- Email: [email protected]
Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle
Gene 531 (2013) 288–293
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle Yang Zhou, Caixia Li, Hanfang Cai, Yao Xu, Xianyong Lan, Chuzhao Lei, Hong Chen ⁎ College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Agricultural Molecular Biology, Yangling, Shaanxi 712100, China
a r t i c l e
i n f o
Article history: Accepted 24 August 2013 Available online 1 September 2013 Keywords: Apoa2 gene Association Bovine Haplotype Body traits
a b s t r a c t Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P b 0.05 or P b 0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. © 2013 Elsevier B.V. All rights reserved.
1. Introduction High-density lipoprotein (HDL) is an important component of serum proteins and plays a crucial role in reverse cholesterol transport and lipid metabolism (Nofer et al., 2002). Apolipoprotein A-II (APOA2) is the second major HDL constituents and regulates HDL structure and stability (Boucher et al., 2004). It displaces Apolipoprotein A-I (APOA1) from HDL, accelerates APOA1 catabolism, and decreases its plasma concentration by fasting (Kalopissis et al., 2003; Mehta et al., 2003). The catabolism of APOA2 determines plasma HDL levels and its existence in HDL is an important signal for specific interaction with HDL receptors such as cubilin or heat shock protein 60 (Blanco-Vaca et al., 2001; Dugué-Pujol et al., 2007). Those studies revealed that APOA2 was a key regulatory factor of HDL metabolism and affected lipid metabolism. In human, APOA2 was recognized as a positional and biological candidate gene for type 2 diabetes at the chromosome 1q21-q24 susceptibility locus (Konsta et al., 2009). However, type 2 diabetes was mainly caused by obesity and high-calorie diets which will lead to obesity. So the APOA2 gene may have a relationship with body weight and other Abbreviations: APOA2, Apolipoprotein A-II; HDL, high-density lipoprotein; APOA1, apolipoprotein A-I; SVs, sequence variants; JX, Jiaxian cattle; QC, Qinchuan cattle; CRS, Chinese Red Steppe cattle; NY, Nanyang cattle; UTR, untranslated regions. ⁎ Corresponding author at: No.22 Xinong Road, College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China. Tel.: +86 29 87092004; fax: + 86 29 87092164. E-mail address: [email protected] (H. Chen). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.08.081
body traits related to obesity. Corella and his colleagues' study showed that the −265 T N C promoter polymorphism (rs5082) in the human APOA2 gene is consistently associated with food consumption and obesity (Corella et al., 2007). Overexpressing APOA2 in mouse exhibit hypertriglyceridemia and increased body fat, whereas APOA2-null mouse decreased triglycerides (Allayee et al., 2003). In humans, the APOA2 gene is implicated in visceral fat accumulation and metabolism of triglyceride-rich lipoproteins (van't Hooft et al., 2001). Therefore the APOA2 gene plays a critical role in lipid metabolism and obesity. However, overexpression of human APOA2 in transgenic mice does not increase their susceptibility to obesity (Rotllan et al., 2005). The comparison of transgenic mice overexpressing human or murine APOA2 suggested that the two proteins have opposite effects on HDL size, APOA1 content, plasma concentration, and protection from oxidation (Kalopissis et al., 2003). This means APOA2 may be regulated variously but reveals a common function in different animals. In cattle, few studies of the bovine APOA2 gene have been reported. The function and the molecular mechanisms of it are unknown. However, all those studies in human and mouse showed that APOA2 could be considered as a candidate gene for growth traits in other animals. To date, only few polymorphisms have been reported of the bovine APOA2 gene and no association analysis has been detected. So the purpose of this study was to detect sequence variants (SVs) in the bovine APOA2 gene and to carry out haplotypes construction and association analysis, so as to contribute to the understanding of the role APOA2 in variation of growth traits in cattle, which will possibly contribute to animal breeding and genetics.
Y. Zhou et al. / Gene 531 (2013) 288–293 Table 1 Primer information for mutation discovery and genotyping in the APOA2 gene. a
Sequence of primiers
Name E1
E2/SV1 E3 SV2 SV3 SV4
F: CCAGACCCATACGAACC R: GAGGCGACTAGAGCCTAA F: TTTCTTAGGCTCTAGTCGC R: CTTGGCTCCCTTGTTCT F: CTCCTCCAAAGTCCTTATCACC R: GCAGGCTCACAACTTAACTCC
Position
R: TTTCTGGGCTTTAGAGAGGGGA A G F: CCTTGAAGGTGGGTGTGA
nt -2035 to -2019 nt -998 to -981 nt -1002 to -984 nt 81 to 97 nt-80 to -59 nt 1249 to 1269 nt 282 to 305 nt 425 to 447 nt 188 to 205 nt 361 to 384 nt 254 to 271
R: CAGGCTCTGCAGATTCGACTCC
nt 546 to 567
F: AA TCCCAAGGAGGAGAAGGTGG CC R: ATTCAGCCTCAGCTCTCAGCCCT F: CACTTTCCCTGCCGTTAA
c
SAFb (bp)
AT (°C)
1055
54
1099
56
1349
55
166
57
197
56
314
55
a
E1, E2/SV1 and E3 were for mutation discovery, E2/SV1, SV2, SV4 and SV5 were for genotyping; b Size of amplification fragment. c Annealing temperature; Nucleotides in the box substituted the naturally occurring “GG” to avoid restriction endonuclease recognition sites and “C”, “T” to introduce restriction endonuclease recognition sites.
289
(UTR), 3′ UTR and partial promoter region (-2035 to 0) were designed for PCR amplification (Table 1). To detect mutations, DNA pools were used as templates and constructed with 80–100 individual genomic samples randomly chosen from each cattle breed, respectively. PCR was performed in 25 μL of reaction volume containing 50 ng genomic DNA, 1 μmol/L of each primer, 1 × buffer (including 1.5 mmol/L MgCl2), 200 μmol/L dNTPs, and 2.5 U of Taq DNA polymerase (MBI Fermentas). PCR reactions were carried out using a PCR System Thermal Cycler Dice (TaKaRa, Dalian, China). The PCR regimen was as follows: initial denaturation for 5 min at 95 °C; followed by 35 cycles of 95 °C for 30 s; annealing at prescribed annealing temperature (AT) (Table 1) for 35 s; and primer extension at 72 °C for 1 min 20 s. The final extension was performed at 72 °C for 10 min. PCR products were directly sequenced using an ABI 3730xl DNA sequencer (Applied Biosystems, Foster City, California) and a BigDye terminator sequencing kit (Shanghai Sangon Biotech Co., Ltd., P.R. China). Sequencing results were analyzed by BioXM (Ver. 2.6) software to search mutations. 2.3. Genotyping
2. Materials and methods 2.1. Animals Genomic DNA samples were obtained from blood samples via standard methods (Sambrook and Russell, 2001). In this study, 1021 cows including four Chinese indigenous breeds: Jiaxian cattle (JX, n = 415); Qinchuan cattle (QC, n = 246); Chinese Red Steppe cattle (CRS, n = 135); Nanyang cattle (NY, n = 225). All these cows represent the main breeds of China and are reared in the provinces of Henan, Shaanxi, Jilin and Henan, respectively. After weaning at 6 months age, they were fed at libitum on concentrated feed and straw to 24 months of age. Growth traits of 225 NY cows were recorded at birth (body weight) and after 6, 12, 18 and 24 months (body weight, body height, body length, heart girth, hucklebone width and average daily gain). Growth traits of 246 QC cows were recorded at 24 months (body weight, body height, body length, heart girth, chest width, height at hip across and hucklebone width). 2.2. PCR amplification and sequencing Primers used to amplify the bovine APOA2 gene were designed based on NCBI database (GenBank accession number: AC_000160.1). Four primers pairs covering all exons, introns, 5′ untranslated regions
Six new PCR primers were redesigned to facilitate genotyping of three sequence variants: sequence variant3 (SV3), sequence variant4 (SV4), sequence variant6 (SV6). The detail information about primers was given in Table 1. The SV1, SV3, SV4 and SV6 of the bovine APOA2 gene were genotyped by means of PCR–RFLP method. Aliquots of 7 μL PCR products were digested with 10 U PvuII for SV1, Bmgt120I for SV3, HindIII for SV4 and HaeIII for SV6 for 10 h at 37 °C. The digested products were detected by electrophoresis for about 2 h on a 2.5% agarose gel stained with ethidium bromide. After the polymorphism was detected, the PCR products of different electrophoresis patterns were sent to sequence in both directions. 2.4. Statistical analysis Genotypic and allelic frequencies were directly calculated. Ho (gene homozygosity), He (gene heterozygosity), Ne (effective allele numbers), and PIC (polymorphism information content) were calculated according to Nei's methods, respectively (Nei and Roychoudhury, 1974). SHEsis software was used to perform the haplotype analysis (Yong and Lin, 2005). The SPSS software (Version 16.0) was used to evaluate the relationship between genotypes of each SVs or combined haplotypes and growth traits in NY and QC population (Shan et al., 2011). The 225 cows of NY breed or the 246 cows of QC breed came from several common ancestors and the pedigree of core breeding population animals were traced back
Fig. 1. DNA pool sequencing maps of the six SNPs in bovine APOA2 gene. Note: The SNP positions are shown according to GenBank No. AC_000160.1.
