Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms Laura F Landweber and Tamara L Horton, Princeton University, Princeton, NJ, USA Jonatha M Gott, Case Western Reserve University, Cleveland, OH, USA r 2013 Elsevier Inc. All rights reserved. This article is a revision of the previous edition article by Tamara L. Horton and Laura F. Landweber, volume 4, pp 415–426, r 2001, Elsevier Inc.

Glossary DNA Deoxyribonucleic acid; a linear polymer of nucleotides that encode information for a cell. Eukaryote An organism whose cell or cells have a membrane-bound nucleus. Mitochondrion A eukaryotic cellular organelle that is used for cellular respiration and energy production. Nucleus Compartment of a cell in which DNA is stored on chromosomes.

Introduction DNA is often described as a blueprint for life, implying that knowledge of the primary sequence of nucleic acids in a genome can give biologists a complete picture of the organism built from these plans. However, neither life nor DNA is that simple. In reality, the sequence of nucleotides in a genome is often just a starting point for the construction of DNA genes and RNA transcripts, which undergo many alterations before organisms actually use the information to fashion their building materials. Two fascinating modes of nucleic acid sequence modification are gene scrambling and RNA editing. Gene scrambling is the rearrangement of DNA segments between a transcriptionally active copy and an archived germline copy. Some genes are broken into more than 50 unordered fragments along a germline chromosome and then unshuffled during formation of an active somatic chromosome. Although gene unscrambling assembles existing DNA information into a new order, RNA editing of transcripts creates completely novel sequences that are not even found in the genome. Processing of edited RNAs alters the transcript length and nucleotide identity, and the transformations can render the expressed RNA form unrecognizably different from the DNA molecule of its origin. Although gene scrambling and RNA editing complicate our analysis of genomes, understanding the methods by which organisms achieve these genetic revisions gives us an appreciation for the diversity of ways by which nucleic acids can store and recombine information.

Protein A three-dimensional macromolecule constructed of amino acids that is formed based on an RNA sequence. Protist A member of a diverse collection of eukaryotes that are defined only by their exclusion from other groups – plants, animals, and fungi. RNA Ribonucleic acid; a linear polymer of nucleotides that is transcribed from DNA.

by the organism, the pieces of the gene must be cut apart and reassembled in the proper sequential arrangement. These stunning acrobatics are performed in the genomes of spirotrichous ciliates, protists that have many unique and mysterious features. However, the fundamental lessons learned from spirotrichs about the flexibility of nucleic acid storage mechanisms are universally important.

Ciliates and Nuclear Dualism Ciliates are unicellular protists that on phylogenetic trees diverge together with apicomplexan parasites and dinoflagellates, all members of the alveolates. The ciliates are a diverse monophyletic group, with certain species estimated to be as evolutionarily distant from one another as corn from rats. All ciliates share two features: a coating of cilia on their cell surfaces and two types of nuclei within single cells. The two nuclei types in each ciliate cytoplasm are different sizes; they are called the micronucleus and the macronucleus. The tiny germline micronucleus is usually transcriptionally inert and functions solely in sexual exchange. In contrast, the large somatic macronucleus is responsible for gene expression, but its contents are only transmitted to asexual offspring. Ciliates reproduce asexually but are capable of exchanging genetic information in a sexual manner independent of reproduction. Conjugation between ciliates leads to an exchange of haploid micronuclei that fuse to form a zygotic nucleus (Figure 1). The biparentally created zygotic nuclei in each mating partner form new micronuclei and macronuclei, and the old macronuclei are destroyed.

