- Email: [email protected]
NRF-2 transcription factor is essential in promoting human Tomm70 gene expression
Mitochondrion 3 (2004) 251–259 www.elsevier.com/locate/mito
NRF-2 transcription factor is essential in promoting human Tomm70 gene expression Jose´ R. Blesa, Jose´ M. Herna´ndez, Jose´ Herna´ndez-Yago* Fundacio´n Valenciana de Investigaciones Biome´dicas, Instituto de Investigaciones Citolo´gicas, Amadeo de Saboya, 4, 46010 Valencia, Spain Received 3 June 2003; received in revised form 7 November 2003; accepted 13 November 2003
Abstract TOMM70 is a subunit of the outer mitochondrial membrane translocase that plays a major role as a receptor of hydrophobic pre-proteins targeted to the mitochondria. We report the presence of two nuclear respiratory factor 2 (NRF-2) binding motifs in the 50 -flanking region of the human Tomm70 gene and establish their essential role for promoter activity by using reporter assays in HeLa cells. We show that both NRF-2 binding sites are functional and present evidence that interactions between these sites and a CpG island contribute to expression. Mobility shift assays show that these NRF-2 sites are specifically recognized by NRF-2 present in HeLa nuclear extracts. q 2004 Elsevier B.V. and Mitochondria Research Society. All rights reserved. Keywords: Human Tomm70 gene; NRF-2 transcription factor; Mitochondrial protein transport
1. Introduction The biogenesis of mitochondria requires the expression of a large number of genes, most of which reside in the nuclear genome. Mitochondrial proteins encoded by these nuclear genes are synthesized as cytosolic precursors with mitochondrial targeting signals. Translocation of these mitochondrial pre-proteins is mediated by translocases in the outer (TOMM) and inner membranes (TIMM). Studies in fungi have elucidated most of the components and mechanisms involved in this process (reviewed in Pfanner and Geissler, 2001). Cytosolic * Corresponding author. Tel.: þ 34-963391250; fax: þ 34963601453. E-mail address: [email protected] (J. Herna´ndez-Yago).
precursors of mitochondrial proteins initially bind to mitochondrial receptors TOMM20 or TOMM70 (van Wilpe et al., 1999). In particular, TOMM70 plays a major role as a receptor of hydrophobic pre-proteins with several internal signals, such as the carrier proteins (Komiya et al., 1997, 1998). In the last few years, many putative homologues of the components of the fungal mitochondrial protein import machinery have been identified in mammals (Bauer et al., 1999) including the human homologue of fungal TOMM70 (Alvarez-Dolado et al., 1999). It has been proposed that nuclear regulatory factors play an important role in governing nucleo-mitochondrial interactions. Two classes of nuclear transcriptional regulators implicated in mitochondrial biogenesis have emerged in recent years. The first includes DNA-binding transcription factors, typified
1567-7249/$20.00 q 2004 Elsevier B.V. and Mitochondria Research Society. All rights reserved. doi:10.1016/j.mito.2004.02.001
252
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
by nuclear respiratory factor 1 (NRF-1), nuclear respiratory factor 2 (NRF-2) and others, which act on known nuclear genes that specify mitochondrial functions (reviewed in Scarpulla, 2002). The NRFs promote the expression of genes encoding respiratory subunits as well as key components of the mtDNA transcription and replication machinery. NRFs and associated regulatory proteins may thus serve to integrate nuclear and mitochondrial genetic systems to accommodate cellular demands for respiratory energy. A second, more recently defined class, includes nuclear co-activators typified by PGC-1 and related family members (PRC and PGC-1b) (reviewed in Scarpulla, 2002). The interplay of these nuclear factors appears to be a major determinant in regulating the biogenesis of mitochondria. Studies carried out by our group led to the characterization of the human homologue gene of Tomm20 and identified a perfect consensus motif for the binding site of the NRF-2 in the 50 -flanking region of this gene (Hernandez et al., 1999). In this paper, we report the presence of two NRF-2 motifs in the 50 flanking region of the Tomm70 gene and provide evidence for their role as transcription factors which are involved in the regulation of the gene. Furthermore, our results suggest that the presence of a CpG island at the promoter region might be determinant in obtaining maximal promoter activity.
2. Materials and methods
No. AC015462). Genomic DNA was isolated from the peripheral blood lymphocytes of a healthy volunteer using phenol – chloroform purification (Tilzer et al., 1989). Two oligonucleotides, 2 1286T70 (ACACTCGAGTCTACTGTGATGTT GTTGCAC, which corresponds to positions 2 1286 to 2 1266 with an additional sequence at its 50 -end introducing an Xho I site for cloning purposes) and T70rev þ 10 (ACAAAGCTTGGG AAGGAAAGCAATGAGC, which corresponds to positions 2 9 to þ 10 with an additional sequence at its 50 -end introducing an Hind III site for cloning purposes), were used to amplify a region of 1296 bp spanning from 2 1286 to þ 10 bp of the promoter region of the hTomm70 gene. The oligonucleotides have flanking restriction sites for Xho I and Hind III enzymes for directional cloning purposes. The PCR included one cycle of denaturation at 94 8C for 2 min followed by 35 cycles of 30 s at 94 8C, 30 s at 59 8C and 2 min 40 s at 73 8C, with a final extension at 73 8C for 5 min. The Pfu DNA polymerase System (Promega) was used in the PCR. PCR product was gel-purified, digested with Xho I and Hind III and cloned into a promoterless luciferase reporter vector, pGL3-Basic (Promega, Madison, WI) previously digested with the same enzymes. This construct was designated pGL3-T70p. Cloned fragment was verified by direct sequencing and then analyzed using GCG (Genetics Computer Group, Madison, WI) and TRANSFAC (Heinemeyer et al., 1999).
2.1. Materials 2.3. Generation of luciferase reporter constructs HeLa S3 cell line was obtained from the American Type Culture Collection (Manassas, VA); fetal bovine serum (FBS) was obtained from Sigma; media and other products for cell culture were purchased from Life Technologies; oligonucleotides were synthesized by Sigma-Genosys; the sources of various kits and reagents used for molecular biological methods are indicated in the appropriate context. 2.2. Cloning of the 5 0 -flanking region of the human Tomm70 gene The 50 -upstream region of the human Tomm70 gene was obtained from the GenBank (Accession
Deletion of specific regions of the cloned 50 sequence was carried out by PCR (using pGL3T70p as a template) and subcloning in pGL3-Basic vector. The oligonucleotides were specifically designed with the flanking restriction sites for Xho I and Hind III enzymes for directional cloning purposes (Table 1). Plasmids used in transfection experiments were purified using Wizard Plus MaxiPreps Kit (Promega, Madison, WI), and purity was assessed by A260/A280 and agarose gel electrophoresis. Orientation and sequence was verified by direct sequencing in all constructs.
