followed by a temperature rise from 40 °C to 90 °C at a rate of 1 °C withholding for 5 s. Megalocytivirus genotypes were determined based on the fluorescence signal and melting temperature (Tm) values (Fig. 1). Specific genotypes were determined by the range of perfect
2.3. Primer and PNA probe design Primers for detecting Megalocytivirus [Irido-F4, Irido-inner-R6, Irido-inner-F7, and Irido-R5] were designed based on the MCP gene (Table 1). Probes for discriminating Megalocytivirus genotypes [RSIVsub.1 probe specific to the RSIV subtype 1 (Genbank accession no. AB104413), RSIV-sub.2 probe specific to the RSIV subtype 2 (Genbank accession no. AT532606), ISKNV probe specific to the ISKNV-type (Genbank accession no. AF371960), and TRBIV probe specific to the TRBIV-type (Genbank accession no. GQ273492)] were designed to be complementary to the parts of their respective specific sequences. Four different fluorophores were labeled at the 3′ ends as a reporter: 6-carboxyfluorescein (FAM) for the RSIV subtype 1 probe, 3
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Fig. 2. The sensitivity of the PNA-based real-time PCR assay. Melting points of synthetic DNA as standard were measured and showed different fluorescences based on Megalocytivirus genotypes. The detection limit of (A) RSIV subtype 1, (C) ISKNV-type, and (D) TRBIV-type appeared to be 102 copies, while that of (B) RSIVsubtype 2 was 103 copies of fragmented DNA.
each primer, and the universal SYBR Green supermix (Bio-Rad) using CFX 96 Touch Real-time PCR detection system (Bio-Rad, USA) according to the manufacturer's instructions. The real-time PCR was performed under the following conditions: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for the 30s. Next, to obtain melting curves, fluorescence was measured by temperature rise from 40 °C to 90 °C at a rate of 1 °C withholding for 5 s. Standards (102 to 107 viral genome copies μL−1) were generated using a recombinant plasmid containing the partial MCP gene (141 bp; Fig. 3C). Rock bream (6.7 ± 0.5 cm) confirmed to be free of Megalocytivirus by qPCR were acclimatized for 10 d at 25 °C in a 500-L tank. A total of 20 rock bream were intraperitoneally injected with 0.1 mL of cultured RB24-GS strain (RSIV subtype 2) at a concentration of 106 viral genome copies per fish. As a negative control, 0.1 mL of PBS was intraperitoneally injected into 20 rock breams. After the viral challenge, the fish were maintained at 26 °C for 15 d using an automatic cooling and heating system. The rearing water was changed continuously (5–6 L h−1) and effluent was discharged through an automatic ozone treatment system. Spleen tissues were cut aseptically from dead and survived fish, and genotyping and quantification of viral copies of MCP gene fragment were performed as described above. All experiments were performed with the permission of the Animal Ethics Committee of the National Institute of Fisheries Science (Permission No. 2019-NIFS-IACUC-20).
match Tm ± 2 °C. 2.5. Specificity and sensitivity test To evaluate the specificity of the real-time PCR assay, four different megalocytiviruses as detailed above, i.e., Viral hemorrhagic septicemia virus IVa genotype (VHSV) and Viral nervous necrosis virus RGNNV type (VNNV) described by Kim et al. (2016), Hirame rhadovirus (HIRRV; ATCC VR-1391), and lymphocytis disease virus (LCDV) were used. Nucleic acids were purified using a Patho Gene-Spin DNA/RNA Extraction kit (Intronbio). For the RNA viruses, cDNA synthesis was performed using the Iscript cDNA synthesis kit (Bio-rad, USA). The detection limit of the real-time PCR was determined using 10-fold serial dilutions of standard DNA (107–102 copies μL−1). 2.6. Application for field and artificial Megalocytivirus-infected samples To evaluate the discrimination accuracy of the real-time PCR assay and quantify copies of MCP fragment, 36 tissue samples including spleen and kidney from Megalocytivirus-infected fishes were used for the experiment (Table 2): 23 from rock bream, 6 from sea bass, 2 from soiuy mullet (Planiliza haematocheila), 1 from thread-sail filefish (Stephanolepis cirrhifer), 1 from a Red Sea bream, 1 from an olive flounder, 1 from a starry flounder (Platichthys stellatus), and 1 from golden mandarin fish (Siniperca scherzeri). All tissue samples were analyzed for the genotype by phylogenetic analysis of MCP gene as described in a previous study (Kim et al., 2019) and compared with the results of the PNA-based real-time PCR assay described in this study. Furthermore, to compare quantitative results, DNAs from Megalocytivirus-infected fishes were quantified with specific primer sets published by Jin et al. (2017) that target a fragment of the MCP region. Briefly, the qPCR was performed with a reagent mixture containing 1 μL DNA (50 ng), 500 nM of
3. Results and discussion A variety of megalocytiviruses have been reported in a wide range of fish species, with wide geographic distribution and genotypes (Song et al., 2008). In Korea, since the first outbreak of RSIVD in rock bream in 1998, two genotypes (RSIV and TRBIV-type) of Megalocytivirus have been identified from cultured fish (Sohn et al., 2000; Kim et al., 2019). No ISKNV-type Megalocytivirus, mainly isolated from freshwater fish, 4