290
Y. Zhou et al. / Gene 531 (2013) 288–293
Table 2 Genetic diversity of four loci of the APOA2 gene in four Chinese cattle breeds. Genotypic frequency
Allelic frequency
SV
Breed
AA
CC
AC
A
C
Ho
Ne
PIC
SV1
JX QC NY CY
0.187 0.195 0.204 0.091 T 0.699 0.780 0.818 0.519 T 0.828 0.854 0.843 0.620 G 0.773 0.877 0.881 0.889
0.579 0.657 0.702 0.501
1.727 1.522 1.424 1.997
0.332 0.284 0.253 0.375
JX QC NY CY
0.813 0.805 0.796 0.909 C 0.301 0.220 0.182 0.481 G 0.172 0.146 0.157 0.380 C 0.227 0.123 0.119 0.111
0.258 0.265 0.272 0.152
SV4
0.330 0.228 0.353 0.183 CT 0.432 0.349 0.339 0.645 GT 0.000 0.040 0.000 0.108 CG 0.283 0.186 0.187 0.222
1.436 1.458 1.480 1.199
JX QC NY CY
0.022 0.081 0.027 0.000 TT 0.483 0.606 0.648 0.196 TT 0.828 0.834 0.843 0.566 GG 0.632 0.784 0.787 0.778
0.696 0.686 0.675 0.834
SV3
0.648 0.691 0.620 0.817 CC 0.085 0.046 0.012 0.159 GG 0.172 0.126 0.157 0.325 CC 0.085 0.030 0.026 0.000
0.715 0.751 0.736 0.529
1.399 1.332 1.359 1.890
0.245 0.218 0.229 0.360
0.649 0.784 0.790 0.802
1.540 1.276 1.266 1.246
0.289 0.193 0.188 0.178
SV6
JX QC NY CY
JX, Jiaxian cattle (n = 415); QC, Qinchuan cattle (n = 246); NY, Nanyang cattle (n = 225); CRS: Chinese Red Steppe cattle (n = 135).
three generations. The following linear model was used in NY breed analysis: Yij = μ + Ai + Gj + eij where Yij is the trait measured on each of the ijth animal; μ is the overall population mean; Ai is the fixed effect due to the ith age; Gj is the fixed effect associated with jth genotype; and eij is the random error (Huang et al., 2012). In the QC cattle analysis, we used another model: Yi = μ + Gi + ei where Yi is the trait measured on each of the ith animal,μis the overall population mean, Gj is the fixed effect associated with jth genotype, and ei is the random error (Xue et al., 2013). 3. Results and discussion 3.1. Sequence variants identified in the bovine APOA2 gene The bovine APOA2 gene locates on chromosome 3 contains 3 exons and encodes 100 amino acids. In order to better understand the detail
variation of the bovine Apoa2 gene, all exons, introns, 5′ UTR, 3′ UTR and partial promoter region (−2035 to 0) were screened. Six novel mutations were identified (Fig. 1). Compared with previous reported aequence (GenBank accession number: AC_000160.1), g. −652A N C was in promoter region, g.247 T N A (exon1) and g.540A N G (exon2) was in coding region, g.306C N T (intron1), g.360 T N G (intron 1) and g.424G N C (intron1) were in the introns. Both the mutation g.247 T N A and g.540A N G were the synonymous mutation p.Ile13Ile and p.Gln24Gln. For convenience, the six mutations were named: sequence variant1 (SV1), sequence variant2 (SV2), sequence variant3 (SV3), sequence variant4 (SV4) sequence variant5 (SV5) and sequence variant6 (SV6), respectively. 3.2. Genotype distribution and genetic diversity In this study, four loci (SV1, SV3, SV4 and SV6) of the bovine APOA2 gene were genotyped for the low mutation frequencies of the SV2 and SV5 loci. The genotypic frequencies, allelic frequencies and genetic indices (Ho, He, Ne, and PIC) of the four loci in four Chinese cattle populations were shown in Table 2. At the SV1 locus, digestion of the 1099 bp PCR fragment with PvuII resulted in fragment lengths of 747 and 352 bp for genotype AA; 1099, 747 and 352 bp for genotype AC and 1099 bp for genotype CC (Fig. 2a). The mutant allele A frequencies were obviously higher than the C allele frequencies in all the four breeds. In CRS breed, no CC genotype was found. CRS breed possessed low polymorphism (0 b PIC b 0.25) and other three breeds possessed intermediate polymorphism (0.25 b PIC b 0.5). At the SV3 locus, digestion of the 166 bp PCR fragment with Bmgt120I resulted in fragment lengths of 144 and 22 bp for genotype CC; 166, 144, and 22 bp for genotype CT and 166 bp for genotype TT (Fig. 2b). Compared with C allele, the frequency of T allele was predominant in NY, JX and QC breeds. In CRS breed, the frequencies of the two alleles were almost flat and the heterozygote genotype (CT) showed a high prevalence with the frequency of 0.645. All the five breeds possessed intermediate polymorphism (0.25 b PIC b 0.5). At the SV4 locus, digestion of the 197 bp PCR fragment with HindIII resulted in fragment length of 171 and 26 bp for genotype GG; 197, 171 and 26 bp for genotype GT and 197 bp for genotype TT (Fig. 2c). The mutant allele T frequencies were obviously higher than the G allele
Fig. 2. The electrophoresis patterns of PCR-RFLP analysis at four SNPs in bovine APOA2 gene. Note: a, PCR products digestion with PuvII demonstrate three genotypes (AA, AC and CC); b, PCR products digestion with Bmgt120I demonstrate three genotypes (CC, CT and TT); c, PCR products digestion with HindIII demonstrate three genotypes (GG, GT and TT); PCR products digestion with HaeIII demonstrate three genotypes (AA, AG and GG).