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
253
Table 1 Oligonucleotides used to generate the constructs of hTomm70 promoter Name
Size (bp)
Forward
Reverse
T70p p1 p2 PN PNA pDN1 pDN2 pDN3 p3 p4
1296 794 302 199 124 66 77 93 123 615
ACACTCGAGTCTACTGTGATGTTGTTGCAC ACACTCGAGACCACGCTCAAACCGTTTC ACACTCGAGCCCTTCTTTCCTGAAGGTAG ACACTCGAGCGAAGACTCCTACTCACACC ACACTCGAGATACTGGAGGAGAAGGACG ACACTCGAGTCTGGCCCTTTTCTGTCGTC ACACTCGAGATACTGGAGGAGAAGGACG ACACTCGAGCGAAGACTCCTACTCACACC ACACTCGAGCCCTTCTTTCCTGAAGGTAG ACACTCGAGACCACGCTCAAACCGTTTC
ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGACGACAGAAAAGGGCCAGAG ACAAAGCTTCGTCCTTCTCCTCCAGTATC ACAAAGCTTGGGTGTGAGTAGGAGTCTTC ACAAAGCTTGGGTGTGAGTAGGAGTCTTC
The underlined nucleotides indicate the recognition sequences for restriction enzymes, Xho I and Hind III in forward and reverse oligonucleotides, respectively. The double underlined nucleotides are included to facilitate the digestion with restriction enzymes.
2.4. Transfection of HeLa S3 cells with luciferase reporter constructs HeLa S3 cells were cultured in Dulbecco’s MEM (D-MEM, high glucose (4500 mg/l D -glucose) with L -glutamine and phenol red) supplemented with 0.1 mM non-essential amino acids (NEAAs) and 10% FBS. Cell cultures were maintained at 37 8C with 5% CO2. The day before transfection, cells were plated onto 24-well tissue culture dishes at a density that allowed the cells to reach 80 – 90% confluence by the time of transfection. Transfections were done with LipofectAMINE PLUS reagent (Life Technologies, Inc.), following manufacturer’s protocol. Each transfection was done using 0.8 mg of luciferase reporter construct DNA and 8 ng of an internal control plasmid pRL-TK (Promega). Four hours after transfection, 1 ml of D-MEM with 0.1 mM NEAA and 13% FBS was added, and the plates were returned to the incubator. At 24 h post-transfection, medium was removed and wells were rinsed with phosphate-buffered saline to detach cells and residual growth medium. Then 100 ml of 1 £ passive lysis buffer, provided in the Dual-Luciferase Reporter Assay System (Promega), were added per well and plates were rocked at room temperature for 15 min. Samples were transferred to 1.5-ml microcentrifuge tubes and assayed for luciferase activity without further manipulation. Firefly and Renilla luciferase activities were sequentially measured using the Dual-Luciferase Reporter Assay System (Promega) following
manufacturer’s instructions. Luciferase activities were determined using a Berthold model Orion Luminometer, with a 2-s pre-delay followed by a 1-s measuring period. The Renilla luciferase activity, expressed from HSV-TK promoter, provided an internal control to monitor transfection efficiency. Firefly luciferase activities were normalized based on the Renilla luciferase activity in each well. Microsoftw Excel 2000 was used for the statistical analysis of the results. 2.5. Labeling of oligonucleotides with digoxigenin Synthetic oligonucleotides encompassing the putative NRF-2A and NRF-2B sequences of the promoter region of the human Tomm70 gene as well as oligonucleotides in which these sequences had been mutated were purchased from Sigma-Genosys (Texas, USA) as single-stranded oligonucleotides. Complementary forward and reverse oligonucleotides were denatured 10 min at 95 8C and placed at room temperature for 30 min to generate doublestranded oligonucleotides (listed in Table 2). Doublestranded oligonucleotides to be used as probes were labeled with digoxigenin using the DIG Oligonucleotide 30 -end Labeling Kit (Roche) following manufacturer’s protocol. Briefly, a reaction was set up in a final volume of 20 ml in 1 £ reaction buffer (0.2 M potassium cacodylate, 25 mM Tris– HCl, 0.25 mg/ml BSA (pH 6.6) at 25 8C) containing 17.5 pmol of double-stranded oligonucleotide, 5 mM CoCl 2, 0.05 mM digoxigenin-ddUTP and 2.5 U of terminal
254
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
Table 2 Oligonucleotides used in EMSAs Name
Sequence
NRF-2A
50 -GCATGCCCTGGGCTTCCGGTGACCTCTGGC-30 30 -CGTACGGGACCCGAAGGCCACTGGAGACCG-50
immunodetected with anti-digoxigenin and visualized with the chemiluminescent substrate disodium 3-(4methoxyspiro {l,2-dioxethane-3,20 -(50 -chloro)tricyclo [3.3.1.13,7]decan}-4-yl)phenyl phosphate (CSPD) (DIG Luminescent Detection Kit, Roche) followed by X-ray film exposure (Kodak).
NRF-2Amut 50 -GCATGCCCTGGGCTAGAGGTGACCTCTGGC-30 30 -CGTACGGGACCCGATCTCCACTGGAGACCG-50 NRF-2B
50 -TTTCCCTTAACCCGGAAGTGATTTCCGCCC-30 30 -AAAGGGAATTGGGCCTTCACTAAAGGCGGG-50
NRF-2Bmut 50 -TTTCCCTTAACCCTCTAGTGATTTCCGCCC-30 30 -AAAGGGAATTGGGAGATCACTAAAGGCGGG-50
Consensus sequences for NRF-2 binding are shown underlined (only coding strand). Nucleotides in bold indicate introduced point mutations.