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Fig. 3. Quantitative analysis of artificial Megalocytivirus (RSIV subtype 2)-infected rock bream (Oplegnathus fasciatus) using PNA-based and SYBR Green real-time PCR assays. (A), (C) Standard curve of amplification plots constructed with the synthetic DNA (107 to 102 copies of standard DNA fragment), (A) PNA probe (C) SYBR Green; (B), (D) Melting point of artificial Megalocytivirus (RSIV subtype 2)-infected rock bream samples detected over 108 copies mg−1 of spleen tissue, (B) PNA probe (D) SYBR Green. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
showed a limit of 103 copies μL−1 (Fig. 2.). Although there was a difference in sensitivities via melting curve analysis, a standard curve could be generated at a level of 102 copies μL−1 (R2 > 0.99), which could amplify > 40 crossing points (Cq) using the CFX 96 Touch Realtime PCR detection system (Fig. 3A). Although there was no difference in amplification level by viral copies in the melting curve analysis, a standard curve could also be generated at a level of 102 copies μL−1 (R2 > 0.99) by SYBR Green (Fig. 3C and D). Notably, the genotyping results using the PNA probe were entirely consistent with the results of the real-time PCR assay and MCP gene sequencing results of Megalocytivirus-positive field samples (Table 2.). The quantitative results of viral genome copies of the MCP gene fragment from Megalocytivirus-infected fishes were not significantly different between SYBR Green and PNA-based qPCR assays (t-test, P < .05; Table 2). A previous study revealed that susceptible marine fish such as Red Sea bream and rock bream show > 106 copies mg−1 of tissue at the moribund stage (Jin et al., 2011). In the present study, almost all diseased fish (dead sample) showed > 108 copies mg−1 of the tissue (Table 2). Moreover, artificial Megalocytivirus-infected rock bream (6.7 ± 0.5; n = 20), which were intraperitoneally injected with cultured RB24-GS strain (RSIV subtype 2), died within 14 days (cumulative mortality 100%; log-rank test, P < .05 compared with –ve control group), and the dead fish showed 1.90 ± 0.93 × 108 and 2.88 ± 0.87 × 108 copies mg−1 of spleen using PNA probe and SYBR Green, respectively (Fig. 3B and D). These results suggest that the novel PNA-based real-time PCR assay can be applied not only for Megalocytivirus genotyping but also for evaluation of the infective levels (early-, transmitted-, moribund or dead-stage). In conclusion, a new PNA-based real-time PCR assay allowed the detection and genotyping of Megalocytivirus in a single tube reaction.
has been identified from cultured fish in Korea yet. In-depth genotype analysis is still important for epidemiological investigations due to the high possibility of Megalocytivirus to cross the environmental or species barriers between freshwater and marine fish (Jeong et al., 2008; Dong et al., 2010). In this study, to apply the PNA probes for Megalocytivirus genotyping, a total of 166 MCP sequences (13 from RSIV subtype1, 22 from RSIV subtype 2, 93 from ISKNV-type, and 38 from TRBIV-type isolates) were compiled from GenBank. Melting temperatures of perfectly matched probes were 68 °C for RSIV subtype 1 (FAM), 65 °C for RSIV subtype 2 (HEX), 77 °C for ISKNV-type (Texas-Red), and 71 °C for TRBIV-type Megalocytivirus (Cy5) (Fig. 1). Besides, other viruses (VHSV, VNNV, HRV, and LCDV) were not amplified using the designed primers and probes (data not shown). By differencing Tm values between perfectly and single mismatch of nucleotide sequences (10–15 °C difference, even in a single mismatch) (Porcheddu and Giacomelli, 2005), the PNA probe allows accurate discrimination of genotypes. Although we obtained a perfect match result in all fluorescence assays, a Tm difference of 1–2 °C can arise during PCR amplification. From this result, specific genotypes were determined using a range of the perfect match Tm ± 2 °C (RSIV subtype 1, 66–70 °C; RSIV subtype 2, 63–67 °C; ISKNV-type, 75–79 °C; TRBIV, 69–73 °C; Table 1). Using synthetic DNA containing primer and probe sequences as the standard, the developed PNA-based real-time PCR was used for simultaneous quantity and quality analyses via one reaction. Furthermore, synthetic DNA containing the GFP sequence has the advantage of differentiating between a positive sample and standard DNA. From the melting curve analysis, the detection limit for the real-time PCR assay appeared to be 102 copies μL−1 of synthetic DNA, except in the case of the HEX fluorescence targeting RSIV subtype 2, which 5
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Melting curve analysis of fluorescence generated from the positive samples was consistent with the sequencing results and could overcome the DNA-based limitations such as non-specific amplification. Also, viral titration could be determined by applying synthetic DNA as a standard. The novel real-time PCR method can be used as a reliable and informative diagnostic tool for assessing Megalocytivirus infection and might be applicable in epidemiological investigations.
