Nuclear receptor Nur77 suppresses inflammatory response dependent on COX-2 in macrophages induced by oxLDL

Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y j m c c

Nuclear receptor Nur77 suppresses inflammatory response dependent on COX-2 in macrophages induced by oxLDL Qin Shao a,1, Ling-Hong Shen a,1, Liu-Hua Hu a, Jun Pu a, Mei-Yan Qi b, Wen-Qing Li b, Fu-Ju Tian b, Qing Jing b,⁎, Ben He a,⁎ a b

Department of Cardiology, Ren Ji Hospital, Medical School of Shanghai Jiao Tong University, Shanghai, People's Republic of China Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, People's Republic of China

a r t i c l e

i n f o

Article history: Received 9 January 2010 Received in revised form 29 March 2010 Accepted 30 March 2010 Available online 8 April 2010 Keywords: oxLDL Nur77 Macrophages COX-2 Atherosclerosis

a b s t r a c t Oxidized low-density lipoprotein (oxLDL) cross-talks with macrophages, and both play a crucial role in the initiation and progression of atherosclerosis. Orphan nuclear receptor Nur77 is potently induced in macrophages by diverse stimuli, suggesting that it may be a key regulator of inflammation in vascular cells. The detailed mechanism of Nur77 activation and subsequent function in macrophages induced by oxLDL remains unclearly. In this study, we demonstrated that Nur77 is upregulated in a dose and time-dependent fashion by oxLDL stimulation in murine macrophages, as detected by real-time PCR and Western blotting. OxLDL activated the phosphorylation ERK1/2 and p38 MAPK, inhibition of p38 MAPK but not ERK1/2 attenuated Nur77 expression. Importantly, overexpression of Nur77 suppressed oxLDL-induced proinflammatory cytokines and chemokines secretion including tumor necrosis factor (TNF)α and monocyte chemoattractant protein-1(MCP-1). While knockdown Nur77 expression by specific small interfering RNA (siRNA) resulted in the enhancement of the secretion. Furthermore, exposure of macrophages to oxLDL significantly upregulated cyclooxygenase-2(COX-2) expression. However, this could be markedly inhibited by Nur77 overexpression. Also, Nur77 siRNA increased oxLDL-induced COX-2 expression and 6mercaptopurine (6-MP) attenuated the increase. The results indicated that Nur77 is induced by oxLDL via p38 MAPK signal pathway and subsequently protects against inflammation by the inhibition of proinflammatory COX-2 pathway in activated macrophages. Specifically modifying transcription activity of Nur77 may represent a potential molecular target for the prevention and treatment of atherosclerosis. © 2010 Elsevier Ltd. All rights reserved.

1. Introduction Atherosclerosis is a complex, chronic inflammatory disease of the vessel wall, which may block the normal blood flow and may be a major life-threatening condition in humans. Oxidized low-density lipoprotein (oxLDL) cross-talks with macrophages and play a crucial role in the initiation and progression of atherosclerosis. Macrophages not only take up the modified LDL particles to form lipid-loaded foam

Abbreviations: oxLDL, oxidized low-density lipoprotein; TNFα, tumor necrosis factor α; MCP-1, monocyte chemoattractant protein-1; siRNA, small interfering RNA; COX-2, cyclooxygenase-2; 6-MP, 6-mercaptopurine; IL-1β, interleukin-1β; MAPK, mitogen-activated protein kinase; TAD, transactivation domain; DBD, DNA-binding domain; LBD, ligand-binding domain. ⁎ Corresponding authors. B. He is to be contacted at Ren Ji Hospital, Medical School of Shanghai Jiao Tong University, No.1630 Dong Fang Road, 200127 Shanghai, People's Republic of China. Tel.: +86 21 5875 2345; fax: +86 21 6838 3069. Q. Jing, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, No.225 South Chong Qing Road, 200025 Shanghai, People's Republic of China. Tel.: +86 21 63842973; fax: +86 21 63849617. E-mail addresses: [email protected] (Q. Jing), [email protected] (B. He). 1 Both authors contributed equally to this work. 0022-2828/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.yjmcc.2010.03.023

cells, but also release proinflammatory cytokines and chemokines, such as monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor (TNF)α, and interleukin-1β (IL-1β) [1,2], which result in lesions that are unstable and prone to rupture. Furthermore, oxLDL could promote macrophages to differentiate into dendritic-like cells, which may contribute to the increase in the inflammatory response [3]. As active inflammation is a major determinant of plaque vulnerability, it is important to know the molecular mechanism involved in the gene regulation in oxLDL-activated macrophages. Emerging data show that expression of Nur77, could be induced by diverse inflammatory stimuli such as lipopolysaccharide (LPS), TNFα, and IL-1β in macrophages [4]. It is also expressed in early and advanced human atherosclerotic lesions [5]. Nur77 may be a key regulator in lipid metabolism, inflammation, and atherosclerosis [6,7]. Nur77 (also known as NR4A1, TR3, NGFI-B), together with Nurr1 (NR4A2) and NOR-1 (NR4A3, MINOR), form the nuclear receptor NR4A subfamily. Similar to other nuclear receptors, their structure includes an N-terminal transactivation domain (TAD), a central DNAbinding domain (DBD), and a C-terminal ligand-binding domain (LBD) [8]. Since classical ligands have not been identified, they are referred as orphan nuclear receptor. As an early response gene, NR4A