transferase and incubated 15 min at 37 8C. The reaction was stopped with 2 ml of 0.2 M EDTA (pH 8.0). 2.6. Electrophoretic mobility shift assays Electrophoretic mobility shift assays (EMSAs) were performed as follows: 11.2 mg of HeLa nuclear protein (HeLaScribew Nuclear Extract, Promega, Madison, WI, USA) were incubated with or without competitor double-stranded oligonucleotides in 1 £ binding buffer (4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris – HCl (pH 7.5), 0.05 mg/ml polydI-dC·polydI-dC, Promega) for 10 min at room temperature. Digoxigenin-labeled NRF-2A or NRF-2B probes were added to the binding reactions and incubated for 20 min at room temperature. For ‘supershift’ analysis, 1 ml of rabbit serum against NRF-2a (gift from Dr Scarpulla) or control serum against an unrelated protein was added to the reaction mixture and incubated for 1 h at room temperature. Samples were loaded into a 6% polyacrilamide (40:1, acrilamide:bisacrilamide), 0.5 £ TBE gel and electrophoresed at 150 V, 4 8C for 25 min in 0.5 £ TBE buffer. Electrophoretic transfer to a nitrocellulose membrane (Hybonde-N þ , Amersham) was carried out under high intensity field (80 V, 500 mA) for 1 h at 4 8C in 0.5 £ TBE, followed by crosslinking under UV light. Digoxigenin-labeled probes were
3. Results 3.1. Sequence analysis of the 5 0 -flanking region of the human Tomm70 gene Analysis of the 1.3-kb of the 50 -flanking region of the hTomm70 gene cloned into pGL3-T70p revealed the lack of consensus TATA and CCAAT promoter boxes although a variety of potential binding sites for several transcription factors were detected. The most apparent was the presence of a perfect consensus sequence (ACCGGAAGNS) for the binding site of the NRF-2 (Virbasius and Scarpulla, 1990), at 2 70 to 2 61 bp (designated as NRF-2A); a second NRF-2 motif—with a single base modification relative to the consensus sequence—is located at 2 124 to 2 115 bp (designated as NRF-2B) (Fig. 1). Moreover, the analysis of a 1.8-kb region including, in addition to the 1.3-kb of the 50 -flanking region of the gene, the exon 1 and the beginning of the first intron, shows the presence of two typical CpG islands, the first one located between positions 2 973 and 2 765 of the promoter region and the second one between positions 2 40 and þ 380 bp (i.e. mainly encompassing exon 1). 3.2. Functional characterization of the human Tomm70 promoter region To identify the critical element(s) required for promoter activity, firefly luciferase reporter constructs containing several regions of the 50 -flanking region were transfected into HeLa S3 cells. Results shown (Fig. 2) represent firefly luciferase activity normalized on the basis of the control Renilla luciferase activity. The highest activity was detected with the construct pN containing the two NRF-2 sites. Reporter assays with the pNA construct, with a deletion of a 76-bp region containing the NRF-2B site, show 50% of the activity of the pN construct;
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
255
Fig. 1. Nucleotide sequence of the 50 -flanking region of the human Tomm70 gene. Underlined indicates the two CpG islands; boldface regions indicate the putative NRF-2 sites; the thymine in boldface corresponds to the transcriptional start site, numbered as position þ 1. The translational start codon at position þ 92 is indicated in boldface. The arrows indicate the orientation of the consensus sequences.
additional deletion of a 58-bp region containing the NRF-2A (pDN1) abolished the activity indicating that the main promoter region of hTomm70 is localized within a 134-bp (2 189 to 2 56) region containing the two NRF-2 sites. This observation implies that both regions, each including an NRF-2, contribute in a similar way to the activity of the promoter. In contrast, the assays with constructs containing either NRF-2A (pDN2) or NRF-2B (pDN3) alone, show that the promoter activities are lower than expected and that pDN3 (NRF-2B-site containing) has 2-fold the activity of pDN2 (NRF2A-site containing) indicating the importance of
the presence of the 27-bp (2 56 to þ 10) downstream region. Interestingly, this region corresponds to a fragment of the CpG island found in the proximal region of the gene. Moreover, constructs with upstream sequences of the 134-bp region, i.e. without the NRF-2 sites (p3 and p4 constructs) showed no activity, reinforcing the idea that the promoter of the hTomm70 lies within this region. The activities of p2, p1 and pT70p constructs containing additional upstream sequences (Fig. 2) are, respectively, 1.1, 1.9 and 4.2-fold less than that of the 199-bp fragment (pN), suggesting that negative elements are located upstream of this region.
256
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
Fig. 2. Functional analysis of the promoter elements of the human Tomm70 gene. Left, schematic illustration of the various promoter-deletion— luciferase-reporter constructs. The open rectangular box indicates the 50 -flanking region of the human Tomm70 gene. The name of each construct is shown on the left. The numbers indicate the position of nucleotides. Vertical bars show the relative positions of the indicated DNA sequence motifs. Right, Firefly luciferase activities expressed in HeLa S3 cells transfected with the reporter constructs have been normalized on the basis of Renilla luciferase activity encoded by the co-transfected control plasmid, pRL-TK. Results are the mean ^ SD of at least six samples from two independent transfection experiments. tsp, transcriptional start site; LUC, luciferase gene reporter.
3.3. EMSA experiments show the binding of a protein to the NRF-2 binding sites in the promoter region of Tomm70 gene Electrophoretic mobility shift assays were run to determine the binding of nuclear proteins to the putative NRF-2 sites located at the promoter region of the human Tomm70 gene. Digoxigenin-labeled oligonucleotides encompassing NRF-2A and NRF-2B putative binding sites incubated with HeLa nuclear proteins generated a major band shift in the absence of competitor, suggesting the binding of nuclear protein(s) to the probes in both cases (Fig. 3A and B, lane 2). To determine the specificity of the band shifts binding reactions were pre-incubated with increasing concentrations of unlabeled normal and mutated competitors. NRF-2A and NRF-2B oligonucleotides were able to completely inhibit the binding of the labeled probe even at the lowest concentration of
10 £ (Fig. 3A and B, lane 3). In contrast, inhibition of binding with mutated NRF-2A and NRF-2B (NRF2Amut and NRF-2Bmut) was very weak even at concentrations of 100 £ (Fig. 3A and B, lane 9). In addition, shift assays using antibodies against NRF2a subunit show supershifted bands in both NRF-2A and NRF-2B sites that were absent with control serum (Fig. 4A and B). These results strongly support the specific binding of NRF-2 to the NRF-2A and NRF-2B sites in the promoter region of the human Tomm70 gene.
4. Discussion We have cloned and sequenced a 1296-bp human genomic DNA fragment corresponding to the 2 1286 to þ 10 region of the gene encoding human Tomm70. The analysis of the proximal promoter region of this
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
257
Fig. 3. EMSAs with HeLa nuclear extract. (A) Using digoxigeninlabeled NRF-2A with (lanes 2–10) or without (lane 1, negative control) nuclear extract and increasing concentrations (10-, 25-, 100- and 300-fold molar concentrations) of unlabeled normal (NRF2A, lanes 3– 6) or mutated (NRF-2Amut, lanes 7–10) competitor. (B) Identical experiment using digoxigenin-labeled NRF-2B as a probe and unlabeled normal (NRF-2B, lanes 3–6) and mutated (NRF-2Bmut, lanes 3–6) oligonucleotides as competitors. Arrows ( ! ) indicate the position of the predominant shifted bands.