Fish Pathol. 24, 53–64 (In Korean). Jin, J.W., Kim, Y.K., Hong, S., Kim, Y.C., Kwon, W.J., Jeong, H.D., 2017. Identification and characterization of Megalocytivirus type 3 infection with low mortality in starry flounder, Platichthys stellatus, in Korea. J. World Aquacult. Soc. 49, 229–239. Jung, S.J., Oh, M.J., 2000. Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula. J. Fish Dis. 23, 223–226. Kawakami, H., Nakajima, K., 2002. Cultured fish species affected by Red Sea Bream Iridoviral disease from 1996 to 2000. Fish Pathol. 37, 45–47. Kim, K.I., Jin, J.W., Kim, Y.C., Jeong, H.D., 2014. Detection and genetic differentiation of Meglaocytiviruses in shellfish via high-resolution melting (HRM) analysis. Korean J. Fish Aquatic Sci. 47, 241–246 (In Korean). Kim, K.I., Kwon, W.J., Kim, Y.C., Kim, M.S., Hong, S., Jeong, H.D., 2016. Surveillance of aquatic animal viruses in seawater and shellfish in Korea. Aquaculture 461, 17–24. Kim, K.I., Lee, E.S., Do, J.W., Hwang, S.D., Cho, M., Jung, S.H., Jee, B.Y., Kwon, W.J., Jeong, H.D., 2019. Genetic diversity of Meglaocytivirus from cultured fish in Korea. Aquaculture 509, 16–22. Kurita, J., Nakajima, K., 2012. Megalocytiviruses. Viruses 4, 521–538. Lopez-Porras, A., Morales, J.A., Alvarado, G., Koda, S.A., Camus, A., Subramaniam, K., Waltzek, T.B., Soto, E., 2018. Red seabream Iridovirus associated with cultured Florida pompano Trachinotus carolinus mortality in Central America. 2018. Dis. Aquat. Org. 130, 109–115. Mackay, J.F., Wright, C.D., Bonfiglioli, R.G., 2008. A new approach to varietal identification in plants by microsatellite high resolution melting analysis: application to the verification of grapevine and olive cultivars. Plant Methods 4, 8. OIE, 2018. World Organization for Animal Health, Manual of Diagnostic Tests for Aquatic Animal. http://www.oie.int/standard-setting/aquatic-manual/access-online. Porcheddu, A., Giacomelli, G., 2005. Peptide nucleic acids (PNAs), a chemical overview. Curr. Med. Chem. 12, 2561–2599. Sohn, S.G., Choi, D.L., Do, J.W., Hwang, J.W., Park, J.W., 2000. Mass mortalities of cultured striped beakperch, Oplegnathus fasciatus by iridoviral infection. J. Fish Pathol. 13 (2), 121–127 (In Korean). Song, J.Y., Kitamura, S., Jung, S.J., Miyadai, T., Tanaka, S., Fukuda, Y., Kim, S.R., Oh, M.J., 2008. Genetic variation and geographic distribution of megalocytiviruses. J. Microbiol. 46, 29–33. Sudthongkong, C., Miyata, M., Miyazaki, T., 2002. Viral DNA sequences of genes encoding the ATPase and the major capsid protein of tropical iridovirus isolates which are pathogenic to fishes in Japan, South China Sea and southeast Asian countries. Arch. Virol. 147 (11), 2089–2109. White, H.E., Hall, V.J., Cross, N.C.P., 2007. Methylation-sensitive high-resolution melting-curve analysis of the SNRPN gene as a diagnostic screen for Prader-Willi and Angelman syndromes. Clin. Chem. 53, 1960–1962. Wittwer, C.T., Reed, G.H., Gundry, C.N., Vandersteen, J.G., Pryor, R.J., 2003. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin. Chem. 49, 853–860. Wojdacz, T.K., Dorbrovic, A., 2007. Methylation-sensitive high resolution melting (MSHRM): a new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res. 35, e41.
Declaration of Competing Interest The author declares no conflicts of interest. Acknowledgments This work was supported by a grant from the National Institute of Fisheries Science (R2019055). References Chinchar, V.G., Hick, P., Ince, I.A., Jancovich, J.K., Marschang, R., Qin, Q., Subramaniam, K., Waltzek, T.B., Whittington, R., Williams, T., Zhang, Q.Y., 2017. ICTV virus taxonomy profile: iridoviridae. J. Gen. Virol. 98, 890–891. Do, J.W., Cha, S.J., Kim, J.S., An, E.J., Lee, N.S., Choi, H.J., Park, M.S., Kim, J.W., Kim, Y.C., Park, J.W., 2005. Phylogenetic analysis of the major capsid protein gene of Iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis. Aquat. Org. 64, 193–200. Dong, C., Weng, S., Luo, Y., Huang, M., Ai, H., Yin, Z., He, J., 2010. A new marine Megalocytivirus from spotted knifejaw, Oplegnathus punctatus, and its pathogenicity to freshwater mandarinfish, Siniperca chuatsi. Virus Res. 147, 98–106. He, J.G., Weng, S.P., Zeng, K., Huang, Z.J., Chan, S.M., 2000. Systemic disease caused by an Iridovirus-like agent in cultured mandarinfish, Siniperca chuatsi (Basilewsky), in China. J. Fish Dis. 23, 219–222. Inouye, K., Yamano, K., Maeno, Y., Nakajima, K., Matsuoka, M., Wada, Y., Sorimachi, M., 1992. Iridovirus infection of cultured Red Sea bream, Pagrus major. Fish Pathol. 27, 19–27. Jeong, J.B., Jun, J.L., Yoo, M.H., Kim, M.S., Komisar, J.L., Jeong, H.D., 2003. Characterization of the DNA nucleotide sequences in the genome of Red Sea bream Iridoviruses isolated in Korea. Aquaculture 220, 119–133. Jeong, J.B., Kim, Y.C., Jun, L.J., Lyu, J.H., Park, N.G., Kim, J.K., Jeong, H.D., 2008. Outbreak of risks of infectious spleen and kidney necrosis virus disease in firewater ornamental fishes. Dis. Aquat. Org. 78, 209–215. Jin, J.W., Cho, H.J., Kim, K.I., Jeong, J.B., Park, G.H., Jeong, H.D., 2011. Quantitative analysis of the clinical signs in marine fish induced by Megalocytivirus infection. J.
6
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Short communication
Novel peptide nucleic acid-based real-time PCR assay for detection and genotyping of Megalocytivirus Eun Sun Lee, Miyoung Cho, Eun Young Min, Sung Hee Jung, Kwang Il Kim
T
⁎
Pathology Division, National Institute of Fisheries Science, Busan 46083, Republic of Korea
A R T I C LE I N FO
A B S T R A C T
Keywords: Megalocytivirus Red Sea bream iridoviral disease Peptide nucleic acid Genotyping
Megalocytivirus, the causative agent for Red Sea Bream Iridoviral Disease (RSIVD), is classified into three genotypes based on its phylogeny: Red Sea Bream Iridovirus (RSIV), Infectious Spleen and Kidney Necrosis Virus (ISKNV), and Turbot Reddish Body Iridovirus (TRBIV). To overcome drawbacks such as limitation of genotypic variant type discrimination and unexpected PCR reaction from an SYBR green-based genotyping method by high-resolution melting analysis, peptide nucleic acid (PNA)-based real-time PCR assay for detecting and genotyping Megalocytivirus was developed. Compared with DNA hybridization, PNA has more suitable hybridization traits that allowed the difference in melting temperature (Tm) even by a single nucleotide mismatch. Based on the consensus sequences of the viral major capsid protein gene, four PNA probes labeled with respective fluorescence at their 3′ ends were designed as reporter molecules. PNA-based real-time PCR assay allowed quantification of Megalocytivirus copies using a synthetic DNA as standard (detection limit of 103 copies) and discrimination of the genotypes based on Tm in a single-tube reaction. Furthermore, the results of this new method were consistent with those of sequencing analysis of Megalocytivirus-infected field and artificial samples, proving its accuracy and efficiency. The novel PNA-based real-time PCR assay could contribute to the detection as well as discrimination of the genotypes of Megalocytivirus in a single simple assay, and could be used as a highly robust diagnostic tool in the field of aquatic animal diseases.