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

is implicated in T-cell and cancer-cell apoptosis [9,10], dopaminergic differentiation of the neurons [11], and in the proliferation and survival of other cells [12,13]. It has been reported that overexpression of Nur77 reduces lipid loading and inflammatory response in human macrophages [5]. Our preliminary data also show that Nur77 could reduce oxLDL-induced intracellular lipid loading in macrophages by inhibiting lipid influx and enhancing lipid efflux [14]. However, the detailed mechanism of oxLDL-induced Nur77 activation and the subsequent function in regulating the inflammatory response in macrophages are not fully understood. In this study, we explored the role of Nur77 in activated macrophages and its potential mechanism. We demonstrated that Nur77 is induced in response to oxLDL and its expression is involved in p38 MAPK signal pathway. Nur77 has been found to reduce the expression of inflammatory cytokines such as MCP-1 and TNFα in activated macrophages via inhibition of cyclooxygenase-2 (COX-2) expression. 2. Methods 2.1. Materials 2.1.1. Antibody Rabbit polyclonal anti-Nur77, anti-COX-2, anti-ERK1/2, antiphosphoERK1/2, anti-p38 mitogen-activated protein kinase (MAPK), anti-phospho p38 MAPK, anti-SAPK/JNK anti-phospho SAPK/JNK, anti-GAPDH, and anti-β-actin were obtained from Cell Signaling Technology Inc. (Beverly, MA).

305

2.4. Cell transfection Plasmids pGFP, pGFP-Nur77 and pGFP-Nur77-△DBD/deltaDBD were transfected into RAW264.7 cells using FugeneHD (Roche, Indianapolis, IN) according to the manufacturer's instructions, respectively. The cells were subsequently incubated in the medium containing 500 μg/mL of G418 for the clones screening. The clones stably expressing pGFP, pGFPNur77 pGFP-Nur77-△DBD were maintained in the medium containing 200 μg/mL of G418. The clones were confirmed using Western blotting. 2.5. Transfection of siRNA against Nur77 Small interfering RNAs (siRNA) against Nur77 (siGenome Smart pool) and control siRNA were purchased from Dharmacon Research, Inc. The following siRNA sequences were used: 1) Sense sequence: 5′-GCCUAGCACUGCCAAAUUGUU-3′ and 5′-PCA AUUUGGCAGUGCUAGGCUU-3′ 2) Sense sequence: 5′-GCUCAGGCCUGGUACUACAUU-3′ and 5′-PUG UAGUACCAGGCCUGAGCUU-3′ 3) Sense sequence: 5′-CAGCGGCUCUGAGUACUAUUU-3′ and 5′-PAU AGUACUCAGAGCCGCUGUU-3′ 4) Sense sequence: 5′-CCGGUGACGUGCAACAAUUUU-3′ and 5′-PAA UUGUUGCACGUCACCGGUU-3′. About 20 μM of siRNA and control siRNA were transfected into the cells using Liprofectamine2000 (Invitrogen), according to the manufacturer's recommendations. 24 h after transfection, cells were treated with oxLDL, the mRNA and protein expression were detected, respectively. 2.6. Real-time RT-PCR analysis

2.1.2. Plasmid Nur77 expression plasmid (pGFP-Nur77) and pGFP-Nur77△DBD/deltaDBD were provided by Xiao-kun Zhang (Burnham Institute, La Jolla, CA). 2.1.3. Other chemical agents PD98059 (PD), SB203580 (SB), 6-mercaptopurine (6-MP), NS398 (NS), and G418 were obtained from Sigma. Tri Reagent was purchased from Molecular Research Center Inc, and FugeneHD was purchased from Roche Inc (Indianapolis, IN). All the other chemicals were obtained from commercial sources. 2.2. Isolation and oxidative modification of LDL LDL (density range 1.019–1.063 g/ml) was isolated from normal human plasma by sequential ultracentrifugation, and dialyzed against PBS at 4 °C. The LDL protein concentration was determined by a modification of the Lowry method with bovine albumin as the standard. After isolation, LDL was oxidized with CuSO4 at 37 °C for 18 h. Then oxLDL was sterilized by filtration membrane and stored at 4 °C as described in our previous research and others [3,15]. 2.3. Cell culture Raw264.7 cells (murine macrophage cell line) were obtained from the American Type Culture Collection and maintained in Dulbecco's modified Eagle's medium (DMEM) containing penicillin (100 U/mL), 100 μg/mL of streptomycin, and 10% heat-inactivated fetal calf serum (FCS) at 37 °C and 5% CO2. Before stimulation, the non-adherent cells were removed by washing them twice with DMEM and incubated for 24 h under standard conditions. Cells treated with oxLDL (40 μg/mL) were collected at the indicated times. In the experiments with inhibitor, the cells were pretreated with PD, SB, or NS for 1 h, then adding oxLDL in the media. Finally, the cells were harvested for the following measurements.