gene shows the absence of canonical TATA and CCAAT elements and the presence of two consensus sequences for the NRF-2 transcription factor. It is well established that fungal TOMM70 plays a key role in mitochondrial biogenesis as a major receptor for mitochondrial import of such hydrophobic pre-proteins as the carrier proteins. Interestingly, other nuclear encoded mitochondrial proteins, which are also involved in mitochondrial biogenesis, share features similar to those reported here for the proximal promoter region of the human Tomm70 gene (i.e. absence of TATA and CCAAT boxes, presence of a CpG island and putative binding sites for NRFs) (Scarpulla, 2002). Our analysis of the 50 -flanking region of other genes encoding different
Fig. 4. Antibody supershift analysis of NRF-2 binding to the Tomm70 promoter. (A) Digoxigenin-labeled NRF-2A probe incubated with (lanes 2–4) or without (lane 1, negative control) nuclear extract and post-incubated with 1 ml of antiserum to NRF2a subunit (lane 3) or control antiserum (lane 4). (B) Identical experiment using digoxigenin-labeled NRF-2B probe. Main shifted complexes are indicated with brackets. Arrows ( ! ) indicate the position of the supershifted bands.
subunits of the human TOMM and TIMM complexes extends this similarity to Tomm20 (Hernandez et al., 1999) as well as to Tomm34, Timm8b, Timm13b and Timm23 (data not shown). Our functional studies with the reporter gene using different constructs of the promoter region of hTomm70 reveal that the shortest construct of those
258
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
that contain the two NRF-2 sites yields the highest promoter activity (pN construct). Deletion of 75 bp of the 50 region of pN construct to remove the NRF-2B site (pNA construct) resulted in a ca. 50% loss of activity. Deletion of an additional 58-bp fragment that included the site for NRF-2A (pDN1 construct) basically abolished promoter activity. These observations strongly suggest that the two NRF-2 motifs are involved in the activity of the hTomm70 promoter and that they work in an additive manner. This conclusion is reinforced by the fact that both sites bind NRF-2, as demonstrated by mobility shift and supershift assays, and this binding is specific as shown by using mutated NRF-2 sites as competitors. A similar pattern of two supershifted bands has been already shown when using antiserum for NRF-2a (Imaki et al., 2003). Nevertheless, we have observed a significant decrease in activity when these NRF-2 binding sites are alone in separate constructs (pDN2 and pDN3). The presence of a fragment of the CpG island immediately downstream from these sites dramatically increases the activity of the promoter. A possible explanation is that this fragment of the CpG island is facilitating the access of the NRF-2 to its binding sites at the promoter as previously described (Murray and Grosveld, 1987). However, since the tsp is part of the CpG island, further approaches are required to discriminate between the activity of the CpG island and the presence of the tsp. In addition, an increase in the length of the pN construct was concomitant with a progressive decrease of the promoter activity, suggesting that the presence of upstream inhibitory regions should not be discounted. In summary, we have characterized the promoter region of the human Tomm70 gene, establishing the essential role of NRF-2 transcription factor and the importance of a CpG island for an effective activity of the promoter. This is the first report demonstrating the importance of an NRF transcription factor for the activity of the promoter of a protein involved in the mitochondrial protein import process. Indeed, our results support the idea that participation of NRF transcription factors in the coordination of nuclear and mitochondrial genetic systems is not limited to the subunits of the respiratory chain (Virbasius
and Scarpulla, 1990) but include important subunits of the mitochondrial protein import machinery such as Tomm70.
Acknowledgements We thank Eloisa Barber for her technical assistance and Dr R.C. Scarpulla for antiserum to NRF-2a. Dr J.R. Blesa was an associate researcher of the Fundacio´n Valenciana de Investigaciones Biome´dicas (FVIB). Dr J.M. Herna´ndez was a postdoctoral fellow of FVIB. This research was supported by a grant of the United Mitochondrial Disease Foundation, the Fondo de Investigacio´n Sanitaria (FIS PI021345) and the Escola Valenciana D’Estudis per a la Salut Pu´blica (EVES/Conselleria de Sanitat, Generalitat Valenciana).
References Alvarez-Dolado, M., Gonzalez-Moreno, M., Valencia, A., Zenke, M., Bernal, J., Mun˜oz, A., 1999. Identification of a mammalian homologue of the fungal Tom70 mitochondrial precursor protein import receptor as a thyroid hormone-regulated gene in specific brain regions. J. Neurochem. 73, 2240–2249. Bauer, M.F., Gempel, K., Reichert, A.S., Rappold, G.A., Lichtner, P., Gerbitz, K.D., et al., 1999. Genetic and structural characterization of the human mitochondrial inner membrane translocase. J. Mol. Biol. 28, 69–82. Heinemeyer, T., Chen, X., Karas, H., Kel, A.E., Kel, O.V., Liebich, I., et al., 1999. Expanding the TRANSFAC database towards an expert system of regulatory molecular mechanisms. Nucleic Acids Res. 27, 318–322. Hernandez, J.M., Giner, P., Hernandez-Yago, J., 1999. Gene structure of the human mitochondrial outer membrane receptor Tom20 and evolutionary study of its family of processed pseudogenes. Gene 239, 283–291. Imaki, H., Nakayama, K., Delehouzee, S., Handa, H., Kitagawa, M., Kamura, T., Nakayama, K.I., 2003. Cell cycle-dependent regulation of the Skp2 promoter by GA-binding protein. Cancer Res. 63, 4607–4613. Komiya, T., Rospert, S., Schatz, G., Mihara, K., 1997. Binding of mitochondrial precursor proteins to the cytoplasmic domains of the import receptors Tom70 and Tom20 is determined by cytoplasmic chaperones. Eur. Mol. Biol. Org. J. 16, 4267–4275. Komiya, T., Rospert, S., Koehler, C., Looser, R., Schatz, G., Mihara, K., 1998. Interaction of mitochondrial targeting signals with acidic receptor domains along the protein import pathway: evidence for the ‘acid chain’ hypothesis. Eur. Mol. Biol. Org. J. 17, 3886–3898.
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259 Murray, E.J., Grosveld, F., 1987. Site specific demethylation in the promoter of human gamma-globin gene does not alleviate methylation mediated suppression. Eur. Mol. Biol. Org. J. 6, 2329–2335. Pfanner, N., Geissler, A., 2001. Versatility of the mitochondrial protein import machinery. Nat. Rev. Mol. Cell Biol. 5, 339–349.Review. Scarpulla, R., 2002. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim. Biophys. Acta 1576, 1 –14.
259
Tilzer, L.L., Thomas, S.M., Moreno, R.F., 1989. Use of silica gel polymer for DNA extraction with organic solvents. Anal. Biochem. 183, 13– 15. Virbasius, J.V., Scarpulla, R.C., 1990. The rat cytochrome c oxidase subunit IV gene family: tissue-specific and hormonal differences in subunit IV and cytochrome c mRNA expression. Nucleic Acids Res. 18, 6581–6586. van Wilpe, S., Ryan, M.T., Hill, K., Maarse, A.C., Meisinger, C., Brix, J., et al., 1999. Tom22 is a multifunctional organizer of the mitochondrial preprotein translocase. Nature 401, 485 –489.