1. Introduction Megalocytivirus belongs to the family Iridoviridae and is the causative agent of Red Sea Bream Iridoviral Disease (RSIVD), a major cause of mortality in Red Sea bream (Pagrus major) and other marine fish, according to the World Organization for Animal Health (Chinchar et al., 2017; OIE, 2018). Megalocytivirus is one of the most virulent viruses affecting > 30 marine and freshwater fish worldwide. Since the first outbreak of Red Sea Bream Iridovirus (RSIV) observed in Red Sea bream in Japan in 1990 (Inouye et al., 1992), it has rapidly been transmitted to Asian countries, resulting in endemic diseases (Jeong et al., 2003; Kawakami and Nakajima, 2002; He et al., 2000; Sudthongkong et al., 2002; Do et al., 2005). Infection with megalocytiviruses have also been reported from Central America (Lopez-Porras et al., 2018). In Korea, the first RSIVD case was reported in juvenile rock bream in 1998; however, the disease has spread to other marine fish such as Red Sea bream and sea bass (Lateolabrax japonicus) and is now endemic in Korea (Jung and Oh, 2000; Sohn et al., 2000; Jeong et al., 2003; Kim et al., 2019). Based on the major capsid protein (MCP) and adenosine triphosphatase, Megalocytivirus is classified into three genotypes: Red Sea
⁎
Bream Iridovirus (RSIV), Infectious Spleen and Kidney Necrosis Virus (ISKNV), and Turbot Reddish Body Iridovirus (TRBIV) (Kurita and Nakajima, 2012). Since it shows vast genetic diversities in several fish species, the accurate genotyping tool is necessary. Previous studies reported genotyping based on melting curve analysis of PCR amplicon that allowed discrimination of single nucleotide polymorphisms (SNPs) and evaluation of DNA methylation and microsatellites (Wittwer et al., 2003; White et al., 2007; Wojdacz and Dorbrovic, 2007; Mackay et al., 2008). Compared with the sequencing method, the melting curve analysis is simple and robust for differentiating genotypes. Previously, a genotyping method for Megalocytivirus by high-resolution melting analysis has been reported (Kim et al., 2014), however, this method shows some drawbacks such as discriminating limitations of variants and non-specific contamination during PCR amplification with primers and SYBR green dye at low copies. Peptide nucleic acid (PNA) has a favorable hybridization trait, along with chemical and thermal stability that is higher than that in DNA-DNA hybridization (Porcheddu and Giacomelli, 2005). In the present study, to supplement and overcome the weakness of SYBR green based-method, PNA-based real-time PCR assay for detecting and simultaneously discriminating Megalocytivirus
Corresponding author. E-mail address: [email protected] (K.I. Kim).
https://doi.org/10.1016/j.aquaculture.2019.734818 Received 28 August 2019; Received in revised form 1 December 2019; Accepted 3 December 2019 Available online 05 December 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Table 1 Primers and PNA probes used in this study for qPCR assay. qPCR assay
Primer name
Target
Sequence (5′ to 3′)
Final concentrations (nM)
PNA probe
Irido-F4 Irido-inner-R6 Irido-inner-F7 Irido-R5 RSIV-sub.1 probe RSIV-sub.2 probe ISKNV probe TRBIV probe qM1F qM1R
Megalocytivirus all genotypes
RSIV subtype 1
GGTGTCGGTGTCATTTAACG TACAACGAGGTGCGCATCC GTCTAGCCGTAGCATGCTC CTCATTTACGAGAACACCCC Dabcyl-CAATTACACTGCGGC-FAM
RSIV subtype 2 ISNKV-type TRBIV-type Megalocytivirus all genotypes
SYBR Green
Melting temperature (°C)
References GenBank No. (position)
50 500 50 500 500
68
AB104413 AB104413 AB104413 AB104413 AB104413
Dabcyl-ATGTCACTCACCGCA-HEX
500
65
AT532606 (905–919)
BHQ3-CAACGGCCAGACTAT-TxR BHQ3-GTTCAGTCATCCCGTCA-Cy5 GGCGACTACCTCATTAATGT CCACCAGGTCGTTAAATGA
500 500 500 500
77 71
AF371960 (480–494) GQ273492 (864–880) Jin et al. (2017)
(333–352) (577–595) (771–789) (1015–1034) (930–944)
Fig. 1. Megalocytivirus genotyping based on differences in melting temperature (Tm) and fluorescence signal of PNA probes. Fluorescence signals and perfectly matched Tm were generated for respective genotypes, (A) 68 °C for RSIV subtype 1 with FAM; (B) 65 °C for RSIV subtype 2 with HEX; (C) 77 °C for ISKNV-type with Texas-red; (D) 71 °C for TRBIV-type with Cy5. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
10 mL of 0.25% trypsin ethylenediaminetetraacetic acid solution (Gibco, USA) and incubated with shaking (450 rpm) at 25 °C for 30 min. Subsequently, the trypsinized cells were collected following filtration with cell strainer (100-μm pore size) and centrifugation at 1000 ×g for 10 min. Pelleted cells were suspended in L-15 medium (Gibco, USA) containing 20% FBS (performance plus glade; Gibco, USA) and 1× antibiotic-antimycotic solution, and 1 × 106 cells mL−1 were seeded into a 25-cm2 flask (Greiner Bio-one, Germany) and incubated at 25 °C. Primary cultured cells were maintained in L-15 medium containing 20% FBS (Gibco, USA) and 1× antibiotic-antimycotic solution and subcultured at a split ratio of 1:2 every 10–14 days.