Y. Zhou et al. / Gene 531 (2013) 288–293
291
Fig. 3. The distribution of the haplotypes across four SNPs in four cattle breeds. Note: JX, Jiaxian cattle; QC, Qinchuan cattle; NY, Nanyang cattle; CRS: Chinese Red Steppe cattle.
frequencies in all the breeds. No heterozygote genotype (GT) was detected in JX and NY breed. CRS breed possessed intermediate polymorphism (0.25 b PIC b 0.5) and other three breeds possessed low polymorphism (0 b PIC b 0.25). At the SV6 locus, digestion of the 314 bp PCR fragment with HaeIII resulted in fragment length of 288 and 26 bp for genotype GG; 314, 288 and 26 bp for genotype AG and 314 bp for genotype AA (Fig. 2d). The mutant allele G frequencies were obviously higher than the C allele frequencies in all the breeds. Frequency of genotype CC was the lowest among the three genotypes and no genotype CC was found in CRS breed. JX breed possessed intermediate polymorphism (0.25 b PIC b 0.5) and other three breeds possessed low polymorphism (0 b PIC b 0.25). 3.3. Haplotype analysis of the four loci in five cattle breeds Haplotype analysis of four SVs showed that 10 different haplotypes: 6 in JX, 8 in QC, 7 in NY and 7 in CRS were identified in all the test animals (Fig. 3). There were 5 haplotypes (Hap1, Hap2, Hap3, Hap4 and Hap5) were shared by all the four populations. In breeding, it is important to consider the consistency with native environment for different climates in different regions. The general trends of the 5 haplotypes distributed in the four cattle breeds were the same. Hap1 (-ATTG-) was shared by the four breeds and predominant in JX, QC, NY and CRS cattle breeds with the percentages of 0.386, 0.535, 0.531 and 0.275 respectively. This means that Hap1 has been existed for a long time and is more adapted for the steppe environment (Huang et al., 2011). Other four common haplotypes (Hap2, Hap3, Hap4 and Hap5) were evenly distributed in different cattle breeds with frequencies about 0.1. However, the four cattle breeds were different in other haplotypes. Hap6 was not detected in CRS breed. Hap7 was just shared by NY and CRS breeds. JX and NY breeds were conservative with none unique haplotype of their own whereas two unique haplotypes (Hap8 and Hap9) were detected in QC breed and one haplotypes (Hap10) was detected in CRS breed. The discrepancy in different populations was probably caused by a smaller bovine sample size and
a different selection history. However, Hap 10 did not meet the regular that the frequency of common haplotype will have a high value and unique haplotype will get a low frequency. It took one fifth of all the haplotypes in CRS cows. Rarer variants represent more recent mutations (Zhou et al., 2012). So Hap10 is one of the original haplotypes in CRS breed and this implicated that the CRS breed may be different from other three cattle breeds. The analysis of genotype distribution and genetic diversity also provided evidence for this conjecture. The CRS breed is reared for dual-purpose (meat and milk) and lives in the north of China while other three cattle breeds are only for table purpose and the living places of the four breeds spread from east to west in the middle of China. So this might be caused by the different directions of origin and application between the CRS breeds and other breeds and (or) (ii) the different selection pressure in different environment. 3.4. Association analysis in NY and QC breeds As for human, −265 T N C promoter polymorphism (rs5082) of the APOA2 gene associated with food consumption and obesity has been replicated in multiple cohorts (Corella et al., 2007; Corella et al., 2009; Corella et al., 2010). The APOA2 gene was recognized as a candidate gene for obesity which may influence the performance of animals. In this study, we screened the bovine APOA2 gene and its promoter region, but we did not find a mutation in the same site. We compared the promoter region (−2000 to 0) of the bovine APOA2 gene with that of the human and the mouse APOA2 gene. The results showed the promoter regions of the APOA2 gene in different species were in a low similarity. To figure out the associations of the four SVs with the body traits of NY and QC breeds, we first conducted association analysis between single markers and growth traits. The results were shown in Tables 3 and 4. In the NY cattle association analysis, genotype CC in the SV1, SV3 and SV6, and genotype GT in the SV4 were excluded due to the small number (b 10). Of the four SVs, three SVs (SV3, SV4 and SV6) were detected having significant association with growth traits. For the SV3 locus,
Table 3 Association between genotypes at the APOA2 gene and body traits in Nanyang cattle. Body traits
SV3#
P value
TT BL12(cm) HG12(cm) HW12(cm) BL18(cm) HG18(cm) BW24(kg) BH24(cm) HW24(cm)
116.27 140.98 21.11 130.69 157.80 371.22 126.33 25.34
CT ± ± ± ± ± ± ± ±
0.88 0.99 0.23a 0.94a 1.09A 5.33 0.58 0.32
116.85 141.60 20.18 126.30 151.05 164.37 126.37 25.05
SV4#
P value
TT ± ± ± ± ± ± ± ±
1.70 1.98 0.26b 1.16b 1.29B 7.84 1.00 0.49
0.747 0.762 0.010 0.012 0.001 0.503 0.972 0.647
116.08 140.45 20.76 129.84 156.77 370.13 126.19 25.31
GG ± ± ± ± ± ± ± ±
0.86a 0.93b 0.20 0.84 0.94 4.83 0.53 0.28
120.69 144.63 20.81 127.94 152.63 360.75 125.81 25.00
SV6#
P value
GG ± ± ± ± ± ± ± ±
1.63a 1.29a 0.34 1.31 1.89 9.51 0.95 0.52
0.023 0.048 0.907 0.318 0.063 0.404 0.752 0.630
116.40 140.79 20.83 129.96 156.92 356.19 125.04 25.58
CG ± ± ± ± ± ± ± ±
0.98 1.14 0.24 1.01 1.06 5.05b 0.60b 0.30A
116.82 142.12 20.82 129.18 155.41 379.19 128.71 23.94
± ± ± ± ± ± ± ±
1.74 1.75 0.30 1.23 1.91 9.02a 0.89a 0.50B
0.835 0.554 0.997 0.682 0.486 0.027 0.002 0.008
Values with different superscripts within the same line differ significantly at P b 0.05 (a, b) or P b 0.01(A, B). # Only one contrast was estimated for the low frequency of the genotype CC in theSV3 and SV6, and genotype GT in the SV4. BL12: body length at 12 months; HG12: heart girth at 12 months; HW12: hucklebone width at 12 months; BL18: body length at 18 months; HG18: heart girth at 18 months; BW24: body weight at 24 months; BH24: body height; HW24: hucklebone width at 24 months.
292
Y. Zhou et al. / Gene 531 (2013) 288–293
Table 4 Association between genotypes at the APOA2 gene and growth traits in Qingchuan cattle. Body traits
SV1
P value
CC CW24(cm)# HW24(cm)# BH24(cm)# HG24(cm)# BW24(kg)#
35.71 22.71 128.33 171.08 381.92
AA ± ± ± ± ±
1.04 1.05a 1.72 3.10 21.06
SV3
AC
37.66 22.78 128.64 176.70 398.57
± ± ± ± ±
0.41 0.37a 0.51 0.94 6.06
35.77 20.74 129.91 175.17 390.64
P value
TT ± ± ± ± ±
0.67 0.53b 0.76 1.54 9.36
P P P P P
= = = = =
0.320 0.019 0.411 0.146 0.597
37.95 23.07 129.30 177.60 404.66
CC ± ± ± ± ±
0.45a 0.43 a 0.57 1.14 7.25
33.75 21.44 124.37 169.13 343.87
CT ± ± ± ± ±
0.84b 1.16 1.66 2.30 15.20
36.13 21.08 129.04 174.14 387.92
± ± ± ± ±
0.51 0.38b 0.63 1.10 6.91
P P P P P
= = = = =
0.020 0.040 0.340 0.015 0.015
Values with different superscripts within the same line differ significantly at P b 0.05 (a, b). # CW24: chest width at 24 months; HW24: hucklebone width at 24 months; BH24: body height at 24 months; HG24: heart girth at 24 months; BW24: body weight.