The cells (5 × 105 cells/well in 12-well plates) were incubated with/without oxLDL at the indicated times. The total RNA was extracted with Tri (MRC). cDNA synthesis was carried out with 250 ng of total RNA that was primed with random (dT). Quantitative realtime PCR was performed using SYBR Green (Toyobo) master mix and specific primers for mouse Nur77, MCP-1, TNFα, and COX-2, which were designed as follows: Nur77: forward primer, 5′-agc ttgggtgttgatgttcc-3′ and reverse primer, 5′-aatgcgattctgcagctctt-3′; MCP-1: forward primer, 5′-catccacgtgttggctca-3′ and reverse primer, 5′-gatcatcttgctggtgaatgagt-3′; COX-2: forward primer, 5′-cttcacgcat cagtttttcaag-3′ and reverse primer, 5′-tcaccgtaaatatgatttaagtccac-3′; TNFα: forward primer, 5′-gtccccaaagggatgagaagttc -3′ and reverse primer, 5′-tccacttggtggtttgctacgac-3′; and GAPDH: forward primer, 5′-cccatgtttgtgatgggtgtg-3′ and reverse primer, 5′-tggcatggactgtggtcatga-3′. The PCR conditions were as follows: preliminary denaturation at 50 °C for 2 min; 95 °C for 10 s, 95 °C for 15 s, and 60 °C for 1 min (40 cycles). The real-time PCR data were normalized by the levels of GAPDH mRNA and analyzed using ABI7900 Data Analysis software. 2.7. Western blotting analysis The cells were seeded (1 × 106 cells/well) onto a 6-well plate and lysed in a lysis buffer containing 150 mM of NaCl, 10 mM of Tris (pH 7.5), 5 mM of EDTA, 1% Triton X-100, 1 mM of PMSF, 10 mg/mL of leupeptin, 10 mg/mL of pepstatin, and 10 mg/mL of aprotinin for 30 min on ice. The protein concentrations were determined by the Micro BCA Protein Assay Reagent (Pierce). The lysates (50 μg) were electrophoresed on 10% SDS-PAGE and transferred onto the nitrocellulose membranes (Bio-Rad). The membranes were blocked with 5% (w/v) nonfat dried milk in TBST (50 mmol/L of Tris–HCl (pH 7.4), 150 mmol/L of NaCl, 0.1% Tween20) for 1 h and then incubated with various primary antibodies at a dilution of 1:1000 in TBST, at 4 °C overnight. The membranes were washed thrice with TBST and then incubated for 2 h at room temperature in TBST containing HRP-linked

306

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

goat anti-rabbit antibodies (Santa Cruz Biotechnology). Antigen detection was performed with the ECL kit (Millipore). 2.8. Transient transfection and luciferase assays The mouse COX-2 promoter was cloned by PCR on mouse genomic DNA as a template and cloned into the luciferase report plasmid pGL3basic. The primers used for PCR were: forward primer tailed with a Kpn I restriction site: GCTCGGGGTACC AAATGTCAAGTAGTCTGAAGGTG; reverse primer tailed with a HindIII restriction site: GTGCCCAAGCTT ACAAATCTACAGAATGATGGT TA. Site-directed mutagenesis (Site-Directed Mutagenesis Kit, Stratagene) of the COX-2 promoter NBRE site was performed with primer: forward: 5′ AGACCCA GATTTAAAAA AAA CATTATT TTAATTAAGTC 3′; R: 5′ GACTTAATTAAAATAATGTTTTTTTTAAATCTGGGTCT 3′. The COX-2 luciferase reporter plasmid or mutated reporter was verified by sequencing and then transfected into RAW264.7 cells using FugeneHD (Roche) for measuring COX-2 transcriptional activity. The cells were seeded (1 × 105 cells/well) onto a 24-well plate and transfected with reporter or expression plasmids, pGFP, pGFP-Nur77 or pGFP-Nur77△DBD/deltaDBD. In addition, the cells were co-transfected with a Renilla luciferase plasmid (pRL-SV40, Promega) as an internal control. After transfection, the cells were incubated with or without 40 μg/mL of oxLDL for 24 h, and then lysed and subjected to luciferase assays using a Dual-Luciferase Reporter Gene Assay system (Promega), according to the manufacturer's instructions. Luciferase activity was normalized for transfection efficiency by the luciferase activity of Renilla. 2.9. ELISA for MCP-1, TNFα Stable clones expressing pGFP, pGFP-Nur77 and pGFP-Nur77△DBD/deltaDBD were treated with or without 40 μg/mL of oxLDL for

Fig. 2. p38 MAPK is mediated by upregulation of Nur77 in response to oxLDL. (A) Raw264.7 cells were treated with oxLDL for the indicated times. Proteins were analyzed by Western blotting using anti-p-ERK1/2, anti-ERK1/2, anti-p-p38MAPK, anti-p38, anti-p-JNK, and anti-JNK antibodies. (B) Raw264.7 cells were pretreated with 20 μM of PD or 10 μM of SB for 1 h, then stimulated with 40 μg/mL of oxLDL for 1 h, and the mRNA expression of Nur77 was determined by real-time PCR. (C) Cells were pretreated with PD or SB for 1 h, Nur77 protein expression was also evaluated 24 h after oxLDL treatment by Western blotting. GAPDH expression served as controls for similar loading of proteins in each lane. PD: PD98059; SB: SB203580; *P b 0.05 vs cells incubated with oxLDL alone. The data represent 3 independent experiments.

24 h in 6-well plates, respectively. MCP-1 and TNFα protein levels in the culture supernatants were analyzed using cytokine-specific ELISA kits, according to the manufacturer's instructions (BD Biosciences Pharmingen, San Diego, CA). 2.10. Statistical analysis The data were expressed as mean ± SEM. The statistical significance of the differences was analyzed using paired Student's t-test. A value of P b 0.05 was considered statistically significant. 3. Results 3.1. oxLDL significantly induced expression of Nur77 in RAW264.7 cells Fig. 1. oxLDL induces Nur77 expression in RAW264.7 cells. (A) Immunoblot of Nur77 protein expression in oxLDL-stimulated RAW264.7 cells. Cells were incubated in varying oxLDL doses for 24 h. Bottom figure shows β-actin protein loading control. (B) Quantitative real-time RT-PCR to demonstrate Nur77 mRNA expression after stimulation with 40 μg/mL of oxLDL at the times indicated. (C) Nur77 protein expression in RAW264.7 cells stimulated with 40 μg/mL of oxLDL at different times as determined by Western blotting. **P b 0.01 vs time at 0 h. The data represent 3 individual experiments.

oxLDL has been proposed to be a key factor in the initiation and progression of atherosclerosis. We explored the expression of Nur77 in Raw264.7 cells in response to oxLDL stimulation. oxLDL dosedependently induced Nur77 expression, as determined by Western blotting (Fig. 1(A)). Thus, 40 μg/mL of oxLDL was chosen based on our