genotypes was developed, and was evaluated the method. 2. Materials and methods 2.1. Primary cell culture Rock bream (Oplegnathus fasciatus) (4.5 ± 1.3 cm) that was confirmed to be free of megalocytiviruses by PCR was used for the primary culture. The fish body surface was wiped with 70% ethanol, and caudal fin tissue was cut aseptically from three fish and washed with phosphate saline buffer (PBS) containing 2× antibiotic-antimycotic solution (Gibco, USA). The tissues were transferred into a Petri dish (SPL, South Korea) with PBS and minced into small pieces (approximately 1 mm3), and then gently washed three times with PBS. Tissue fragments (300–500 mg) were then transferred into a new Petri dish containing
2.2. Virus culture In this study, megalocytiviruses obtained from the following 2
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Table 2 Genotyping and quantitative results using PNA probe in different diseased fish between 2012 and 2018. Isolate
RB2-YS SM1-SC SB1-TY RB3-JJ RB4-SC RB5-NH OF1-JH RS2-TY RB6-YS SB2-YS RB7-NH RB8-WD RB9-WD RB10-GH RB11-GH RB16-YS RB17-YS RB18-TY SB3-GH RB19-GJ SB4-GH TF1-GS SB5-TY RB20-SA RB21-NH SB6-NH RB22-SC SM2-HD RB23-TY RB24-GS RB25-GJ RB26-GJ SF1-PH RB27-YS RB28-YS GM2-SC a
Biological source
Oplegnathus fasciatus Planiliza haematocheila Latolabrax japonicus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Paralichthys olivaceus Pagrus major Oplegnathus fasciatus Latolabrax japonicus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Latolabrax japonicus Oplegnathus fasciatus Latolabrax japonicus Stephanolepis cirrhifer Latolabrax japonicus Oplegnathus fasciatus Oplegnathus fasciatus Latolabrax japonicus Oplegnathus fasciatus Planiliza haematocheila Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Oplegnathus fasciatus Platichthys stellatus Oplegnathus fasciatus Oplegnathus fasciatus Siniperca scherzeri
Year
2012 2013 2013 2013 2014 2014 2014 2014 2014 2015 2015 2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2017 2018
Genotypea
Sampling site
Yeosu Sachun TongYeong Jeju Sachun Namhae Jangheung TongYeong Yeosu Yeosu Namhae Wando Wando Goheung Goheung Yeosu Yeosu TongYeong Goheung GeoJe Goheung Goseong TongYeong Shinan Namhae Namhae Sachun Hadong TongYeong Goseong GeoJe GeoJe Pohang Yeosu Yeosu Sancheong
RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 TRBIV RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.1 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2
Melt curve
RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 TRBIV RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.1 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2 RSIV-sub.2
Viral genome copies mg−1 tissue PNA probe
SYBR Green
5.59E+08 2.59E+05 3.72E+08 4.78E+08 5.47E+08 2.14E+09 7.32E+06 2.57E+07 4.05E+08 2.45E+08 3.24E+08 6.48E+07 6.23E+05 6.09E+07 8.18E+08 3.91E+09 3.52E+09 2.41E+08 2.26E+09 8.05E+08 3.78E+07 1.93E+03 1.55E+08 6.03E+08 5.99E+08 1.30E+05 7.52E+08 1.09E+08 1.31E+07 1.44E+07 4.42E+08 1.67E+08 2.59E+08 3.74E+08 7.81E+05 1.31E+08
5.32E+08 3.70E+05 4.20E+08 4.50E+08 5.50E+08 1.98E+09 7.02E+06 2.20E+07 3.50E+08 2.10E+08 2.15E+08 5.40E+07 3.23E+05 5.05E+07 6.89E+08 1.95E+09 3.24E+09 3.75E+08 1.05E+09 7.02E+08 5.89E+07 2.52E+03 2.72E+08 3.03E+08 2.58E+08 2.74E+05 5.23E+08 3.75E+08 2.43E+07 3.42E+07 5.23E+08 2.45E+08 4.78E+08 1.45E+08 5.15E+05 2.89E+08
Phylogenetic analysis of major capsid protein gene (Kim et al., 2019)
hexachlorofluorescein (HEX) for the RSIV subtype 2 probe, sulforhodamine 101 acid chloride (Texas-Red) for the ISKNV-type probe, and Cy 5 for the TRBIV-type probe. Furthermore, two different quenchers were labeled at the 5′ end, namely Dabcyl for the RSIV subtypes, and BHQ3 for the ISKNV and TRBIV-type probes.
primary cells were used: SB5-TY (RSIV subtype I) derived from sea bass and RB24-GS (RSIV subtype II) derived from rock bream (Kim et al., 2019), PGIV (ISKNV-type) derived from pearl gourami (Trichogaster leeri; see Jeong et al., 2008), and FLIV (TRBIV-type) derived from olive flounder (Paralichthys olivaceus; see Kim et al., 2014). Infections were induced in 25-cm2 culture flasks containing monolayers of primary cells at a multiplicity of infection (MOI) of 1. Megalocytiviruses were propagated at 25 °C in L-15 medium (Gibco, USA) supplemented with 5% fetal bovine serum and 1× antibioticantimycotic solution (Gibco, USA). Inoculated cells were incubated at 25 °C and monitored daily for 10 days. After the appearance of degenerative changes in fibroblast-like cells as the cytopathic effect (CPE), the supernatant was collected following centrifugation at 1500 ×g for 10 min and stored at −80 °C.