significant differences of hucklebone width at 12 months, body length at 18 months and heart girth at 18 months (P b 0.05 or P b 0.01) were observed between cattle with genotype TT and CT. Cattle with genotype TT appeared to be superior in the three body traits than individuals with genotype CT. At the SV4 locus, cows with genotype GG had significantly greater body length and hucklebone width at 12 months (P b 0.05) than those with genotype TT, which implied that the G might be associated with body length and hucklebone width at 12 months. At the SV6 locus, significant differences of body weight, body height and hucklebone width at 24 months (P b 0.05 or P b 0.01) were observed between cattle with genotype GG and CG. Cows with genotype CG appeared to be superior in the body weight and body height at 24 months than individuals with genotype GG, while cows with genotype GG got a higher value of hucklebone width at 24 months than the cows with genotype CG. In the QC cattle association analysis, two SVs (SV1 and SV3) were detected having significant association with body traits. For the SV1 locus, hucklebone width of the cows with genotype AA was significantly wider than the cows with genotype AC. As for the SV3 locus, hucklebone width TT was significantly wider than the cows with genotype CT; chest width, heart girth and body weight (P b 0.05 or P b 0.01) were observed significantly different between the cattle with genotype CC and TT, and the cows with genotype TT appeared to be superior than the cows with genotype CC in the three body traits. Association analysis between single markers and growth traits is an essential way to value the effects of a gene in breeding. However, integrating the haplotype combinations and the single analysis with traits will be more efficient and reliable to value the effects of genetic variations of a gene (Akey et al., 2001; Schaid, 2004). We then examined the combined effects of the four loci on the body traits in the two breeds. A total of 9 haplotype combinations in NY breed and 9 haplotype combinations in QC breed were use in the association analysis. In NY cows, the 9 haplotype combinations were significantly association with hucklebone width at 6 months (P b 0.01) and body height at 24 months (P b 0.05) (Table 5). Cows with haplotype combinations of
Table 5 Association analysis for the referring haplotype combinations with growth traits in Nanyang breeds. Combined genotypes
Body traits HW6(cm)#
AATTGGGG AACTTTGG AACTTTCG ACTTTTCG AATTTTGG ACTTTTGG ACCTTTGG AATTTTGT AATTGGCG P-value
BH24(cm)# Aa
19.88 ± 0.52 19.33 ± 0.67ABab 18.83 ± 0.44ABCabcd 18.50 ± 0.50ABCabcd 18.50 ± 0.28ABCbcd 17.94 ± 0.20ABCbcd 17.75 ± 0.25ABCbcd 17.17 ± 0.60BCd 16.50 ± 0.00C P = 0.007
125.25 ± 1.89Aabc 121.33 ± 3.33Bc 128.00 ± 3.06Aab 129.50 ± 2.50Aab 125.33 ± 0.99Abc 123.13 ± 1.22Ac 129.50 ± 1.50Aab 130.67 ± 1.76a 130.50 ± 1.50Bab P = 0.038
Values with different superscripts within the same line differ significantly at P b 0.05 (a, b) or P b 0.01(A, B). # HW16: hucklebone width at 6 months; BH24: body height.
-AA-TT-GG-GG- possessed the widest hucklebone width at 6 months, while cows with haplotype combinations of -AA-TT-TT-GT- which was with a smaller hucklebone width possessed the highest body height at 24 months. In QC breed, no significant association was observed between the 9 haplotype combinations with body traits (data not shown). 4. Conclusions Our study was the first one to detect six SVs in the bovine APOA2 gene and its promoter region. We then analyzed the genetic diversity and haplotype distribution of four SVs in four cattle breeds which revealed that the cows with allele A, T, T and G were extremely predominant in all test populations and were more adapted to the steppe environment. In addition, an association analysis of 4 SVs and 9 haplotype combinations with body traits in NY and QC breeds was also established in this study. This data strongly suggested that the bovine APOA2 gene polymorphisms might be used as genetic makers in cattle breeding. Conflict of interest None. Acknowledgements This study was supported by the National Natural Science Foundation of China (Grant No. 31272408), National 863 Program of China (Grant No. 2013AA102505), Agricultural Science and Technology Innovation Projects of Shaanxi Province (No. 2012NKC01-13), and Program of National Beef Cattle Industrial Technology System (CARS-38). References Akey, J., Jin, L., Xiong, M., 2001. Haplotypes vs single marker linkage disequilibrium tests: what do we gain? Eur. J. Hum. Genet. 9, 291–300. Allayee, H., Castellani, L.W., Cantor, R.M., de Bruin, T.W., Lusis, A.J., 2003. Biochemical and genetic association of plasma apolipoprotein A-II levels with familial combined hyperlipidemia. Circ. Res. 92, 1262–1267. Blanco-Vaca, F., Martín-Campos, J.M., Julve, J., 2001. Role of apoA-II in lipid metabolism and atherosclerosis: advances in the study of an enigmatic protein. J. Lipid Res. 42, 1727–1739. Boucher, J., Ramsamy, T.A., Braschi, S., Sahoo, D., Neville, T.A., Sparks, D.L., 2004. Apolipoprotein A-II regulates HDL stability and affects hepatic lipase association and activity. J. Lipid Res. 45, 849–858. Corella, D., et al., 2007. The −256 T N C polymorphism in the apolipoprotein A-II gene promoter is associated with body mass index and food intake in the genetics of lipid lowering drugs and diet network study. Clin. Chem. 53, 1144–1152. Corella, D., et al., 2009. APOA2, dietary fat and body mass index: replication of a gene–diet interaction in three independent populations. Arch. Intern. Med. 169, 1897. Corella, D., et al., 2010. Association between the APOA2 promoter polymorphism and body weight in Mediterranean and Asian populations: replication of a gene–saturated fat interaction. Int. J. Obes. 35, 666–675. Dugué-Pujol, S., et al., 2007. Apolipoprotein A-II is catabolized in the kidney as a function of its plasma concentration. J. Lipid Res. 48, 2151–2161. Huang, Y.Z., et al., 2011. Haplotype combination of SREBP-1c gene sequence variants is associated with growth traits in cattle. Genome 54, 507–516. Huang, Y.-Z., et al., 2012. Haplotype distribution in the b i N GLI3b/i N gene and their associations with growth traits in cattle. Gene 513, 141–146. Kalopissis, A.-D., Pastier, D., Chambaz, J., 2003. Apolipoprotein A-II: beyond genetic associations with lipid disorders and insulin resistance. Curr. Opin. Lipidol. 14, 165–172.
Y. Zhou et al. / Gene 531 (2013) 288–293 Konsta, D., Guillaume, C., Michel, M., Jean, T., 2009. Evaluating the association of common APOA2 variants with type 2 diabetes. Mehta, R., Gantz, D.L., Gursky, O., 2003. Human plasma high-density lipoproteins are stabilized by kinetic factors. J. Mol. Biol. 328, 183–192. Nei, M., Roychoudhury, A., 1974. Sampling variances of heterozygosity and genetic distance. Genetics 76, 379. Nofer, J.-R., Kehrel, B., Fobker, M., Levkau, B., Assmann, G., Eckardstein, A.v., 2002. HDL and arteriosclerosis: beyond reverse cholesterol transport. Atherosclerosis 161, 1–16. Rotllan, N., Ribas, V., Calpe-Berdiel, L., Martín-Campos, J.M., Blanco-Vaca, F., 2005. Overexpression of human apolipoprotein A-II in transgenic mice does not impair macrophage-specific reverse cholesterol transport in vivo. Arterioscler. Thromb. Vasc. Biol. 25, E128–E132. Sambrook, J., Russell, David William, 2001. Molecular Cloning: A Laboratory Manual. 3 Cold Spring Harbor Laboratory Press, New York 49–56.
293
Schaid, D.J., 2004. Evaluating associations of haplotypes with traits. Genet. Epidemiol. 27, 348–364. Shan, L., et al., 2011. The polymorphisms of bovine PCSK1 gene and their associations with growth traits. Genes Genomics 33, 57–63. van't Hooft, F.M., Ruotolo, G., Boquist, S., de Faire, U., Eggertsen, G., Hamsten, A., 2001. Human evidence that the apolipoprotein A-II gene is implicated in visceral fat accumulation and metabolism of triglyceride-rich lipoproteins. Circulation 104, 1223–1228. Xue, J., et al., 2013. Haplotypes and effects on growth traits of bovine b i N Wnt7ab/i N gene in Chinese Qinchuan cattle. Gene 524, 241–245. Yong, Y., Lin, H., 2005. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 15, 97–98. Zhou, Y., et al., 2012. Exploring polymorphisms and potential application roles of the bovine Nfix gene in breeding. Genome 55, 845–851.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle Yang Zhou, Caixia Li, Hanfang Cai, Yao Xu, Xianyong Lan, Chuzhao Lei, Hong Chen ⁎ College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Agricultural Molecular Biology, Yangling, Shaanxi 712100, China
a r t i c l e
i n f o
Article history: Accepted 24 August 2013 Available online 1 September 2013 Keywords: Apoa2 gene Association Bovine Haplotype Body traits
a b s t r a c t Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P b 0.05 or P b 0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. © 2013 Elsevier B.V. All rights reserved.