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

preliminary experiment and previously published reports of others [16]. oxLDL upregulated Nur77 expression at both mRNA and protein levels. The time course of Nur77 mRNA expression upregulated at early time points increased by 25-folds peaking at 1 h (Fig. 1(B)). Likewise, the protein level of Nur77 was also elevated in a time-dependent fashion, which was analyzed by Western blotting (Fig. 1(C)). We found that Nur77 can be induced in macrophages in response to oxLDL. 3.2. p38 MAPK is mediated upregulation of Nur77 in response to oxLDL Mitogen-activated protein kinases (MAPKs) are serine/threonine protein kinases which play an important role in cell proliferation, differentiation and production of several inflammatory genes [17]. To further investigate the molecular mechanism involved in oxLDLinduced Nur77 expression, we examined the MAPK inflammatory signal pathway. First, we carried out time-course experiments of extracellular signal regulated kinase 1/2 (ERK1/2), p38MAPK, and Jun N-terminal kinases/stress-activated protein kinase (JNKs/SAPKs) activation in Raw264.7 cells after oxLDL treatment. Phosphorylation

307

of ERK1/2, p38 was transiently enhanced, peaking at 1 h, and remained for up to 9 h. However, phosphorylation of JNK slightly increased at 3 h as determined by Western blotting (Fig. 2(A)). Meanwhile, oxLDL highly upregulated Nur77 expression at both mRNA and protein levels, as described previously (Figs. 1(B), C). Subsequently, we detected the effect of ERK1/2-specific inhibitor, PD98059, and p38 MAPK-specific inhibitor, SB203580, on oxLDLinduced Nur77 expression. The incubation of cells with oxLDL for 1 h significantly enhanced Nur77 mRNA level, while the upregulation was abrogated by p38 MAPK-specific inhibitor SB (Fig. 2(B), P b 0.05).After treatment for 24 h, oxLDL-induced Nur77 protein expression was also inhibited by SB, not by PD (Fig. 2(C)). The results showed that oxLDLinduced Nur77 expression is mediated by p38 MAPK signal pathway. 3.3. Nur77 suppresses proinflammatory cytokine and chemokine expression induced by oxLDL Subsequently, we explored the function of Nur77 in regulating inflammatory response in oxLDL-activated macrophages. We

Fig. 3. Nur77 suppresses proinflammatory cytokine and chemokine expression induced by oxLDL. (A) A stable clone expressing pGFP (as a control) , pGFP-Nur77 or pGFP-Nur77deltaDBD was incubated with oxLDL for 24 h, and mRNA expression of MCP-1 and TNFα was determined by real-time PCR. Culture supernatants of cell lines were collected after treated with or without oxLDL for 24 h, respectively. Protein levels of MCP-1 (B), TNFα (C) were detected by ELISA. (D) Cells seeded in six wells were transfected with Nur77-specific siRNA and control siRNA for 48 h, 24 h after transfection cells were treated with or without oxLDL and analyzed Nur77 expression by Western blotting. GAPDH protein expression monitored as controls showed in bottom. (E) After transfection with specific siRNA against Nur77 and control siRNA for 24 h, Raw264.7 cells were stimulated with oxLDL for additional 24 h, and the mRNA expression of MCP-1 and TNFα was determined by real-time PCR. Cells were incubated with 40 μg/mL oxLDL combined with or without 50 μM 6-MP for 24 h. The mRNA was extracted to test the expression of MCP-1 (F) and TNFα (G). Data are expressed as fold difference from control in three independent experiments and are shown as mean ± SEM. Significant differences from controls or cells treated with oxLDL alone (F,G): *P b 0.05, **P b 0.01 for MCP-1, and #P b 0.05, ##P b 0.01 for TNFα, respectively.