2.4. Quantitative and qualitative analysis For the quantitative analysis, a synthetic oligonucleotide was used as a standard DNA. A synthetic DNA was constructed with the green fluorescent protein (GFP) sequence (total 1362 bp) containing primers and PNA-probe sequences at each site described in Table 1. Standards (102 to 107 viral genome copies μL−1 of fragmented MCP gene) were generated by 10-fold dilution with 1× TE buffer (Fig. 3A). Real-time PCR was performed with a reagent mixture containing 1 μL DNA (50 ng), 50–500 nM of each primer and probe, and 2× probe premix (TNS, Korea) using CFX 96 Touch Real-time PCR detection system (BioRad, USA) according to the manufacturer's instructions. The real-time PCR was performed under the following conditions to amplify the fragmented MCP gene: denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 54 °C for 40 s and 76 °C for 50 s. Next, to hybridize to the PNA probe and obtain melting curves, fluorescence was measured under the following conditions: denaturation at 95 °C for 5 min, followed by holding at 75 °C for 1 min, 55 °C for 1 min and 45 °C for 1 min, followed by a temperature rise from 40 °C to 90 °C at a rate of 1 °C withholding for 5 s. Megalocytivirus genotypes were determined based on the fluorescence signal and melting temperature (Tm) values (Fig. 1). Specific genotypes were determined by the range of perfect
2.3. Primer and PNA probe design Primers for detecting Megalocytivirus [Irido-F4, Irido-inner-R6, Irido-inner-F7, and Irido-R5] were designed based on the MCP gene (Table 1). Probes for discriminating Megalocytivirus genotypes [RSIVsub.1 probe specific to the RSIV subtype 1 (Genbank accession no. AB104413), RSIV-sub.2 probe specific to the RSIV subtype 2 (Genbank accession no. AT532606), ISKNV probe specific to the ISKNV-type (Genbank accession no. AF371960), and TRBIV probe specific to the TRBIV-type (Genbank accession no. GQ273492)] were designed to be complementary to the parts of their respective specific sequences. Four different fluorophores were labeled at the 3′ ends as a reporter: 6-carboxyfluorescein (FAM) for the RSIV subtype 1 probe, 3
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Fig. 2. The sensitivity of the PNA-based real-time PCR assay. Melting points of synthetic DNA as standard were measured and showed different fluorescences based on Megalocytivirus genotypes. The detection limit of (A) RSIV subtype 1, (C) ISKNV-type, and (D) TRBIV-type appeared to be 102 copies, while that of (B) RSIVsubtype 2 was 103 copies of fragmented DNA.
each primer, and the universal SYBR Green supermix (Bio-Rad) using CFX 96 Touch Real-time PCR detection system (Bio-Rad, USA) according to the manufacturer's instructions. The real-time PCR was performed under the following conditions: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for the 30s. Next, to obtain melting curves, fluorescence was measured by temperature rise from 40 °C to 90 °C at a rate of 1 °C withholding for 5 s. Standards (102 to 107 viral genome copies μL−1) were generated using a recombinant plasmid containing the partial MCP gene (141 bp; Fig. 3C). Rock bream (6.7 ± 0.5 cm) confirmed to be free of Megalocytivirus by qPCR were acclimatized for 10 d at 25 °C in a 500-L tank. A total of 20 rock bream were intraperitoneally injected with 0.1 mL of cultured RB24-GS strain (RSIV subtype 2) at a concentration of 106 viral genome copies per fish. As a negative control, 0.1 mL of PBS was intraperitoneally injected into 20 rock breams. After the viral challenge, the fish were maintained at 26 °C for 15 d using an automatic cooling and heating system. The rearing water was changed continuously (5–6 L h−1) and effluent was discharged through an automatic ozone treatment system. Spleen tissues were cut aseptically from dead and survived fish, and genotyping and quantification of viral copies of MCP gene fragment were performed as described above. All experiments were performed with the permission of the Animal Ethics Committee of the National Institute of Fisheries Science (Permission No. 2019-NIFS-IACUC-20).
match Tm ± 2 °C. 2.5. Specificity and sensitivity test To evaluate the specificity of the real-time PCR assay, four different megalocytiviruses as detailed above, i.e., Viral hemorrhagic septicemia virus IVa genotype (VHSV) and Viral nervous necrosis virus RGNNV type (VNNV) described by Kim et al. (2016), Hirame rhadovirus (HIRRV; ATCC VR-1391), and lymphocytis disease virus (LCDV) were used. Nucleic acids were purified using a Patho Gene-Spin DNA/RNA Extraction kit (Intronbio). For the RNA viruses, cDNA synthesis was performed using the Iscript cDNA synthesis kit (Bio-rad, USA). The detection limit of the real-time PCR was determined using 10-fold serial dilutions of standard DNA (107–102 copies μL−1). 2.6. Application for field and artificial Megalocytivirus-infected samples To evaluate the discrimination accuracy of the real-time PCR assay and quantify copies of MCP fragment, 36 tissue samples including spleen and kidney from Megalocytivirus-infected fishes were used for the experiment (Table 2): 23 from rock bream, 6 from sea bass, 2 from soiuy mullet (Planiliza haematocheila), 1 from thread-sail filefish (Stephanolepis cirrhifer), 1 from a Red Sea bream, 1 from an olive flounder, 1 from a starry flounder (Platichthys stellatus), and 1 from golden mandarin fish (Siniperca scherzeri). All tissue samples were analyzed for the genotype by phylogenetic analysis of MCP gene as described in a previous study (Kim et al., 2019) and compared with the results of the PNA-based real-time PCR assay described in this study. Furthermore, to compare quantitative results, DNAs from Megalocytivirus-infected fishes were quantified with specific primer sets published by Jin et al. (2017) that target a fragment of the MCP region. Briefly, the qPCR was performed with a reagent mixture containing 1 μL DNA (50 ng), 500 nM of