NRF-2 transcription factor is essential in promoting human Tomm70 gene expression Jose´ R. Blesa, Jose´ M. Herna´ndez, Jose´ Herna´ndez-Yago* Fundacio´n Valenciana de Investigaciones Biome´dicas, Instituto de Investigaciones Citolo´gicas, Amadeo de Saboya, 4, 46010 Valencia, Spain Received 3 June 2003; received in revised form 7 November 2003; accepted 13 November 2003
Abstract TOMM70 is a subunit of the outer mitochondrial membrane translocase that plays a major role as a receptor of hydrophobic pre-proteins targeted to the mitochondria. We report the presence of two nuclear respiratory factor 2 (NRF-2) binding motifs in the 50 -flanking region of the human Tomm70 gene and establish their essential role for promoter activity by using reporter assays in HeLa cells. We show that both NRF-2 binding sites are functional and present evidence that interactions between these sites and a CpG island contribute to expression. Mobility shift assays show that these NRF-2 sites are specifically recognized by NRF-2 present in HeLa nuclear extracts. q 2004 Elsevier B.V. and Mitochondria Research Society. All rights reserved. Keywords: Human Tomm70 gene; NRF-2 transcription factor; Mitochondrial protein transport
1. Introduction The biogenesis of mitochondria requires the expression of a large number of genes, most of which reside in the nuclear genome. Mitochondrial proteins encoded by these nuclear genes are synthesized as cytosolic precursors with mitochondrial targeting signals. Translocation of these mitochondrial pre-proteins is mediated by translocases in the outer (TOMM) and inner membranes (TIMM). Studies in fungi have elucidated most of the components and mechanisms involved in this process (reviewed in Pfanner and Geissler, 2001). Cytosolic * Corresponding author. Tel.: þ 34-963391250; fax: þ 34963601453. E-mail address: [email protected] (J. Herna´ndez-Yago).
precursors of mitochondrial proteins initially bind to mitochondrial receptors TOMM20 or TOMM70 (van Wilpe et al., 1999). In particular, TOMM70 plays a major role as a receptor of hydrophobic pre-proteins with several internal signals, such as the carrier proteins (Komiya et al., 1997, 1998). In the last few years, many putative homologues of the components of the fungal mitochondrial protein import machinery have been identified in mammals (Bauer et al., 1999) including the human homologue of fungal TOMM70 (Alvarez-Dolado et al., 1999). It has been proposed that nuclear regulatory factors play an important role in governing nucleo-mitochondrial interactions. Two classes of nuclear transcriptional regulators implicated in mitochondrial biogenesis have emerged in recent years. The first includes DNA-binding transcription factors, typified
1567-7249/$20.00 q 2004 Elsevier B.V. and Mitochondria Research Society. All rights reserved. doi:10.1016/j.mito.2004.02.001
252
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
by nuclear respiratory factor 1 (NRF-1), nuclear respiratory factor 2 (NRF-2) and others, which act on known nuclear genes that specify mitochondrial functions (reviewed in Scarpulla, 2002). The NRFs promote the expression of genes encoding respiratory subunits as well as key components of the mtDNA transcription and replication machinery. NRFs and associated regulatory proteins may thus serve to integrate nuclear and mitochondrial genetic systems to accommodate cellular demands for respiratory energy. A second, more recently defined class, includes nuclear co-activators typified by PGC-1 and related family members (PRC and PGC-1b) (reviewed in Scarpulla, 2002). The interplay of these nuclear factors appears to be a major determinant in regulating the biogenesis of mitochondria. Studies carried out by our group led to the characterization of the human homologue gene of Tomm20 and identified a perfect consensus motif for the binding site of the NRF-2 in the 50 -flanking region of this gene (Hernandez et al., 1999). In this paper, we report the presence of two NRF-2 motifs in the 50 flanking region of the Tomm70 gene and provide evidence for their role as transcription factors which are involved in the regulation of the gene. Furthermore, our results suggest that the presence of a CpG island at the promoter region might be determinant in obtaining maximal promoter activity.
2. Materials and methods
No. AC015462). Genomic DNA was isolated from the peripheral blood lymphocytes of a healthy volunteer using phenol – chloroform purification (Tilzer et al., 1989). Two oligonucleotides, 2 1286T70 (ACACTCGAGTCTACTGTGATGTT GTTGCAC, which corresponds to positions 2 1286 to 2 1266 with an additional sequence at its 50 -end introducing an Xho I site for cloning purposes) and T70rev þ 10 (ACAAAGCTTGGG AAGGAAAGCAATGAGC, which corresponds to positions 2 9 to þ 10 with an additional sequence at its 50 -end introducing an Hind III site for cloning purposes), were used to amplify a region of 1296 bp spanning from 2 1286 to þ 10 bp of the promoter region of the hTomm70 gene. The oligonucleotides have flanking restriction sites for Xho I and Hind III enzymes for directional cloning purposes. The PCR included one cycle of denaturation at 94 8C for 2 min followed by 35 cycles of 30 s at 94 8C, 30 s at 59 8C and 2 min 40 s at 73 8C, with a final extension at 73 8C for 5 min. The Pfu DNA polymerase System (Promega) was used in the PCR. PCR product was gel-purified, digested with Xho I and Hind III and cloned into a promoterless luciferase reporter vector, pGL3-Basic (Promega, Madison, WI) previously digested with the same enzymes. This construct was designated pGL3-T70p. Cloned fragment was verified by direct sequencing and then analyzed using GCG (Genetics Computer Group, Madison, WI) and TRANSFAC (Heinemeyer et al., 1999).
2.1. Materials 2.3. Generation of luciferase reporter constructs HeLa S3 cell line was obtained from the American Type Culture Collection (Manassas, VA); fetal bovine serum (FBS) was obtained from Sigma; media and other products for cell culture were purchased from Life Technologies; oligonucleotides were synthesized by Sigma-Genosys; the sources of various kits and reagents used for molecular biological methods are indicated in the appropriate context. 2.2. Cloning of the 5 0 -flanking region of the human Tomm70 gene The 50 -upstream region of the human Tomm70 gene was obtained from the GenBank (Accession
Deletion of specific regions of the cloned 50 sequence was carried out by PCR (using pGL3T70p as a template) and subcloning in pGL3-Basic vector. The oligonucleotides were specifically designed with the flanking restriction sites for Xho I and Hind III enzymes for directional cloning purposes (Table 1). Plasmids used in transfection experiments were purified using Wizard Plus MaxiPreps Kit (Promega, Madison, WI), and purity was assessed by A260/A280 and agarose gel electrophoresis. Orientation and sequence was verified by direct sequencing in all constructs.