308

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

transfected pGFP, pGFP-Nur77, a dominant-negative form of Nur77 (pGFP-Nur77-△DBD/deltaDBD) which lacks its DNA-binding domain into Raw264.7 cells, respectively (Supplementary Fig. 2(A)). Then screened the clones by G418 (see Methods). The clones were verified by Western blotting and visualized by confocal. GFP-Nur77-ΔDBD protein was localized to the cells cytosol, whereas Nur77 was in cytosol and nucleus, predominately in nucleus (Supplementary Fig. 2(B–C)). First, we tested the mRNA expression of MCP-1 and TNFα in oxLDL-induced macrophages. Stable clones overexpression of Nur77 when compared with pGFP control group, significantly reduced oxLDL-induced the mRNA expression of MCP-1 and TNFα, as assayed by real-time PCR (Fig. 3(A), P b 0.01). Whereas, overexpression of dominant-negative Nur77 (Nur77-△DBD), which is defective in its binding domain, had no effect (Fig. 3(A)). Culture supernatants of cell lines were collected after treatment with or without oxLDL for 24 h, protein concentrations of MCP-1 and TNF-α were determined by Elisa. Similarly, overexpression of Nur77 led to a significant reduction of MCP-1 by 76% (Fig. 3(B), P b 0.05) and TNF-α expression by 31% (Fig. 3(C), P b 0.05), as compared with control group. In contrast, overexpression of Nur77-△DBD slightly increased oxLDL-induced expression of MCP-1 and TNF-α. Furthermore, to test the endogenous Nur77 function, we performed loss-of-function experiments. We used the RNA interference to silence Nur77 expression and the mRNA expression of Nur77 was assayed by real-time PCR (Supplementary Fig. 3(A)). After transfection with Nur77 special siRNA, cells were treated in the absence or presence of oxLDL, the protein expression of Nur77 was detected by Western blotting (Fig. 3(D)). Transfection with siRNA specific to Nur77 resulted in the upregulation of MCP-1 and TNFα mRNA expression approximately to 3.6-fold and 1.8-fold, respectively, as compared with control siRNA, which was also determined by real-time PCR (Fig. 3(E), P b 0.05). Since 6-mercaptopurine(6-MP) could increase Nur77 transactivation via its activating function-1 domain [8,18]. We explored the effect of endogenous Nur77 activation by 6-MP on inflammation. Subsequently, cells were stimulated with 40 μg/mL of oxLDL with or without 6-MP for 24 h. Briefly, mRNA expression of MCP-1 was obviously evoked with oxLDL stimuli in cultured RAW264.7 murine macrophages. Meanwhile, the increase of mRNA expression induced by oxLDL was significantly decreased by the co-incubation with 6-MP (Fig. 3(F), P b 0.05) and the results of the mRNA expression of TNFα were similar (Fig. 3(G), P b 0.05). These data further indicate that Nur77 is involved in the regulation of oxLDL-induced inflammatory response in macrophages. 3.4. The mechanism of Nur77 in negatively regulating inflammatory response 3.4.1. oxLDL upregulated expression of COX-2 Subsequently, we explored the detailed mechanism underlying the suppression of inflammatory cytokines by Nur77. The expression of COX-2 is induced by various stimuli and is involved in many inflammatory reactions and various physiological processes. Activation of COX-2 has been implicated in the expression of inflammatory cytokines, such as MCP-1 and TNFα, which are involved in the progression of atherosclerosis [19]. So we detected COX-2 expression in response to oxLDL. When Raw264.7 cells were exposed to oxLDL, the protein expressions of COX-2 were upregulated in a timedependent manner (Fig. 4(A)). Subsequently, we detected the effect of COX-2 inhibitor, NS398 on oxLDL-induced inflammatory response. In the cells pretreated with NS398, the mRNA expression of MCP-1 and TNFα was significantly reduced (Figs. 4(B) and (C), P b 0.05). These results suggest that COX-2 inhibition could block oxLDLinduced inflammatory cytokines expression. 3.4.2. Nur77 inhibits oxLDL-induced COX-2 upregulation To further clarify whether the regulation of oxLDL-induced inflammatory response by Nur77 is related to COX-2, we examined

Fig. 4. COX-2 inhibition blocks oxLDL-induced inflammation cytokines. (A) The protein expression of COX-2 at the times indicated in response to oxLDL was determined by Western blotting, and the GAPDH protein was monitored as a control. Cells were preincubated with 20 μM of NS398 for 1 h, then stimulated with 40 μg/mL of oxLDL for 24 h, and the mRNA expression of MCP-1(B) and TNFα (C) was determined by realtime PCR. NS: NS398. Results are shown as mean ± SEM of three independent experiments. *P b 0.05, for MCP-1, and #P b 0.05, for TNFα, vs cells treated with oxLDL alone, respectively.

the effect of Nur77 on COX-2 promoter activity. Nur77 has been shown to regulate gene transcription through its highly conserved DNA-binding domain which recognizes its response element (NBRE, AAAGGTCA) [20]. Sequence analysis further revealed that COX-2 promoter contains a potential Nur77 binding site. First, COX-2 promoter containing a potential binding site was cloned by PCR on murine genomic DNA as a template and cloned into pGL3 basic luciferase vector. Then luciferase report assay was performed (Supplementary Fig. 4(A–B)). The results showed that COX-2 promoter activity was inhibited when it was coexpressed with Nur77, compared with coexpression with GFP (Fig. 5(A), P b 0.05). To further confirm whether the NBRE site in the COX-2 promoter is responsible for transactivation mediated by Nur77, subsequently, site-directed mutagenesis of the COX-2 promoter containing a mutation of the putative Nur77 binding site (NBRE:AAAGGTCA) to AAAAAACA using site directed mutagenesis was performed and verified by sequencing (Supplementary Fig. 4(C)). Mutation of the putative site abolished the responsiveness of the COX-2 promoter to Nur77 (Fig. 5(A), P N 0.05), suggesting that the site mediates COX-2 transcriptional activity by Nur77. Furthermore, a dominant-negative form of Nur77(△DBD) which lacks its DNA-binding domain was also

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

309

Fig. 5. Nur77 inhibits oxLDL-induced COX-2 expression. Raw264.7 cells were co-transfected with 200 ng of pGL3-COX-2-luc or its mutant, 10 ng of Renilla luciferase plasmid, in the presence 800 ng of pGFP as a control or pGFP-Nur77 or pGFP-Nur77-deltaDBD. 48 h after transfection, COX-2 luciferase activity was assayed and normalized by Renilla luciferase. A mutant of COX-2 promoter contains a mutation of the putative Nur77 binding site (NBRE: AAAGGTCA) to AAAAAACA using site directed mutagenesis. P b 0.05 vs control. (B) Cells were transfected with 200 ng of pGL3-COX-2-luc, 10 ng of Renilla luciferase plasmid, and 800 ng of either pGFP or pGFP-Nur77 or pGFP-Nur77-deltaDBD, then were treated with or without 40 μg/mL of oxLDL for an additional 24 h. COX-2 activity was determined by luciferase assays. The data represent at least 3 individual experiments. P b 0.05 vs control. (C) mRNA expression of COX-2 in cell lines expressing pGFP or pGFP-Nur77, treated with oxLDL or without oxLDL, was evaluated by real-time PCR. (D) Cell lines expressing pGFP as a control, pGFP-Nur77 or pGFP-Nur77-deltaDBD(△DBD), treated with oxLDL or without oxLDL, protein expression of COX-2 was evaluated by Western blotting. GAPDH expression served as controls for similar loading of proteins in each lane. (E) After transduction with Nur77-specific siRNA and control siRNA for 24 h, Raw264.7 cells were stimulated with oxLDL for an additional 24 h, and the mRNA expression of COX-2 was assayed by real-time PCR. (F) 24 h after transfection with siRNA or control siRNA, cells were treated with 40 μg/mL of oxLDL at the times indicated. The protein expression of COX-2 was detected by Western blotting using anti-COX-2 antibody. Significant differences from controls: *P b 0.05 vs cells treated with oxLDL alone. Results are shown as mean ± SEM of three independent experiments.