3. Results and discussion A variety of megalocytiviruses have been reported in a wide range of fish species, with wide geographic distribution and genotypes (Song et al., 2008). In Korea, since the first outbreak of RSIVD in rock bream in 1998, two genotypes (RSIV and TRBIV-type) of Megalocytivirus have been identified from cultured fish (Sohn et al., 2000; Kim et al., 2019). No ISKNV-type Megalocytivirus, mainly isolated from freshwater fish, 4
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Fig. 3. Quantitative analysis of artificial Megalocytivirus (RSIV subtype 2)-infected rock bream (Oplegnathus fasciatus) using PNA-based and SYBR Green real-time PCR assays. (A), (C) Standard curve of amplification plots constructed with the synthetic DNA (107 to 102 copies of standard DNA fragment), (A) PNA probe (C) SYBR Green; (B), (D) Melting point of artificial Megalocytivirus (RSIV subtype 2)-infected rock bream samples detected over 108 copies mg−1 of spleen tissue, (B) PNA probe (D) SYBR Green. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
showed a limit of 103 copies μL−1 (Fig. 2.). Although there was a difference in sensitivities via melting curve analysis, a standard curve could be generated at a level of 102 copies μL−1 (R2 > 0.99), which could amplify > 40 crossing points (Cq) using the CFX 96 Touch Realtime PCR detection system (Fig. 3A). Although there was no difference in amplification level by viral copies in the melting curve analysis, a standard curve could also be generated at a level of 102 copies μL−1 (R2 > 0.99) by SYBR Green (Fig. 3C and D). Notably, the genotyping results using the PNA probe were entirely consistent with the results of the real-time PCR assay and MCP gene sequencing results of Megalocytivirus-positive field samples (Table 2.). The quantitative results of viral genome copies of the MCP gene fragment from Megalocytivirus-infected fishes were not significantly different between SYBR Green and PNA-based qPCR assays (t-test, P < .05; Table 2). A previous study revealed that susceptible marine fish such as Red Sea bream and rock bream show > 106 copies mg−1 of tissue at the moribund stage (Jin et al., 2011). In the present study, almost all diseased fish (dead sample) showed > 108 copies mg−1 of the tissue (Table 2). Moreover, artificial Megalocytivirus-infected rock bream (6.7 ± 0.5; n = 20), which were intraperitoneally injected with cultured RB24-GS strain (RSIV subtype 2), died within 14 days (cumulative mortality 100%; log-rank test, P < .05 compared with –ve control group), and the dead fish showed 1.90 ± 0.93 × 108 and 2.88 ± 0.87 × 108 copies mg−1 of spleen using PNA probe and SYBR Green, respectively (Fig. 3B and D). These results suggest that the novel PNA-based real-time PCR assay can be applied not only for Megalocytivirus genotyping but also for evaluation of the infective levels (early-, transmitted-, moribund or dead-stage). In conclusion, a new PNA-based real-time PCR assay allowed the detection and genotyping of Megalocytivirus in a single tube reaction.
has been identified from cultured fish in Korea yet. In-depth genotype analysis is still important for epidemiological investigations due to the high possibility of Megalocytivirus to cross the environmental or species barriers between freshwater and marine fish (Jeong et al., 2008; Dong et al., 2010). In this study, to apply the PNA probes for Megalocytivirus genotyping, a total of 166 MCP sequences (13 from RSIV subtype1, 22 from RSIV subtype 2, 93 from ISKNV-type, and 38 from TRBIV-type isolates) were compiled from GenBank. Melting temperatures of perfectly matched probes were 68 °C for RSIV subtype 1 (FAM), 65 °C for RSIV subtype 2 (HEX), 77 °C for ISKNV-type (Texas-Red), and 71 °C for TRBIV-type Megalocytivirus (Cy5) (Fig. 1). Besides, other viruses (VHSV, VNNV, HRV, and LCDV) were not amplified using the designed primers and probes (data not shown). By differencing Tm values between perfectly and single mismatch of nucleotide sequences (10–15 °C difference, even in a single mismatch) (Porcheddu and Giacomelli, 2005), the PNA probe allows accurate discrimination of genotypes. Although we obtained a perfect match result in all fluorescence assays, a Tm difference of 1–2 °C can arise during PCR amplification. From this result, specific genotypes were determined using a range of the perfect match Tm ± 2 °C (RSIV subtype 1, 66–70 °C; RSIV subtype 2, 63–67 °C; ISKNV-type, 75–79 °C; TRBIV, 69–73 °C; Table 1). Using synthetic DNA containing primer and probe sequences as the standard, the developed PNA-based real-time PCR was used for simultaneous quantity and quality analyses via one reaction. Furthermore, synthetic DNA containing the GFP sequence has the advantage of differentiating between a positive sample and standard DNA. From the melting curve analysis, the detection limit for the real-time PCR assay appeared to be 102 copies μL−1 of synthetic DNA, except in the case of the HEX fluorescence targeting RSIV subtype 2, which 5
Aquaculture 518 (2020) 734818
E.S. Lee, et al.
Melting curve analysis of fluorescence generated from the positive samples was consistent with the sequencing results and could overcome the DNA-based limitations such as non-specific amplification. Also, viral titration could be determined by applying synthetic DNA as a standard. The novel real-time PCR method can be used as a reliable and informative diagnostic tool for assessing Megalocytivirus infection and might be applicable in epidemiological investigations.