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
253
Table 1 Oligonucleotides used to generate the constructs of hTomm70 promoter Name
Size (bp)
Forward
Reverse
T70p p1 p2 PN PNA pDN1 pDN2 pDN3 p3 p4
1296 794 302 199 124 66 77 93 123 615
ACACTCGAGTCTACTGTGATGTTGTTGCAC ACACTCGAGACCACGCTCAAACCGTTTC ACACTCGAGCCCTTCTTTCCTGAAGGTAG ACACTCGAGCGAAGACTCCTACTCACACC ACACTCGAGATACTGGAGGAGAAGGACG ACACTCGAGTCTGGCCCTTTTCTGTCGTC ACACTCGAGATACTGGAGGAGAAGGACG ACACTCGAGCGAAGACTCCTACTCACACC ACACTCGAGCCCTTCTTTCCTGAAGGTAG ACACTCGAGACCACGCTCAAACCGTTTC
ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGGGAAGGAAAGCAATGAG ACAAAGCTTGACGACAGAAAAGGGCCAGAG ACAAAGCTTCGTCCTTCTCCTCCAGTATC ACAAAGCTTGGGTGTGAGTAGGAGTCTTC ACAAAGCTTGGGTGTGAGTAGGAGTCTTC
The underlined nucleotides indicate the recognition sequences for restriction enzymes, Xho I and Hind III in forward and reverse oligonucleotides, respectively. The double underlined nucleotides are included to facilitate the digestion with restriction enzymes.
2.4. Transfection of HeLa S3 cells with luciferase reporter constructs HeLa S3 cells were cultured in Dulbecco’s MEM (D-MEM, high glucose (4500 mg/l D -glucose) with L -glutamine and phenol red) supplemented with 0.1 mM non-essential amino acids (NEAAs) and 10% FBS. Cell cultures were maintained at 37 8C with 5% CO2. The day before transfection, cells were plated onto 24-well tissue culture dishes at a density that allowed the cells to reach 80 – 90% confluence by the time of transfection. Transfections were done with LipofectAMINE PLUS reagent (Life Technologies, Inc.), following manufacturer’s protocol. Each transfection was done using 0.8 mg of luciferase reporter construct DNA and 8 ng of an internal control plasmid pRL-TK (Promega). Four hours after transfection, 1 ml of D-MEM with 0.1 mM NEAA and 13% FBS was added, and the plates were returned to the incubator. At 24 h post-transfection, medium was removed and wells were rinsed with phosphate-buffered saline to detach cells and residual growth medium. Then 100 ml of 1 £ passive lysis buffer, provided in the Dual-Luciferase Reporter Assay System (Promega), were added per well and plates were rocked at room temperature for 15 min. Samples were transferred to 1.5-ml microcentrifuge tubes and assayed for luciferase activity without further manipulation. Firefly and Renilla luciferase activities were sequentially measured using the Dual-Luciferase Reporter Assay System (Promega) following
manufacturer’s instructions. Luciferase activities were determined using a Berthold model Orion Luminometer, with a 2-s pre-delay followed by a 1-s measuring period. The Renilla luciferase activity, expressed from HSV-TK promoter, provided an internal control to monitor transfection efficiency. Firefly luciferase activities were normalized based on the Renilla luciferase activity in each well. Microsoftw Excel 2000 was used for the statistical analysis of the results. 2.5. Labeling of oligonucleotides with digoxigenin Synthetic oligonucleotides encompassing the putative NRF-2A and NRF-2B sequences of the promoter region of the human Tomm70 gene as well as oligonucleotides in which these sequences had been mutated were purchased from Sigma-Genosys (Texas, USA) as single-stranded oligonucleotides. Complementary forward and reverse oligonucleotides were denatured 10 min at 95 8C and placed at room temperature for 30 min to generate doublestranded oligonucleotides (listed in Table 2). Doublestranded oligonucleotides to be used as probes were labeled with digoxigenin using the DIG Oligonucleotide 30 -end Labeling Kit (Roche) following manufacturer’s protocol. Briefly, a reaction was set up in a final volume of 20 ml in 1 £ reaction buffer (0.2 M potassium cacodylate, 25 mM Tris– HCl, 0.25 mg/ml BSA (pH 6.6) at 25 8C) containing 17.5 pmol of double-stranded oligonucleotide, 5 mM CoCl 2, 0.05 mM digoxigenin-ddUTP and 2.5 U of terminal
254
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
Table 2 Oligonucleotides used in EMSAs Name
Sequence
NRF-2A
50 -GCATGCCCTGGGCTTCCGGTGACCTCTGGC-30 30 -CGTACGGGACCCGAAGGCCACTGGAGACCG-50
immunodetected with anti-digoxigenin and visualized with the chemiluminescent substrate disodium 3-(4methoxyspiro {l,2-dioxethane-3,20 -(50 -chloro)tricyclo [3.3.1.13,7]decan}-4-yl)phenyl phosphate (CSPD) (DIG Luminescent Detection Kit, Roche) followed by X-ray film exposure (Kodak).
NRF-2Amut 50 -GCATGCCCTGGGCTAGAGGTGACCTCTGGC-30 30 -CGTACGGGACCCGATCTCCACTGGAGACCG-50 NRF-2B
50 -TTTCCCTTAACCCGGAAGTGATTTCCGCCC-30 30 -AAAGGGAATTGGGCCTTCACTAAAGGCGGG-50
NRF-2Bmut 50 -TTTCCCTTAACCCTCTAGTGATTTCCGCCC-30 30 -AAAGGGAATTGGGAGATCACTAAAGGCGGG-50
Consensus sequences for NRF-2 binding are shown underlined (only coding strand). Nucleotides in bold indicate introduced point mutations.