Gene Scrambling Gene scrambling occurs when coding segments of DNA are mixed in a randomly or a nonrandomly shuffled order along a chromosome. Before the stored information can be expressed

568

DNA Processing during Macronuclear Formation The micronuclear and macronuclear genomes do not have the same chromosomal structure. As the new macronucleus is

Encyclopedia of Biodiversity, Volume 5

http://dx.doi.org/10.1016/B978-0-12-384719-5.00313-0

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

569

Scrambled Genes and the Unscrambling Process

2

3

1 4

7 5 6 Figure 1 Ciliate sex. The micronuclei of conjugating ciliates undergo meiosis, exchange, and fusion to form new genetic combinations. Between steps 1 and 2, the ciliates conjugate. In the transition from step 2 to step 3, the micronuclei have undergone meiosis to form haploid micronuclei while the old macronuclei have been destroyed. In step 4, the haploid micronuclei are exchanged, and in step 5 they fuse. By step 6, two unique diploid micronuclei are formed with genetic material from both parents. At step 7, a new macronucleus is formed from each new micronucleus.

formed, diploid micronuclear chromosomes become polytene and reproducibly break at certain sites, portions of DNA undergo deletion, chromosomes are rejoined, and new chromosome ends are repaired by telomerase. DNA in the new, shortened chromosomes is differentially amplified so that copy numbers of individual chromosomes in Tetrahymena thermophila range from 45 to 9000. Spirotrichous ciliates tend to have higher copy numbers of chromosomes than the oligohymenophorans such as Tetrahymena, and these copy numbers are regulated by noncoding RNA (Nowacki et al., 2010). Disparities in DNA copy number can relate to levels of gene expression, because the most highly amplified DNAs encode the highly expressed ribosomal RNAs, and the quantities of mRNA synthesis and cognate protein secretion from Euplotes raikovi pheromone genes directly correlate with the genes’ individual macronuclear copy numbers. Coding sequences in micronuclear genes are called MDSs for macronuclear destined sequences (or segments), whereas IESs are internal eliminated (or excised) sequences. MDSs and IESs are superficially analogous to exons and introns, respectively, although the latter two terms only refer to a particular type of RNA processing and do not apply to this unrelated restructuring of DNA. The amount of DNA eliminated during macronuclear formation varies extensively across diverse ciliates: the oligohymenophoran T. thermophila eliminates approximately 15% of its micronuclear genome, whereas spirotrichous ciliates such as Stylonychia and Oxytricha eliminate 95–98% of their micronuclear genomes to create macronuclear chromosomes that typically bear single genes and very little noncoding sequence (Prescott, 1994).

The drastic genome rearrangements of spirotrichous ciliates are not confined to the extreme quantity of DNA deletions. The protein-coding MDSs in Oxytricha and Stylonychia species are sometimes disordered relative to their final position in the macronuclear copy. For example, Prescott and colleagues found that in Oxytricha nova, the micronuclear copy of three genes (actin I, a telomere-binding protein, and DNA polymerase a) must be reordered while intervening DNA sequences are removed in order to construct functional macronuclear genes. In O. nova’s micronuclear genome, the MDSs destined to construct the gene for a telomere end-binding protein (TEBPa) are arranged in the cryptic order 1–3–5–7–9–11–2–4–6–8–10–12–13–14 relative to their conventional order in the macronucleus of 1–2–3–4– 5–6–7–8–9–10–11–12–13–14. Most impressively, the gene encoding DNA polymerase a (DNA pol a) in Oxytricha trifallax and Stylonychia lemnae is scrambled in 48 or more pieces in their germline nuclei (Figure 2). Genome rearrangements in spirotrichous ciliates are guided by maternally inherited noncoding RNAs (Nowacki et al., 2008) – the same noncoding RNAs that regulate chromosome copy number (Nowacki et al., 2010). Homologous recombination at MDS boundaries is also part of the unscrambling process. A segment of DNA sequence at the junction between a particular MDS and its downstream IES usually matches the sequence at the junction of the next MDS and its upstream IES, leading to the correct ligation of the two MDSs over a distance. However, the presence of shared repeat regions as short as an average of 4 base pairs (bp) for nonscrambled MDSs and 9 bp for scrambled MDSs suggests that although these recombination guides may be necessary, they are certainly not sufficient to guide accurate assembly of the genes. Hence, it is more likely that the repeats satisfy a structural requirement for MDS joining rather than perform any role in substrate recognition, which the noncoding template RNAs provide instead. Otherwise, incorrectly spliced products of promiscuous recombination would dominate genomes since 2–4 bp repeats occur many thousands of times throughout the micronucleus. This incorrect hybridization could be a driving force in the production of newly scrambled patterns in evolution. Nonetheless, if this sort of ambiguous unscrambling actually occurs during macronuclear development, then only unscrambled molecules that contain both 5 and 30 telomere addition sequences are selectively retained in the macronucleus, ensuring that most haphazardly ordered genes would be lost. The pattern of MDSs in the micronuclear genome provides a strong clue to both the ciliates’ orchestration of the unscrambling process and the mutational events that led to the scrambling in each gene sequence. For example, in the previously mentioned gene encoding O. nova’s TEBPa protein, the micronuclear order of MDSs (1–3–5–7–9–1–2–4– 6–8–10–12–13–14) predicts a spiral mechanism in the unscrambling path to link odd and even segments in order (Figure 3). In contrast, the DNA polymerase a gene has at least 44 MDSs in O. nova and 50 in O. trifallax scrambled in a nonrandom order with an inversion in the middle; some MDSs