Fish Pathol. 24, 53–64 (In Korean). Jin, J.W., Kim, Y.K., Hong, S., Kim, Y.C., Kwon, W.J., Jeong, H.D., 2017. Identification and characterization of Megalocytivirus type 3 infection with low mortality in starry flounder, Platichthys stellatus, in Korea. J. World Aquacult. Soc. 49, 229–239. Jung, S.J., Oh, M.J., 2000. Iridovirus-like infection associated with high mortalities of striped beakperch, Oplegnathus fasciatus (Temminck et Schlegel), in southern coastal areas of the Korean peninsula. J. Fish Dis. 23, 223–226. Kawakami, H., Nakajima, K., 2002. Cultured fish species affected by Red Sea Bream Iridoviral disease from 1996 to 2000. Fish Pathol. 37, 45–47. Kim, K.I., Jin, J.W., Kim, Y.C., Jeong, H.D., 2014. Detection and genetic differentiation of Meglaocytiviruses in shellfish via high-resolution melting (HRM) analysis. Korean J. Fish Aquatic Sci. 47, 241–246 (In Korean). Kim, K.I., Kwon, W.J., Kim, Y.C., Kim, M.S., Hong, S., Jeong, H.D., 2016. Surveillance of aquatic animal viruses in seawater and shellfish in Korea. Aquaculture 461, 17–24. Kim, K.I., Lee, E.S., Do, J.W., Hwang, S.D., Cho, M., Jung, S.H., Jee, B.Y., Kwon, W.J., Jeong, H.D., 2019. Genetic diversity of Meglaocytivirus from cultured fish in Korea. Aquaculture 509, 16–22. Kurita, J., Nakajima, K., 2012. Megalocytiviruses. Viruses 4, 521–538. Lopez-Porras, A., Morales, J.A., Alvarado, G., Koda, S.A., Camus, A., Subramaniam, K., Waltzek, T.B., Soto, E., 2018. Red seabream Iridovirus associated with cultured Florida pompano Trachinotus carolinus mortality in Central America. 2018. Dis. Aquat. Org. 130, 109–115. Mackay, J.F., Wright, C.D., Bonfiglioli, R.G., 2008. A new approach to varietal identification in plants by microsatellite high resolution melting analysis: application to the verification of grapevine and olive cultivars. Plant Methods 4, 8. OIE, 2018. World Organization for Animal Health, Manual of Diagnostic Tests for Aquatic Animal. http://www.oie.int/standard-setting/aquatic-manual/access-online. Porcheddu, A., Giacomelli, G., 2005. Peptide nucleic acids (PNAs), a chemical overview. Curr. Med. Chem. 12, 2561–2599. Sohn, S.G., Choi, D.L., Do, J.W., Hwang, J.W., Park, J.W., 2000. Mass mortalities of cultured striped beakperch, Oplegnathus fasciatus by iridoviral infection. J. Fish Pathol. 13 (2), 121–127 (In Korean). Song, J.Y., Kitamura, S., Jung, S.J., Miyadai, T., Tanaka, S., Fukuda, Y., Kim, S.R., Oh, M.J., 2008. Genetic variation and geographic distribution of megalocytiviruses. J. Microbiol. 46, 29–33. Sudthongkong, C., Miyata, M., Miyazaki, T., 2002. Viral DNA sequences of genes encoding the ATPase and the major capsid protein of tropical iridovirus isolates which are pathogenic to fishes in Japan, South China Sea and southeast Asian countries. Arch. Virol. 147 (11), 2089–2109. White, H.E., Hall, V.J., Cross, N.C.P., 2007. Methylation-sensitive high-resolution melting-curve analysis of the SNRPN gene as a diagnostic screen for Prader-Willi and Angelman syndromes. Clin. Chem. 53, 1960–1962. Wittwer, C.T., Reed, G.H., Gundry, C.N., Vandersteen, J.G., Pryor, R.J., 2003. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin. Chem. 49, 853–860. Wojdacz, T.K., Dorbrovic, A., 2007. Methylation-sensitive high resolution melting (MSHRM): a new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res. 35, e41.
Declaration of Competing Interest The author declares no conflicts of interest. Acknowledgments This work was supported by a grant from the National Institute of Fisheries Science (R2019055). References Chinchar, V.G., Hick, P., Ince, I.A., Jancovich, J.K., Marschang, R., Qin, Q., Subramaniam, K., Waltzek, T.B., Whittington, R., Williams, T., Zhang, Q.Y., 2017. ICTV virus taxonomy profile: iridoviridae. J. Gen. Virol. 98, 890–891. Do, J.W., Cha, S.J., Kim, J.S., An, E.J., Lee, N.S., Choi, H.J., Park, M.S., Kim, J.W., Kim, Y.C., Park, J.W., 2005. Phylogenetic analysis of the major capsid protein gene of Iridovirus isolates from cultured flounders Paralichthys olivaceus in Korea. Dis. Aquat. Org. 64, 193–200. Dong, C., Weng, S., Luo, Y., Huang, M., Ai, H., Yin, Z., He, J., 2010. A new marine Megalocytivirus from spotted knifejaw, Oplegnathus punctatus, and its pathogenicity to freshwater mandarinfish, Siniperca chuatsi. Virus Res. 147, 98–106. He, J.G., Weng, S.P., Zeng, K., Huang, Z.J., Chan, S.M., 2000. Systemic disease caused by an Iridovirus-like agent in cultured mandarinfish, Siniperca chuatsi (Basilewsky), in China. J. Fish Dis. 23, 219–222. Inouye, K., Yamano, K., Maeno, Y., Nakajima, K., Matsuoka, M., Wada, Y., Sorimachi, M., 1992. Iridovirus infection of cultured Red Sea bream, Pagrus major. Fish Pathol. 27, 19–27. Jeong, J.B., Jun, J.L., Yoo, M.H., Kim, M.S., Komisar, J.L., Jeong, H.D., 2003. Characterization of the DNA nucleotide sequences in the genome of Red Sea bream Iridoviruses isolated in Korea. Aquaculture 220, 119–133. Jeong, J.B., Kim, Y.C., Jun, L.J., Lyu, J.H., Park, N.G., Kim, J.K., Jeong, H.D., 2008. Outbreak of risks of infectious spleen and kidney necrosis virus disease in firewater ornamental fishes. Dis. Aquat. Org. 78, 209–215. Jin, J.W., Cho, H.J., Kim, K.I., Jeong, J.B., Park, G.H., Jeong, H.D., 2011. Quantitative analysis of the clinical signs in marine fish induced by Megalocytivirus infection. J.
6