transferase and incubated 15 min at 37 8C. The reaction was stopped with 2 ml of 0.2 M EDTA (pH 8.0). 2.6. Electrophoretic mobility shift assays Electrophoretic mobility shift assays (EMSAs) were performed as follows: 11.2 mg of HeLa nuclear protein (HeLaScribew Nuclear Extract, Promega, Madison, WI, USA) were incubated with or without competitor double-stranded oligonucleotides in 1 £ binding buffer (4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris – HCl (pH 7.5), 0.05 mg/ml polydI-dC·polydI-dC, Promega) for 10 min at room temperature. Digoxigenin-labeled NRF-2A or NRF-2B probes were added to the binding reactions and incubated for 20 min at room temperature. For ‘supershift’ analysis, 1 ml of rabbit serum against NRF-2a (gift from Dr Scarpulla) or control serum against an unrelated protein was added to the reaction mixture and incubated for 1 h at room temperature. Samples were loaded into a 6% polyacrilamide (40:1, acrilamide:bisacrilamide), 0.5 £ TBE gel and electrophoresed at 150 V, 4 8C for 25 min in 0.5 £ TBE buffer. Electrophoretic transfer to a nitrocellulose membrane (Hybonde-N þ , Amersham) was carried out under high intensity field (80 V, 500 mA) for 1 h at 4 8C in 0.5 £ TBE, followed by crosslinking under UV light. Digoxigenin-labeled probes were
3. Results 3.1. Sequence analysis of the 5 0 -flanking region of the human Tomm70 gene Analysis of the 1.3-kb of the 50 -flanking region of the hTomm70 gene cloned into pGL3-T70p revealed the lack of consensus TATA and CCAAT promoter boxes although a variety of potential binding sites for several transcription factors were detected. The most apparent was the presence of a perfect consensus sequence (ACCGGAAGNS) for the binding site of the NRF-2 (Virbasius and Scarpulla, 1990), at 2 70 to 2 61 bp (designated as NRF-2A); a second NRF-2 motif—with a single base modification relative to the consensus sequence—is located at 2 124 to 2 115 bp (designated as NRF-2B) (Fig. 1). Moreover, the analysis of a 1.8-kb region including, in addition to the 1.3-kb of the 50 -flanking region of the gene, the exon 1 and the beginning of the first intron, shows the presence of two typical CpG islands, the first one located between positions 2 973 and 2 765 of the promoter region and the second one between positions 2 40 and þ 380 bp (i.e. mainly encompassing exon 1). 3.2. Functional characterization of the human Tomm70 promoter region To identify the critical element(s) required for promoter activity, firefly luciferase reporter constructs containing several regions of the 50 -flanking region were transfected into HeLa S3 cells. Results shown (Fig. 2) represent firefly luciferase activity normalized on the basis of the control Renilla luciferase activity. The highest activity was detected with the construct pN containing the two NRF-2 sites. Reporter assays with the pNA construct, with a deletion of a 76-bp region containing the NRF-2B site, show 50% of the activity of the pN construct;
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
255
Fig. 1. Nucleotide sequence of the 50 -flanking region of the human Tomm70 gene. Underlined indicates the two CpG islands; boldface regions indicate the putative NRF-2 sites; the thymine in boldface corresponds to the transcriptional start site, numbered as position þ 1. The translational start codon at position þ 92 is indicated in boldface. The arrows indicate the orientation of the consensus sequences.
additional deletion of a 58-bp region containing the NRF-2A (pDN1) abolished the activity indicating that the main promoter region of hTomm70 is localized within a 134-bp (2 189 to 2 56) region containing the two NRF-2 sites. This observation implies that both regions, each including an NRF-2, contribute in a similar way to the activity of the promoter. In contrast, the assays with constructs containing either NRF-2A (pDN2) or NRF-2B (pDN3) alone, show that the promoter activities are lower than expected and that pDN3 (NRF-2B-site containing) has 2-fold the activity of pDN2 (NRF2A-site containing) indicating the importance of
the presence of the 27-bp (2 56 to þ 10) downstream region. Interestingly, this region corresponds to a fragment of the CpG island found in the proximal region of the gene. Moreover, constructs with upstream sequences of the 134-bp region, i.e. without the NRF-2 sites (p3 and p4 constructs) showed no activity, reinforcing the idea that the promoter of the hTomm70 lies within this region. The activities of p2, p1 and pT70p constructs containing additional upstream sequences (Fig. 2) are, respectively, 1.1, 1.9 and 4.2-fold less than that of the 199-bp fragment (pN), suggesting that negative elements are located upstream of this region.
256
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
Fig. 2. Functional analysis of the promoter elements of the human Tomm70 gene. Left, schematic illustration of the various promoter-deletion— luciferase-reporter constructs. The open rectangular box indicates the 50 -flanking region of the human Tomm70 gene. The name of each construct is shown on the left. The numbers indicate the position of nucleotides. Vertical bars show the relative positions of the indicated DNA sequence motifs. Right, Firefly luciferase activities expressed in HeLa S3 cells transfected with the reporter constructs have been normalized on the basis of Renilla luciferase activity encoded by the co-transfected control plasmid, pRL-TK. Results are the mean ^ SD of at least six samples from two independent transfection experiments. tsp, transcriptional start site; LUC, luciferase gene reporter.
3.3. EMSA experiments show the binding of a protein to the NRF-2 binding sites in the promoter region of Tomm70 gene Electrophoretic mobility shift assays were run to determine the binding of nuclear proteins to the putative NRF-2 sites located at the promoter region of the human Tomm70 gene. Digoxigenin-labeled oligonucleotides encompassing NRF-2A and NRF-2B putative binding sites incubated with HeLa nuclear proteins generated a major band shift in the absence of competitor, suggesting the binding of nuclear protein(s) to the probes in both cases (Fig. 3A and B, lane 2). To determine the specificity of the band shifts binding reactions were pre-incubated with increasing concentrations of unlabeled normal and mutated competitors. NRF-2A and NRF-2B oligonucleotides were able to completely inhibit the binding of the labeled probe even at the lowest concentration of
10 £ (Fig. 3A and B, lane 3). In contrast, inhibition of binding with mutated NRF-2A and NRF-2B (NRF2Amut and NRF-2Bmut) was very weak even at concentrations of 100 £ (Fig. 3A and B, lane 9). In addition, shift assays using antibodies against NRF2a subunit show supershifted bands in both NRF-2A and NRF-2B sites that were absent with control serum (Fig. 4A and B). These results strongly support the specific binding of NRF-2 to the NRF-2A and NRF-2B sites in the promoter region of the human Tomm70 gene.
4. Discussion We have cloned and sequenced a 1296-bp human genomic DNA fragment corresponding to the 2 1286 to þ 10 region of the gene encoding human Tomm70. The analysis of the proximal promoter region of this
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
257
Fig. 3. EMSAs with HeLa nuclear extract. (A) Using digoxigeninlabeled NRF-2A with (lanes 2–10) or without (lane 1, negative control) nuclear extract and increasing concentrations (10-, 25-, 100- and 300-fold molar concentrations) of unlabeled normal (NRF2A, lanes 3– 6) or mutated (NRF-2Amut, lanes 7–10) competitor. (B) Identical experiment using digoxigenin-labeled NRF-2B as a probe and unlabeled normal (NRF-2B, lanes 3–6) and mutated (NRF-2Bmut, lanes 3–6) oligonucleotides as competitors. Arrows ( ! ) indicate the position of the predominant shifted bands.