utilized. Our findings showed that it also abrogated the responsiveness of the COX-2 promoter (Fig. 5(A), P N 0.05). Next, after transfection with COX-2 promoter, Renilla luciferase plasmid, and either pGFP or pGFP-Nur77 or pGFP-Nur77-△DBD, then cells were treated with or without 40 μg/mL of oxLDL for an additional 24 h. Overexpression of Nur77 significantly inhibited both basal and oxLDLinduced COX-2 promoter activities (Fig. 5(B), P b 0.05), whereas Nur77-△DBD had no such effect. Likewise, Nur77 overexpression attenuated mRNA expression of COX-2 in response to oxLDL (Fig. 5(C), P b 0.05). Similarly, overexpression of Nur77, but not Nur77-△DBD, significantly attenuated oxLDL-induced COX-2 expression, as indicated by Western blotting (Fig. 5(D)). On the other hand, Nur77-specific siRNA significantly enhanced oxLDL-induced COX-2 mRNA expression by 30-fold, as compared with control group (Fig. 5 (E), P b 0.05). Furthermore, we determined the effect of siRNA against Nur77 on oxLDL-induced expression of COX-2 by Western blotting. In control siRNA group, the time course of COX-2 expression, when incubated with 40 μg/mL oxLDL, was upregulated following the treatment after 3 h, peaking up at 12 h. While in Nur77 knock down group, oxLDL increased COX-2 expression at 3 h, remained up to 24 h. Moreover, the COX-2 expression was much stronger than control group at the times indicated (Fig. 5(F)).On the other hand, cells were treated with oxLDL, combined with or without 50 μM 6-MP for 1 h, activation of endogenous Nur77 by 6-MP also suppressed oxLDL-induced COX-2 mRNA expression (Fig. 6(A), P b 0.05). Similarly, COX-2 protein expression in response to oxLDL was also inhibited by co-incubation

with 6-MP (Fig. 6(B)). These findings indicate that Nur77 could attenuate COX-2 expression in oxLDL-induced macrophages. 4. Discussion In this study, we found that orphan nuclear receptor, Nur77, was activated in response to inflammatory stimuli of oxLDL, and that overexpression of Nur77, but not dominant-negative Nur77(Nur77△DBD), attenuated the secretion of proinflammatory cytokines, such as MCP-1 and TNFα, while knockdown Nur77 expression by specific siRNA resulted in the enhancement of the secretion of proinflammatory cytokines. We presented a novel mechanism that oxLDL-induced Nur77 expression is through p38 MAPK signal pathway, and that Nur77 could negatively regulate the inflammatory response by suppressing COX-2 expression. Thus, it can be concluded that Nur77 may play a protective role in activated macrophages by suppressing the proinflammatory cytokines. Atherosclerosis is thought of not only as a lipid metabolism disturbance, but also an inflammation condition of the vascular system. It seems essential to know how atherotic lesions are initiated, how they progress, and most importantly, how these lesions develop into vulnerable plaques which cause serial clinical events. Exploring the molecular mechanism of gene regulation involved in inflammation may provide a potential target for inflammatory vascular disorder. Recent data suggest that Nur77 is implicated in vascular homeostasis and inflammation by regulating the vascular cells. In

310

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

Fig. 6. Nur77 activity attenuates COX-2 expression. (A) RAW264.7 cells were stimulated with oxLDL combined with or without 6-MP for 1 h, and the mRNA was extracted to determine the expression of COX-2 by real-time PCR. (B) After 24 h of oxLDL incubation, the protein samples were immunoblotted with anti-COX-2 antibody. The data represent mean ± SEM of 3 independent experiments. *P b 0.05 vs cells treated with oxLDL alone.

smooth muscle cells (SMCs), Nur77 has been shown to inhibit SMCs proliferation and prevent the formation of vascular lesion in carotid artery ligation of transgenic mice model [21]. Enhancement of the activity of Nur77 by 6-MP has also been observed to reduce SMC proliferation and SMC-rich neointima formation [22,23]. In endothelial cells, Nur77 has been reported to regulate VEGF-A-induced endothelial cell proliferation, tube formation in vitro, and exhibit pro-angiogenesis effect in vivo [24]. Recently, it has been revealed that Nur77 suppresses cytokine-induced expression of VCAM-1 and ICAM-1 through the induction of IkBα expression in human ECs [25]. As it has been established that atherosclerotic lesions are active sites of inflammation and immune response, cytokines mediate the chronic development of atherosclerosis [26,27]. Much attention has been focused on the macrophages. It has been found that Nur77 is markedly induced by diverse inflammatory stimuli, and is expressed in human atherosclerotic lesion macrophages that exhibit the important role of Nur77 in plaque progression [4,5]. In this study, we found that Nur77 was induced by oxLDL. Subsequently, we investigated the mechanism involved in oxLDLinduced Nur77 expression. First, we explored the upstream signaling pathway that regulates Nur77 expression on oxLDL stimulation. In inflammatory stimuli triggered proinflammatory signal transduction cascade, MAPKs which consist of p38 MAPK, ERK, JNK, play a key role in regulating cell growth, differentiation and the expression of proinflammatory protein and cytokines [28,29]. It has been reported that ERK1/2 and p38 MAPK are involved in oxLDL-induced macrophage proliferation [30]. In this study, our results indicated that oxLDL activated the phosphorylation of ERK1/2 and p38 MAPK. Inhibiting p38 MAPK but not ERK blocked the upregulation of Nur77 in mRNA and protein level, which suggests that oxLDL-induced Nur77 expression is through p38 MAPK signal pathway. Subsequently, we investigated the role of Nur77 in activated macrophages. It has been shown that Nur77 could reduce lipid loading and inflammatory response in human macrophages after stimulation with lipopolysaccharide (LPS) and TNFα [5]. However, it has also been reported that overexpression of Nur77 in murine macrophages potentiates the inflammatory gene and cell cycle gene