570

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

1 2 3 4 5 6 7 In the macronucleus, gene-sized chromosomes assemble from their scrambled building blocks; telomere repeats (boxes) mark and protect the surviving ends.

In the micronucleus, coding regions of DNA are dispersed over the long chromosome. 1

3 5 7

4 6 2

Figure 2 Overview of gene unscrambling. Dispersed coding MDSs 1–7 reassemble during macronuclear development to form the functional gene copy (top), complete with telomere addition to mark and protect both ends of the gene.

12

2

4

3 11

1 5

10 9 7

6

8 Figure 3 Spiral model for unscrambling in TEBPa.

are located at least several kilobases away from the main gene in an unmapped fragment. A hairpin structure could help resolve MDSs during unscrambling (Figure 4). Comparison of the O. nova sequence with that of O. trifallax allows precise predictions for the origin of new scrambled segments (Figures 4 and 5). Micronuclear junction sequences promote pairing between each MDS and the noncoding IES on the opposite side of a hairpin (Figure 4). Any mutation that leads to an increased stabilization of this hairpin during macronuclear chromosome formation would also increase the chance of

homologous recombination between correct segments within the micronuclear genome. Consequently, selection would favor the appearance of more scrambled MDS segments in such a nonrandomly scrambled gene since each additional MDS adds more paired junction sequences to stabilize the hairpin necessary for unscrambling the already existing MDSs. This explanation is consistent with the additional MDSs in the DNA pol a gene in O. trifallax. The arrangement of MDSs 2, 6, and 10 in O. nova could have given rise to the arrangement of eight new MDSs in O. trifallax (Figure 4) by multiple crossovers in the germline micronucleus. Thus, the appearance of an inversion leads to the introduction of new MDSs in a nonrandomly scrambled pattern. Gene scrambling in ciliates may have evolved as a product of an increased capacity for homologous recombination. The reason why it has been detected in only a restricted group of ciliates might reflect their increased levels of recombination, which generate both the scrambled arrangements and the subsequent process of unscrambling them. Although it is difficult to propose an adaptive argument for the presence and maintenance of such a complicated gene-decoding procedure, the forces that have led to ciliate nuclear dualism might be at the root of its origin. For example, Yao and Doerder independently proposed that the different roles required of the micronucleus and macronucleus, as well as intragenomic competition, may have led to disruptive selection acting on their genetic organization and chromatin structure. The accommodation of both types of nuclei within a single cytoplasm may promote or at least permit profound differences to arise that distinguish active genes from transmitted genes. Likewise, the gene scrambling present in certain spirotrichous ciliates may be a profound exaggeration of this solution to problems presented by ciliate life.

RNA Editing RNA editing is the alteration of RNA sequences by base modifications, substitutions, insertions, and deletions (see Knoop, 2011

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

O. nova

571

Inversion 18 16

12

14

10

8

6 4

xx

1

xx 3 5

20

2

24 22

MDS

7

9

11 13

15 17

19

21 23

25

? Inversion

O. trifallax MDS

29 27

25

23

21

19

(10) (6) 15 13 11 9 7 5

17

1

? 2

3

(2)