1. Introduction High-density lipoprotein (HDL) is an important component of serum proteins and plays a crucial role in reverse cholesterol transport and lipid metabolism (Nofer et al., 2002). Apolipoprotein A-II (APOA2) is the second major HDL constituents and regulates HDL structure and stability (Boucher et al., 2004). It displaces Apolipoprotein A-I (APOA1) from HDL, accelerates APOA1 catabolism, and decreases its plasma concentration by fasting (Kalopissis et al., 2003; Mehta et al., 2003). The catabolism of APOA2 determines plasma HDL levels and its existence in HDL is an important signal for specific interaction with HDL receptors such as cubilin or heat shock protein 60 (Blanco-Vaca et al., 2001; Dugué-Pujol et al., 2007). Those studies revealed that APOA2 was a key regulatory factor of HDL metabolism and affected lipid metabolism. In human, APOA2 was recognized as a positional and biological candidate gene for type 2 diabetes at the chromosome 1q21-q24 susceptibility locus (Konsta et al., 2009). However, type 2 diabetes was mainly caused by obesity and high-calorie diets which will lead to obesity. So the APOA2 gene may have a relationship with body weight and other Abbreviations: APOA2, Apolipoprotein A-II; HDL, high-density lipoprotein; APOA1, apolipoprotein A-I; SVs, sequence variants; JX, Jiaxian cattle; QC, Qinchuan cattle; CRS, Chinese Red Steppe cattle; NY, Nanyang cattle; UTR, untranslated regions. ⁎ Corresponding author at: No.22 Xinong Road, College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China. Tel.: +86 29 87092004; fax: + 86 29 87092164. E-mail address: [email protected] (H. Chen). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.08.081
body traits related to obesity. Corella and his colleagues' study showed that the −265 T N C promoter polymorphism (rs5082) in the human APOA2 gene is consistently associated with food consumption and obesity (Corella et al., 2007). Overexpressing APOA2 in mouse exhibit hypertriglyceridemia and increased body fat, whereas APOA2-null mouse decreased triglycerides (Allayee et al., 2003). In humans, the APOA2 gene is implicated in visceral fat accumulation and metabolism of triglyceride-rich lipoproteins (van't Hooft et al., 2001). Therefore the APOA2 gene plays a critical role in lipid metabolism and obesity. However, overexpression of human APOA2 in transgenic mice does not increase their susceptibility to obesity (Rotllan et al., 2005). The comparison of transgenic mice overexpressing human or murine APOA2 suggested that the two proteins have opposite effects on HDL size, APOA1 content, plasma concentration, and protection from oxidation (Kalopissis et al., 2003). This means APOA2 may be regulated variously but reveals a common function in different animals. In cattle, few studies of the bovine APOA2 gene have been reported. The function and the molecular mechanisms of it are unknown. However, all those studies in human and mouse showed that APOA2 could be considered as a candidate gene for growth traits in other animals. To date, only few polymorphisms have been reported of the bovine APOA2 gene and no association analysis has been detected. So the purpose of this study was to detect sequence variants (SVs) in the bovine APOA2 gene and to carry out haplotypes construction and association analysis, so as to contribute to the understanding of the role APOA2 in variation of growth traits in cattle, which will possibly contribute to animal breeding and genetics.
Y. Zhou et al. / Gene 531 (2013) 288–293 Table 1 Primer information for mutation discovery and genotyping in the APOA2 gene. a
Sequence of primiers
Name E1
E2/SV1 E3 SV2 SV3 SV4
F: CCAGACCCATACGAACC R: GAGGCGACTAGAGCCTAA F: TTTCTTAGGCTCTAGTCGC R: CTTGGCTCCCTTGTTCT F: CTCCTCCAAAGTCCTTATCACC R: GCAGGCTCACAACTTAACTCC
Position
R: TTTCTGGGCTTTAGAGAGGGGA A G F: CCTTGAAGGTGGGTGTGA
nt -2035 to -2019 nt -998 to -981 nt -1002 to -984 nt 81 to 97 nt-80 to -59 nt 1249 to 1269 nt 282 to 305 nt 425 to 447 nt 188 to 205 nt 361 to 384 nt 254 to 271
R: CAGGCTCTGCAGATTCGACTCC
nt 546 to 567
F: AA TCCCAAGGAGGAGAAGGTGG CC R: ATTCAGCCTCAGCTCTCAGCCCT F: CACTTTCCCTGCCGTTAA
c
SAFb (bp)
AT (°C)
1055
54
1099
56
1349
55
166
57
197
56
314
55
a
E1, E2/SV1 and E3 were for mutation discovery, E2/SV1, SV2, SV4 and SV5 were for genotyping; b Size of amplification fragment. c Annealing temperature; Nucleotides in the box substituted the naturally occurring “GG” to avoid restriction endonuclease recognition sites and “C”, “T” to introduce restriction endonuclease recognition sites.
289
(UTR), 3′ UTR and partial promoter region (-2035 to 0) were designed for PCR amplification (Table 1). To detect mutations, DNA pools were used as templates and constructed with 80–100 individual genomic samples randomly chosen from each cattle breed, respectively. PCR was performed in 25 μL of reaction volume containing 50 ng genomic DNA, 1 μmol/L of each primer, 1 × buffer (including 1.5 mmol/L MgCl2), 200 μmol/L dNTPs, and 2.5 U of Taq DNA polymerase (MBI Fermentas). PCR reactions were carried out using a PCR System Thermal Cycler Dice (TaKaRa, Dalian, China). The PCR regimen was as follows: initial denaturation for 5 min at 95 °C; followed by 35 cycles of 95 °C for 30 s; annealing at prescribed annealing temperature (AT) (Table 1) for 35 s; and primer extension at 72 °C for 1 min 20 s. The final extension was performed at 72 °C for 10 min. PCR products were directly sequenced using an ABI 3730xl DNA sequencer (Applied Biosystems, Foster City, California) and a BigDye terminator sequencing kit (Shanghai Sangon Biotech Co., Ltd., P.R. China). Sequencing results were analyzed by BioXM (Ver. 2.6) software to search mutations. 2.3. Genotyping
2. Materials and methods 2.1. Animals Genomic DNA samples were obtained from blood samples via standard methods (Sambrook and Russell, 2001). In this study, 1021 cows including four Chinese indigenous breeds: Jiaxian cattle (JX, n = 415); Qinchuan cattle (QC, n = 246); Chinese Red Steppe cattle (CRS, n = 135); Nanyang cattle (NY, n = 225). All these cows represent the main breeds of China and are reared in the provinces of Henan, Shaanxi, Jilin and Henan, respectively. After weaning at 6 months age, they were fed at libitum on concentrated feed and straw to 24 months of age. Growth traits of 225 NY cows were recorded at birth (body weight) and after 6, 12, 18 and 24 months (body weight, body height, body length, heart girth, hucklebone width and average daily gain). Growth traits of 246 QC cows were recorded at 24 months (body weight, body height, body length, heart girth, chest width, height at hip across and hucklebone width). 2.2. PCR amplification and sequencing Primers used to amplify the bovine APOA2 gene were designed based on NCBI database (GenBank accession number: AC_000160.1). Four primers pairs covering all exons, introns, 5′ untranslated regions
Six new PCR primers were redesigned to facilitate genotyping of three sequence variants: sequence variant3 (SV3), sequence variant4 (SV4), sequence variant6 (SV6). The detail information about primers was given in Table 1. The SV1, SV3, SV4 and SV6 of the bovine APOA2 gene were genotyped by means of PCR–RFLP method. Aliquots of 7 μL PCR products were digested with 10 U PvuII for SV1, Bmgt120I for SV3, HindIII for SV4 and HaeIII for SV6 for 10 h at 37 °C. The digested products were detected by electrophoresis for about 2 h on a 2.5% agarose gel stained with ethidium bromide. After the polymorphism was detected, the PCR products of different electrophoresis patterns were sent to sequence in both directions. 2.4. Statistical analysis Genotypic and allelic frequencies were directly calculated. Ho (gene homozygosity), He (gene heterozygosity), Ne (effective allele numbers), and PIC (polymorphism information content) were calculated according to Nei's methods, respectively (Nei and Roychoudhury, 1974). SHEsis software was used to perform the haplotype analysis (Yong and Lin, 2005). The SPSS software (Version 16.0) was used to evaluate the relationship between genotypes of each SVs or combined haplotypes and growth traits in NY and QC population (Shan et al., 2011). The 225 cows of NY breed or the 246 cows of QC breed came from several common ancestors and the pedigree of core breeding population animals were traced back
Fig. 1. DNA pool sequencing maps of the six SNPs in bovine APOA2 gene. Note: The SNP positions are shown according to GenBank No. AC_000160.1.