expression, such as MARCKs, cyclinD2, and IKKi in response to LPS [31]. In this study, we demonstrated that overexpression of Nur77 suppressed the expression of proinflammatory cytokines, such as MCP-1 and TNFα. The discrepancy may be explained by the different inflammatory stimuli. Following that, we tried to explore the detailed mechanism of Nur77 in regulating the inflammatory response. Previous study has shown that oxLDL could induce COX-2 expression by the activation of ERK1/2 [17], and that COX-2 is expressed in the atherosclerotic lesions and could promote inflammation. In macrophages, COX-2 expression was found to contribute to atherogenesis in LDLR−/− mice [32]. Furthermore, LPS-activated COX-2(−/−) had decreased expression of MCP-1 and TNFα [19]. Thus, we speculate that the regulation of proinflammatory cytokine secretion by Nur77 may be linked with COX-2. In this study, our results suggest that oxLDL also induced COX-2 expression in a time-dependent manner, while COX-2 inhibition blocked oxLDL-induced inflammatory cytokines release. To investigate whether Nur77 directly affects COX-2 transcriptional activity, a luciferase report construct containing a putative Nur77 response element sequence from −2140 bp to +930 bp of COX-2 was cloned. As shown in Fig. 5(A), a significant inhibition of COX-2 promoter activity was observed following cotransfection with Nur77, but not Nur77-△DBD. However, this effect was also not observed after mutation AAAGGTCA sequence in the NBRE site to AAAAAACA of the COX-2 promoter. These results indicated that NBRE site is essential for Nur77-mediated transactivation of COX-2 promoter activity. Further study indicated that overexpression of Nur77 inhibited both basal and oxLDL-induced COX-2 promoter activity and mRNA expression. Similarly, overexpression of Nur77, but not Nur77-△DBD, significantly attentuated oxLDL-induced COX-2 protein expression. Enhancement of the activity of Nur77 by 6-MP also suppressed oxLDL-induced COX-2 mRNA and protein expression. On the other hand, Nur77specific siRNA significantly enhanced COX-2 mRNA and protein expression upon stimulation, as compared with control group. These findings indicated that Nur77 could attenuate COX-2 expression, which may negatively regulate the inflammatory response in oxLDL-induced macrophages. The detailed mechanism of oxLDLinduced Nur77 expression and its role in regulating the inflammatory response is described as follows: Macrophages activation by inflammatory stimuli of oxLDL could activate both proinflammatory pathway of COX-2 and anti-inflammatory pathway of Nur77. While Nur77 exerts anti-inflammatory properties which attenuates COX-2 expression, balances of these pathways and protects against inflammatory injury in activated macrophages. However, it would be interesting to further investigate whether other pathways are involved in regulating the inflammatory response by Nur77 in oxLDL-induced macrophages. In summary, our data suggest that Nur77 suppresses the secretion of inflammatory cytokines, which exhibits anti-inflammatory role in oxLDL-induced macrophages. We have also presented a novel molecular mechanism through which Nur77 could negatively regulate the inflammatory response in activated macrophages via inhibition of COX-2 expression. Thus, Nur77 may be a novel target for the prevention and treatment of atherosclerosis. Conflict of interest Nothing to declare. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (30670880, 30600242 and 30971185); Shanghai Municipal Natural Science Foundation (08XD14026, 08ZR1413500 and 09JC1409400); Vascular Biology, Vascular Benefit Foundation (07060670075); and Shanghai Renji Hospital (ZD0705). We

Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

thank X.K. Zhang from the Burnham Institute for Medical Research in California, USA, for his generous help and excellent technical assistance.

[16]

Appendix A. Supplementary data [17]

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.yjmcc.2010.03.023.

[18]