gene shows the absence of canonical TATA and CCAAT elements and the presence of two consensus sequences for the NRF-2 transcription factor. It is well established that fungal TOMM70 plays a key role in mitochondrial biogenesis as a major receptor for mitochondrial import of such hydrophobic pre-proteins as the carrier proteins. Interestingly, other nuclear encoded mitochondrial proteins, which are also involved in mitochondrial biogenesis, share features similar to those reported here for the proximal promoter region of the human Tomm70 gene (i.e. absence of TATA and CCAAT boxes, presence of a CpG island and putative binding sites for NRFs) (Scarpulla, 2002). Our analysis of the 50 -flanking region of other genes encoding different
Fig. 4. Antibody supershift analysis of NRF-2 binding to the Tomm70 promoter. (A) Digoxigenin-labeled NRF-2A probe incubated with (lanes 2–4) or without (lane 1, negative control) nuclear extract and post-incubated with 1 ml of antiserum to NRF2a subunit (lane 3) or control antiserum (lane 4). (B) Identical experiment using digoxigenin-labeled NRF-2B probe. Main shifted complexes are indicated with brackets. Arrows ( ! ) indicate the position of the supershifted bands.
subunits of the human TOMM and TIMM complexes extends this similarity to Tomm20 (Hernandez et al., 1999) as well as to Tomm34, Timm8b, Timm13b and Timm23 (data not shown). Our functional studies with the reporter gene using different constructs of the promoter region of hTomm70 reveal that the shortest construct of those
258
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259
that contain the two NRF-2 sites yields the highest promoter activity (pN construct). Deletion of 75 bp of the 50 region of pN construct to remove the NRF-2B site (pNA construct) resulted in a ca. 50% loss of activity. Deletion of an additional 58-bp fragment that included the site for NRF-2A (pDN1 construct) basically abolished promoter activity. These observations strongly suggest that the two NRF-2 motifs are involved in the activity of the hTomm70 promoter and that they work in an additive manner. This conclusion is reinforced by the fact that both sites bind NRF-2, as demonstrated by mobility shift and supershift assays, and this binding is specific as shown by using mutated NRF-2 sites as competitors. A similar pattern of two supershifted bands has been already shown when using antiserum for NRF-2a (Imaki et al., 2003). Nevertheless, we have observed a significant decrease in activity when these NRF-2 binding sites are alone in separate constructs (pDN2 and pDN3). The presence of a fragment of the CpG island immediately downstream from these sites dramatically increases the activity of the promoter. A possible explanation is that this fragment of the CpG island is facilitating the access of the NRF-2 to its binding sites at the promoter as previously described (Murray and Grosveld, 1987). However, since the tsp is part of the CpG island, further approaches are required to discriminate between the activity of the CpG island and the presence of the tsp. In addition, an increase in the length of the pN construct was concomitant with a progressive decrease of the promoter activity, suggesting that the presence of upstream inhibitory regions should not be discounted. In summary, we have characterized the promoter region of the human Tomm70 gene, establishing the essential role of NRF-2 transcription factor and the importance of a CpG island for an effective activity of the promoter. This is the first report demonstrating the importance of an NRF transcription factor for the activity of the promoter of a protein involved in the mitochondrial protein import process. Indeed, our results support the idea that participation of NRF transcription factors in the coordination of nuclear and mitochondrial genetic systems is not limited to the subunits of the respiratory chain (Virbasius
and Scarpulla, 1990) but include important subunits of the mitochondrial protein import machinery such as Tomm70.
Acknowledgements We thank Eloisa Barber for her technical assistance and Dr R.C. Scarpulla for antiserum to NRF-2a. Dr J.R. Blesa was an associate researcher of the Fundacio´n Valenciana de Investigaciones Biome´dicas (FVIB). Dr J.M. Herna´ndez was a postdoctoral fellow of FVIB. This research was supported by a grant of the United Mitochondrial Disease Foundation, the Fondo de Investigacio´n Sanitaria (FIS PI021345) and the Escola Valenciana D’Estudis per a la Salut Pu´blica (EVES/Conselleria de Sanitat, Generalitat Valenciana).
References Alvarez-Dolado, M., Gonzalez-Moreno, M., Valencia, A., Zenke, M., Bernal, J., Mun˜oz, A., 1999. Identification of a mammalian homologue of the fungal Tom70 mitochondrial precursor protein import receptor as a thyroid hormone-regulated gene in specific brain regions. J. Neurochem. 73, 2240–2249. Bauer, M.F., Gempel, K., Reichert, A.S., Rappold, G.A., Lichtner, P., Gerbitz, K.D., et al., 1999. Genetic and structural characterization of the human mitochondrial inner membrane translocase. J. Mol. Biol. 28, 69–82. Heinemeyer, T., Chen, X., Karas, H., Kel, A.E., Kel, O.V., Liebich, I., et al., 1999. Expanding the TRANSFAC database towards an expert system of regulatory molecular mechanisms. Nucleic Acids Res. 27, 318–322. Hernandez, J.M., Giner, P., Hernandez-Yago, J., 1999. Gene structure of the human mitochondrial outer membrane receptor Tom20 and evolutionary study of its family of processed pseudogenes. Gene 239, 283–291. Imaki, H., Nakayama, K., Delehouzee, S., Handa, H., Kitagawa, M., Kamura, T., Nakayama, K.I., 2003. Cell cycle-dependent regulation of the Skp2 promoter by GA-binding protein. Cancer Res. 63, 4607–4613. Komiya, T., Rospert, S., Schatz, G., Mihara, K., 1997. Binding of mitochondrial precursor proteins to the cytoplasmic domains of the import receptors Tom70 and Tom20 is determined by cytoplasmic chaperones. Eur. Mol. Biol. Org. J. 16, 4267–4275. Komiya, T., Rospert, S., Koehler, C., Looser, R., Schatz, G., Mihara, K., 1998. Interaction of mitochondrial targeting signals with acidic receptor domains along the protein import pathway: evidence for the ‘acid chain’ hypothesis. Eur. Mol. Biol. Org. J. 17, 3886–3898.
J.R. Blesa et al. / Mitochondrion 3 (2004) 251–259 Murray, E.J., Grosveld, F., 1987. Site specific demethylation in the promoter of human gamma-globin gene does not alleviate methylation mediated suppression. Eur. Mol. Biol. Org. J. 6, 2329–2335. Pfanner, N., Geissler, A., 2001. Versatility of the mitochondrial protein import machinery. Nat. Rev. Mol. Cell Biol. 5, 339–349.Review. Scarpulla, R., 2002. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim. Biophys. Acta 1576, 1 –14.
259
Tilzer, L.L., Thomas, S.M., Moreno, R.F., 1989. Use of silica gel polymer for DNA extraction with organic solvents. Anal. Biochem. 183, 13– 15. Virbasius, J.V., Scarpulla, R.C., 1990. The rat cytochrome c oxidase subunit IV gene family: tissue-specific and hormonal differences in subunit IV and cytochrome c mRNA expression. Nucleic Acids Res. 18, 6581–6586. van Wilpe, S., Ryan, M.T., Hill, K., Maarse, A.C., Meisinger, C., Brix, J., et al., 1999. Tom22 is a multifunctional organizer of the mitochondrial preprotein translocase. Nature 401, 485 –489.