290
Y. Zhou et al. / Gene 531 (2013) 288–293
Table 2 Genetic diversity of four loci of the APOA2 gene in four Chinese cattle breeds. Genotypic frequency
Allelic frequency
SV
Breed
AA
CC
AC
A
C
Ho
Ne
PIC
SV1
JX QC NY CY
0.187 0.195 0.204 0.091 T 0.699 0.780 0.818 0.519 T 0.828 0.854 0.843 0.620 G 0.773 0.877 0.881 0.889
0.579 0.657 0.702 0.501
1.727 1.522 1.424 1.997
0.332 0.284 0.253 0.375
JX QC NY CY
0.813 0.805 0.796 0.909 C 0.301 0.220 0.182 0.481 G 0.172 0.146 0.157 0.380 C 0.227 0.123 0.119 0.111
0.258 0.265 0.272 0.152
SV4
0.330 0.228 0.353 0.183 CT 0.432 0.349 0.339 0.645 GT 0.000 0.040 0.000 0.108 CG 0.283 0.186 0.187 0.222
1.436 1.458 1.480 1.199
JX QC NY CY
0.022 0.081 0.027 0.000 TT 0.483 0.606 0.648 0.196 TT 0.828 0.834 0.843 0.566 GG 0.632 0.784 0.787 0.778
0.696 0.686 0.675 0.834
SV3
0.648 0.691 0.620 0.817 CC 0.085 0.046 0.012 0.159 GG 0.172 0.126 0.157 0.325 CC 0.085 0.030 0.026 0.000
0.715 0.751 0.736 0.529
1.399 1.332 1.359 1.890
0.245 0.218 0.229 0.360
0.649 0.784 0.790 0.802
1.540 1.276 1.266 1.246
0.289 0.193 0.188 0.178
SV6
JX QC NY CY
JX, Jiaxian cattle (n = 415); QC, Qinchuan cattle (n = 246); NY, Nanyang cattle (n = 225); CRS: Chinese Red Steppe cattle (n = 135).
three generations. The following linear model was used in NY breed analysis: Yij = μ + Ai + Gj + eij where Yij is the trait measured on each of the ijth animal; μ is the overall population mean; Ai is the fixed effect due to the ith age; Gj is the fixed effect associated with jth genotype; and eij is the random error (Huang et al., 2012). In the QC cattle analysis, we used another model: Yi = μ + Gi + ei where Yi is the trait measured on each of the ith animal,μis the overall population mean, Gj is the fixed effect associated with jth genotype, and ei is the random error (Xue et al., 2013). 3. Results and discussion 3.1. Sequence variants identified in the bovine APOA2 gene The bovine APOA2 gene locates on chromosome 3 contains 3 exons and encodes 100 amino acids. In order to better understand the detail
variation of the bovine Apoa2 gene, all exons, introns, 5′ UTR, 3′ UTR and partial promoter region (−2035 to 0) were screened. Six novel mutations were identified (Fig. 1). Compared with previous reported aequence (GenBank accession number: AC_000160.1), g. −652A N C was in promoter region, g.247 T N A (exon1) and g.540A N G (exon2) was in coding region, g.306C N T (intron1), g.360 T N G (intron 1) and g.424G N C (intron1) were in the introns. Both the mutation g.247 T N A and g.540A N G were the synonymous mutation p.Ile13Ile and p.Gln24Gln. For convenience, the six mutations were named: sequence variant1 (SV1), sequence variant2 (SV2), sequence variant3 (SV3), sequence variant4 (SV4) sequence variant5 (SV5) and sequence variant6 (SV6), respectively. 3.2. Genotype distribution and genetic diversity In this study, four loci (SV1, SV3, SV4 and SV6) of the bovine APOA2 gene were genotyped for the low mutation frequencies of the SV2 and SV5 loci. The genotypic frequencies, allelic frequencies and genetic indices (Ho, He, Ne, and PIC) of the four loci in four Chinese cattle populations were shown in Table 2. At the SV1 locus, digestion of the 1099 bp PCR fragment with PvuII resulted in fragment lengths of 747 and 352 bp for genotype AA; 1099, 747 and 352 bp for genotype AC and 1099 bp for genotype CC (Fig. 2a). The mutant allele A frequencies were obviously higher than the C allele frequencies in all the four breeds. In CRS breed, no CC genotype was found. CRS breed possessed low polymorphism (0 b PIC b 0.25) and other three breeds possessed intermediate polymorphism (0.25 b PIC b 0.5). At the SV3 locus, digestion of the 166 bp PCR fragment with Bmgt120I resulted in fragment lengths of 144 and 22 bp for genotype CC; 166, 144, and 22 bp for genotype CT and 166 bp for genotype TT (Fig. 2b). Compared with C allele, the frequency of T allele was predominant in NY, JX and QC breeds. In CRS breed, the frequencies of the two alleles were almost flat and the heterozygote genotype (CT) showed a high prevalence with the frequency of 0.645. All the five breeds possessed intermediate polymorphism (0.25 b PIC b 0.5). At the SV4 locus, digestion of the 197 bp PCR fragment with HindIII resulted in fragment length of 171 and 26 bp for genotype GG; 197, 171 and 26 bp for genotype GT and 197 bp for genotype TT (Fig. 2c). The mutant allele T frequencies were obviously higher than the G allele
Fig. 2. The electrophoresis patterns of PCR-RFLP analysis at four SNPs in bovine APOA2 gene. Note: a, PCR products digestion with PuvII demonstrate three genotypes (AA, AC and CC); b, PCR products digestion with Bmgt120I demonstrate three genotypes (CC, CT and TT); c, PCR products digestion with HindIII demonstrate three genotypes (GG, GT and TT); PCR products digestion with HaeIII demonstrate three genotypes (AA, AG and GG).