References [19] [1] Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med 2005;352:1685–95. [2] Kirii Hirokazu, Niwa Tamikazu, Yamada Yasuhiro. Lack of Interleukin-1β decreases the severity of atherosclerosis in ApoE-deficient mice. Arterioscler Thromb Vasc Biol 2003;23:656–60. [3] Shen LH, Zhou L, Wang BY, Pu J, Hu LH, Chai DJ, et al. Oxidized low-density lipoprotein induces differentiation of RAW264.7 murine macrophage cell line into dendritic-like cells. Atherosclerosis 2008;199:257–64. [4] Pei L, Castrillo A, Chen M, Hoffmann A, Tontonoz P. Induction of NR4A orphan nuclear receptor expression in macrophages in response to inflammatory stimuli. J Biol Chem 2005;280:29256–62. [5] Bonta PI, van Tiel CM, Vos M, Pols TW, van Thienen JV, Ferreira V, et al. Nuclear receptors Nur77, Nurr1, and NOR-1 expressed in atherosclerotic lesion macrophages reduce lipid loading and inflammatory responses. Arterioscler Thromb Vasc Biol 2006;26:2288–94. [6] Bensinger SJ, Tontonoz P. Integration of metabolism and inflammation by lipidactivated nuclear receptors. Nature 2008;454:470–7. [7] Evans Paul C. Nur77 orphaned at birth but adopted by the nuclear factor kB signaling pathway. Circ Res 2009;104:707–9. [8] Bonta PI, Pols TW, deVries CJ. NR4A nuclear receptors in atherosclerosis and veingraft disease. Trends Cardiovasc Med 2007;17:105–11. [9] Cheng LE, Chan FK, Cado D, Winoto A. Functional redundancy of the Nur77 and Nor-1 orphan steroid receptors in T-cell apoptosis. EMBO J 1997;16:1865–75. [10] Lin B, Kolluri SK, Lin F, Liu W, Han YH, Cao X, et al. Conversion of Bcl-2 from protector to killer by interaction with nuclear orphan receptor Nur77/TR3. Cell 2004;116:527–40. [11] Zetterstrom RH, Solomin L, Jansson L, Hoffer BJ, Olson L, Perlmann T. Dopamine neuron agenesis in Nurr1-deficient mice. Science 1997;276:248–50. [12] Martinez-Gonzalez J, Badimon L. The NR4A subfamily of nuclear receptors: new early genes regulated by growth factors in vascular cells. Cardiovasc Res 2005;65: 609–18. [13] Hsu HC, Zhou T, Mountz JD. Nur77 family of nuclear hormone receptors. Curr Drug Targets-Inflamm Allergy 2004;3:413–23. [14] Hu LH, He B, Shen LH, Zhou L, Pu J, Jiang LS, et al. Nuclear receptor Nur77 inhibits oxidized low density lipoprotein induced lipid loading in macrophages. Zhonghua Xin Xue Guan Bing Za Zhi 2008;36:1032–6. [15] Steinbrecher UP, Parthasarathy S, Leake DS, Witztum JL, Steinberg D. Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and

[20] [21]

[22]

[23]

[24]

[25]

[26] [27] [28] [29] [30]

[31]

[32]

311

degradation of low density lipoprotein phospholipids. Proc Natl Acad Sci 1984;81: 3883–7. Taketa K, Matsumura T, Yano M, Ishii N, Senokuchi T, Motoshima H, et al. Oxidized low density lipoprotein activates peroxisome proliferator-activated receptor-α (PPARα) and PPARγ through MAPK-dependent COX-2 expression in macrophages. J Biol Chem 2008;283:9852–62. Johnson GL, Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002;298:1911–2. Wansa KD, Harris JM, Yan G, Ordentlich P, Muscat GE. The AF-1 domain of the orphan nuclear receptor NOR-1 mediates trans-activation, coactivator recruitment, and activation by the purine anti-metabolite, 6-mercaptopurine. J Biol Chem 2003;278:24776–90. Burleigha ME, Babaevb VR, Yanceyb PG, Majorb AS, McCalebb JL, Oatesa JA, et al. Cyclooxygenase-2 promotes early atherosclerotic lesion formation in ApoEdeficient and C57BL/6 mice. J Mol Cell Cardiol 2005;39(3):443–52. Wilson TE, Fahrner TJ, Johnston M, Milbrandt J. Identification of the DNA binding site for NGFI-B by genetic selection in yeast. Science 1991;252:1296–300. Arkenbout EK, de Waard V, van Bragt M, van Achterberg TA, Grimbergen JM, Pichon B, et al. Protective function of transcription factor TR3 orphan receptor in atherogenesis: decreased lesion formation in carotid artery ligation model in TR3 transgenic mice. Circulation 2002;106:1530–5. de Waard V, Arkenbout EK, Vos M, Mocking AI, Niessen HW, Stooker W, et al. TR3 nuclear orphan receptor prevents cyclic stretch-induced proliferation of venous smooth muscle cells. Am J Pathol 2006;168:2027–35. Pires NM, Pols TW, de Vries MR, van Tiel CM, Bonta PI, Vos M, et al. Activation of nuclear receptor Nur77 by 6-mercaptopurine protects against neointima formation. Circulation 2007;115:493–500. Zeng H, Qin L, Zhao D, Tan X, Manseau EJ, Van Hoang M, et al. Orphan nuclear receptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its transcriptional activity. J Exp Med 2006;203:719–29. You B, Jiang Y-Y, Chen S, Yan G, Sun J. The orphan nuclear receptor Nur77 suppresses endothelial cell activation through induction of IkBα expression. Circ Res 2009;104:742–9. Blake GJ, Ridker PM. Inflammatory bio-markers and cardiovascular risk prediction. J Intern Med 2002;252:283–94. Tabas I. Apoptosis and plaque destabilization in atherosclerosis: the role of macrophage apoptosis induced by cholesterol. Cell Death Differ 2004;11:s12–6. Nakashima S. Protein kinase C alpha (PKC alpha): regulation and biological function. J Biochem 2002;132:669–75. Tsatsanis C, Androulidaki A, Venihaki M, Margioris AN. Signalling networks regulating cyclooxygenase-2. Int J Biochem Cell Biol 2006;38:1654–61. Senokuchi T, Matsumura T, Sakai M, Matsuo T, Yano M, Kiritoshi S, et al. Extracellular signal-regulated kinase and p38 mitogen-activated protein kinase mediate macrophage proliferation induced by oxidized low-density lipoprotein. Atherosclerosis 2004;176:233–45. Pei L, Castrillo A, Tontonoz P. Regulation of macrophage inflammatory gene expression by the orphan nuclear receptor Nur77. Mol Endocrinol 2006;20: 786–94. Burleigh ME, Babaev VR, Oates JA, Harris RC, Gautam S, Riendeau D, et al. Cyclooxygenase2 promotes early atherosclerotic lesion formation in LDL receptordeficient mice. Circulation 2002;105:1816–23.