Y. Zhou et al. / Gene 531 (2013) 288–293
291
Fig. 3. The distribution of the haplotypes across four SNPs in four cattle breeds. Note: JX, Jiaxian cattle; QC, Qinchuan cattle; NY, Nanyang cattle; CRS: Chinese Red Steppe cattle.
frequencies in all the breeds. No heterozygote genotype (GT) was detected in JX and NY breed. CRS breed possessed intermediate polymorphism (0.25 b PIC b 0.5) and other three breeds possessed low polymorphism (0 b PIC b 0.25). At the SV6 locus, digestion of the 314 bp PCR fragment with HaeIII resulted in fragment length of 288 and 26 bp for genotype GG; 314, 288 and 26 bp for genotype AG and 314 bp for genotype AA (Fig. 2d). The mutant allele G frequencies were obviously higher than the C allele frequencies in all the breeds. Frequency of genotype CC was the lowest among the three genotypes and no genotype CC was found in CRS breed. JX breed possessed intermediate polymorphism (0.25 b PIC b 0.5) and other three breeds possessed low polymorphism (0 b PIC b 0.25). 3.3. Haplotype analysis of the four loci in five cattle breeds Haplotype analysis of four SVs showed that 10 different haplotypes: 6 in JX, 8 in QC, 7 in NY and 7 in CRS were identified in all the test animals (Fig. 3). There were 5 haplotypes (Hap1, Hap2, Hap3, Hap4 and Hap5) were shared by all the four populations. In breeding, it is important to consider the consistency with native environment for different climates in different regions. The general trends of the 5 haplotypes distributed in the four cattle breeds were the same. Hap1 (-ATTG-) was shared by the four breeds and predominant in JX, QC, NY and CRS cattle breeds with the percentages of 0.386, 0.535, 0.531 and 0.275 respectively. This means that Hap1 has been existed for a long time and is more adapted for the steppe environment (Huang et al., 2011). Other four common haplotypes (Hap2, Hap3, Hap4 and Hap5) were evenly distributed in different cattle breeds with frequencies about 0.1. However, the four cattle breeds were different in other haplotypes. Hap6 was not detected in CRS breed. Hap7 was just shared by NY and CRS breeds. JX and NY breeds were conservative with none unique haplotype of their own whereas two unique haplotypes (Hap8 and Hap9) were detected in QC breed and one haplotypes (Hap10) was detected in CRS breed. The discrepancy in different populations was probably caused by a smaller bovine sample size and
a different selection history. However, Hap 10 did not meet the regular that the frequency of common haplotype will have a high value and unique haplotype will get a low frequency. It took one fifth of all the haplotypes in CRS cows. Rarer variants represent more recent mutations (Zhou et al., 2012). So Hap10 is one of the original haplotypes in CRS breed and this implicated that the CRS breed may be different from other three cattle breeds. The analysis of genotype distribution and genetic diversity also provided evidence for this conjecture. The CRS breed is reared for dual-purpose (meat and milk) and lives in the north of China while other three cattle breeds are only for table purpose and the living places of the four breeds spread from east to west in the middle of China. So this might be caused by the different directions of origin and application between the CRS breeds and other breeds and (or) (ii) the different selection pressure in different environment. 3.4. Association analysis in NY and QC breeds As for human, −265 T N C promoter polymorphism (rs5082) of the APOA2 gene associated with food consumption and obesity has been replicated in multiple cohorts (Corella et al., 2007; Corella et al., 2009; Corella et al., 2010). The APOA2 gene was recognized as a candidate gene for obesity which may influence the performance of animals. In this study, we screened the bovine APOA2 gene and its promoter region, but we did not find a mutation in the same site. We compared the promoter region (−2000 to 0) of the bovine APOA2 gene with that of the human and the mouse APOA2 gene. The results showed the promoter regions of the APOA2 gene in different species were in a low similarity. To figure out the associations of the four SVs with the body traits of NY and QC breeds, we first conducted association analysis between single markers and growth traits. The results were shown in Tables 3 and 4. In the NY cattle association analysis, genotype CC in the SV1, SV3 and SV6, and genotype GT in the SV4 were excluded due to the small number (b 10). Of the four SVs, three SVs (SV3, SV4 and SV6) were detected having significant association with growth traits. For the SV3 locus,
Table 3 Association between genotypes at the APOA2 gene and body traits in Nanyang cattle. Body traits
SV3#
P value
TT BL12(cm) HG12(cm) HW12(cm) BL18(cm) HG18(cm) BW24(kg) BH24(cm) HW24(cm)
116.27 140.98 21.11 130.69 157.80 371.22 126.33 25.34
CT ± ± ± ± ± ± ± ±
0.88 0.99 0.23a 0.94a 1.09A 5.33 0.58 0.32
116.85 141.60 20.18 126.30 151.05 164.37 126.37 25.05
SV4#
P value
TT ± ± ± ± ± ± ± ±
1.70 1.98 0.26b 1.16b 1.29B 7.84 1.00 0.49
0.747 0.762 0.010 0.012 0.001 0.503 0.972 0.647
116.08 140.45 20.76 129.84 156.77 370.13 126.19 25.31
GG ± ± ± ± ± ± ± ±
0.86a 0.93b 0.20 0.84 0.94 4.83 0.53 0.28
120.69 144.63 20.81 127.94 152.63 360.75 125.81 25.00
SV6#
P value
GG ± ± ± ± ± ± ± ±
1.63a 1.29a 0.34 1.31 1.89 9.51 0.95 0.52
0.023 0.048 0.907 0.318 0.063 0.404 0.752 0.630
116.40 140.79 20.83 129.96 156.92 356.19 125.04 25.58
CG ± ± ± ± ± ± ± ±
0.98 1.14 0.24 1.01 1.06 5.05b 0.60b 0.30A
116.82 142.12 20.82 129.18 155.41 379.19 128.71 23.94
± ± ± ± ± ± ± ±
1.74 1.75 0.30 1.23 1.91 9.02a 0.89a 0.50B
0.835 0.554 0.997 0.682 0.486 0.027 0.002 0.008
Values with different superscripts within the same line differ significantly at P b 0.05 (a, b) or P b 0.01(A, B). # Only one contrast was estimated for the low frequency of the genotype CC in theSV3 and SV6, and genotype GT in the SV4. BL12: body length at 12 months; HG12: heart girth at 12 months; HW12: hucklebone width at 12 months; BL18: body length at 18 months; HG18: heart girth at 18 months; BW24: body weight at 24 months; BH24: body height; HW24: hucklebone width at 24 months.
292
Y. Zhou et al. / Gene 531 (2013) 288–293
Table 4 Association between genotypes at the APOA2 gene and growth traits in Qingchuan cattle. Body traits
SV1
P value
CC CW24(cm)# HW24(cm)# BH24(cm)# HG24(cm)# BW24(kg)#
35.71 22.71 128.33 171.08 381.92
AA ± ± ± ± ±
1.04 1.05a 1.72 3.10 21.06
SV3
AC
37.66 22.78 128.64 176.70 398.57
± ± ± ± ±
0.41 0.37a 0.51 0.94 6.06
35.77 20.74 129.91 175.17 390.64
P value
TT ± ± ± ± ±
0.67 0.53b 0.76 1.54 9.36
P P P P P
= = = = =
0.320 0.019 0.411 0.146 0.597
37.95 23.07 129.30 177.60 404.66
CC ± ± ± ± ±
0.45a 0.43 a 0.57 1.14 7.25
33.75 21.44 124.37 169.13 343.87
CT ± ± ± ± ±
0.84b 1.16 1.66 2.30 15.20
36.13 21.08 129.04 174.14 387.92
± ± ± ± ±
0.51 0.38b 0.63 1.10 6.91
P P P P P
= = = = =
0.020 0.040 0.340 0.015 0.015
Values with different superscripts within the same line differ significantly at P b 0.05 (a, b). # CW24: chest width at 24 months; HW24: hucklebone width at 24 months; BH24: body height at 24 months; HG24: heart girth at 24 months; BW24: body weight.
significant differences of hucklebone width at 12 months, body length at 18 months and heart girth at 18 months (P b 0.05 or P b 0.01) were observed between cattle with genotype TT and CT. Cattle with genotype TT appeared to be superior in the three body traits than individuals with genotype CT. At the SV4 locus, cows with genotype GG had significantly greater body length and hucklebone width at 12 months (P b 0.05) than those with genotype TT, which implied that the G might be associated with body length and hucklebone width at 12 months. At the SV6 locus, significant differences of body weight, body height and hucklebone width at 24 months (P b 0.05 or P b 0.01) were observed between cattle with genotype GG and CG. Cows with genotype CG appeared to be superior in the body weight and body height at 24 months than individuals with genotype GG, while cows with genotype GG got a higher value of hucklebone width at 24 months than the cows with genotype CG. In the QC cattle association analysis, two SVs (SV1 and SV3) were detected having significant association with body traits. For the SV1 locus, hucklebone width of the cows with genotype AA was significantly wider than the cows with genotype AC. As for the SV3 locus, hucklebone width TT was significantly wider than the cows with genotype CT; chest width, heart girth and body weight (P b 0.05 or P b 0.01) were observed significantly different between the cattle with genotype CC and TT, and the cows with genotype TT appeared to be superior than the cows with genotype CC in the three body traits. Association analysis between single markers and growth traits is an essential way to value the effects of a gene in breeding. However, integrating the haplotype combinations and the single analysis with traits will be more efficient and reliable to value the effects of genetic variations of a gene (Akey et al., 2001; Schaid, 2004). We then examined the combined effects of the four loci on the body traits in the two breeds. A total of 9 haplotype combinations in NY breed and 9 haplotype combinations in QC breed were use in the association analysis. In NY cows, the 9 haplotype combinations were significantly association with hucklebone width at 6 months (P b 0.01) and body height at 24 months (P b 0.05) (Table 5). Cows with haplotype combinations of
Table 5 Association analysis for the referring haplotype combinations with growth traits in Nanyang breeds. Combined genotypes
Body traits HW6(cm)#
AATTGGGG AACTTTGG AACTTTCG ACTTTTCG AATTTTGG ACTTTTGG ACCTTTGG AATTTTGT AATTGGCG P-value
BH24(cm)# Aa
19.88 ± 0.52 19.33 ± 0.67ABab 18.83 ± 0.44ABCabcd 18.50 ± 0.50ABCabcd 18.50 ± 0.28ABCbcd 17.94 ± 0.20ABCbcd 17.75 ± 0.25ABCbcd 17.17 ± 0.60BCd 16.50 ± 0.00C P = 0.007
125.25 ± 1.89Aabc 121.33 ± 3.33Bc 128.00 ± 3.06Aab 129.50 ± 2.50Aab 125.33 ± 0.99Abc 123.13 ± 1.22Ac 129.50 ± 1.50Aab 130.67 ± 1.76a 130.50 ± 1.50Bab P = 0.038
Values with different superscripts within the same line differ significantly at P b 0.05 (a, b) or P b 0.01(A, B). # HW16: hucklebone width at 6 months; BH24: body height.
-AA-TT-GG-GG- possessed the widest hucklebone width at 6 months, while cows with haplotype combinations of -AA-TT-TT-GT- which was with a smaller hucklebone width possessed the highest body height at 24 months. In QC breed, no significant association was observed between the 9 haplotype combinations with body traits (data not shown). 4. Conclusions Our study was the first one to detect six SVs in the bovine APOA2 gene and its promoter region. We then analyzed the genetic diversity and haplotype distribution of four SVs in four cattle breeds which revealed that the cows with allele A, T, T and G were extremely predominant in all test populations and were more adapted to the steppe environment. In addition, an association analysis of 4 SVs and 9 haplotype combinations with body traits in NY and QC breeds was also established in this study. This data strongly suggested that the bovine APOA2 gene polymorphisms might be used as genetic makers in cattle breeding. Conflict of interest None. Acknowledgements This study was supported by the National Natural Science Foundation of China (Grant No. 31272408), National 863 Program of China (Grant No. 2013AA102505), Agricultural Science and Technology Innovation Projects of Shaanxi Province (No. 2012NKC01-13), and Program of National Beef Cattle Industrial Technology System (CARS-38). References Akey, J., Jin, L., Xiong, M., 2001. Haplotypes vs single marker linkage disequilibrium tests: what do we gain? Eur. J. Hum. Genet. 9, 291–300. Allayee, H., Castellani, L.W., Cantor, R.M., de Bruin, T.W., Lusis, A.J., 2003. Biochemical and genetic association of plasma apolipoprotein A-II levels with familial combined hyperlipidemia. Circ. Res. 92, 1262–1267. Blanco-Vaca, F., Martín-Campos, J.M., Julve, J., 2001. Role of apoA-II in lipid metabolism and atherosclerosis: advances in the study of an enigmatic protein. J. Lipid Res. 42, 1727–1739. Boucher, J., Ramsamy, T.A., Braschi, S., Sahoo, D., Neville, T.A., Sparks, D.L., 2004. Apolipoprotein A-II regulates HDL stability and affects hepatic lipase association and activity. J. Lipid Res. 45, 849–858. Corella, D., et al., 2007. The −256 T N C polymorphism in the apolipoprotein A-II gene promoter is associated with body mass index and food intake in the genetics of lipid lowering drugs and diet network study. Clin. Chem. 53, 1144–1152. Corella, D., et al., 2009. APOA2, dietary fat and body mass index: replication of a gene–diet interaction in three independent populations. Arch. Intern. Med. 169, 1897. Corella, D., et al., 2010. Association between the APOA2 promoter polymorphism and body weight in Mediterranean and Asian populations: replication of a gene–saturated fat interaction. Int. J. Obes. 35, 666–675. Dugué-Pujol, S., et al., 2007. Apolipoprotein A-II is catabolized in the kidney as a function of its plasma concentration. J. Lipid Res. 48, 2151–2161. Huang, Y.Z., et al., 2011. Haplotype combination of SREBP-1c gene sequence variants is associated with growth traits in cattle. Genome 54, 507–516. Huang, Y.-Z., et al., 2012. Haplotype distribution in the b i N GLI3b/i N gene and their associations with growth traits in cattle. Gene 513, 141–146. Kalopissis, A.-D., Pastier, D., Chambaz, J., 2003. Apolipoprotein A-II: beyond genetic associations with lipid disorders and insulin resistance. Curr. Opin. Lipidol. 14, 165–172.
Y. Zhou et al. / Gene 531 (2013) 288–293 Konsta, D., Guillaume, C., Michel, M., Jean, T., 2009. Evaluating the association of common APOA2 variants with type 2 diabetes. Mehta, R., Gantz, D.L., Gursky, O., 2003. Human plasma high-density lipoproteins are stabilized by kinetic factors. J. Mol. Biol. 328, 183–192. Nei, M., Roychoudhury, A., 1974. Sampling variances of heterozygosity and genetic distance. Genetics 76, 379. Nofer, J.-R., Kehrel, B., Fobker, M., Levkau, B., Assmann, G., Eckardstein, A.v., 2002. HDL and arteriosclerosis: beyond reverse cholesterol transport. Atherosclerosis 161, 1–16. Rotllan, N., Ribas, V., Calpe-Berdiel, L., Martín-Campos, J.M., Blanco-Vaca, F., 2005. Overexpression of human apolipoprotein A-II in transgenic mice does not impair macrophage-specific reverse cholesterol transport in vivo. Arterioscler. Thromb. Vasc. Biol. 25, E128–E132. Sambrook, J., Russell, David William, 2001. Molecular Cloning: A Laboratory Manual. 3 Cold Spring Harbor Laboratory Press, New York 49–56.
293
Schaid, D.J., 2004. Evaluating associations of haplotypes with traits. Genet. Epidemiol. 27, 348–364. Shan, L., et al., 2011. The polymorphisms of bovine PCSK1 gene and their associations with growth traits. Genes Genomics 33, 57–63. van't Hooft, F.M., Ruotolo, G., Boquist, S., de Faire, U., Eggertsen, G., Hamsten, A., 2001. Human evidence that the apolipoprotein A-II gene is implicated in visceral fat accumulation and metabolism of triglyceride-rich lipoproteins. Circulation 104, 1223–1228. Xue, J., et al., 2013. Haplotypes and effects on growth traits of bovine b i N Wnt7ab/i N gene in Chinese Qinchuan cattle. Gene 524, 241–245. Yong, Y., Lin, H., 2005. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 15, 97–98. Zhou, Y., et al., 2012. Exploring polymorphisms and potential application roles of the bovine Nfix gene in breeding. Genome 55, 845–851.