4 6

10 12 14

16

18

20

22

24

26 28

30

Figure 4 Model for scrambling of DNA pol a. Vertical lines indicate recombination junctions between scrambled MDSs guided by direct repeats. MDS 1 contains the start of the gene. MDS 10 in O. nova can also give rise to three new MDSs (13–15) in O. trifallax, one scrambled on the inverted strand, by two spontaneous intramolecular recombination events (x’s) in the folded orientation shown. Oxytricha nova MDS 6 can give rise to O. trifallax MDSs 7–9 (MDS 8, shaded, is only 6 bp and was not identified in Hoffman and Prescott, 1997). Oxytricha trifallax nonscrambled MDSs 2 and 3 could be generated by the insertion of an IES in O. nova MDS 2 (similar to a model suggested by M. DuBois as cited in Hoffman and Prescott, 1997).

Inversion x

x

1

x

3

Inversion 2 1

2

1 x

x

Inversion 4 3

1

4

x

Inversion 2 1

3

1

2

2 Inversion

Figure 5 Proposed model for the origin of a scrambled gene. (Left) Birth of a scrambled gene from a nonscrambled gene by a double recombination with an IES or any noncoding DNA (new MDS order 1–3–2 with an inversion between MDSs 3 and 2). (Middle) Generation of a scrambled gene with a nonrandom MDS order from a nonscrambled gene with an inversion between two MDSs. (Right) Creation of new scrambled MDSs in a scrambled gene containing an inversion. Inversions may dramatically increase the production of scrambled MDSs by stabilizing the folded conformation that allows reciprocal recombination across the inversion.

for a comprehensive review). The process of rewriting RNA transcripts by editing produces major effects, even adding more than half of the nucleotides in some mitochondrial transcripts of kinetoplastid protozoa. In contrast, the impact of editing can still be large even in cases in which the physical extent of editing is small. For instance, in human apolipoprotein B transcripts, the replacement of a single cytidine (C) by uridine (U) results in the conversion of a glutamine codon to a stop codon; the early termination of apo B translation shortens the resultant polypeptide by half and removes a functional domain. Since the initial discovery of RNA editing as extensive U insertions and deletions in trypanosome mitochondrial mRNAs, many additional and apparently unrelated examples of editing have been found in organisms ranging from Ebola virus to humans. Substitution or modification editing exists in many nuclear and organellar RNAs among a diverse set of eukaryotes, whereas insertion or

deletion editing is found in a much more limited set of organisms (Table 1). On first inspection, the use of RNA editing in gene expression seems inefficient. Why not encode genes in their final edited form rather than require an additional revision step? However, organisms exploit the ability to edit RNA in amazingly clever ways. RNA editing allows the persistence of deleterious mutations in DNA genomes: new point mutations and frameshifts may persist if they are repaired at the RNA level, and DNA copies of genes and control sequences in crowded genomes may overlap but generate two or more discrete RNA sequences through editing. RNA editing also offers an array of posttranscriptional modes of genetic regulation through the formation of start and stop codons, intron splice sites, and open reading frames and the potential alteration of microRNA (miRNA)–mRNA interactions, mRNA localization, and stability. Editing even permits

572

Types and distribution of RNA editing

Organism Metazoa

A4I

C4U 1

mRNA tRNA2 ncRNA3

Viruses

HDV9 HIV10

Plants (Plantae)

cp tRNA2

Kinetoplastids (Excavata)

tRNA19

U4C 4

mRNA

þA

þC

þG

þU

A

U

6

mRNA7

mt mRNA

mt tRNA5

mt tRNA8 Ebola11

mt mRNA13 mt tRNA14 cp mRNA15 cp tRNA16

Paramxyoviruses12

mt mRNA17 cp mRNA18

tRNA19 mt tRNA20

Naegleria (Excavata)

mt mRNA23

Myxomycetes (Amboebozoa)

mt mRNA24

N to N

mt mRNA21

mt mRNA24,25 mt rRNA26

mt mRNA27 mt rRNA28 mt rRNA26

mt mRNA24,25 mt rRNA25

mt mRNA24 mt tRNA28 mt rRNA26

mt mRNA22

mt mRNA29

mt tRNA30

Acanthamoeba (Amboebozoa)

mt tRNA31

Spizellomyces (Fungi)

mt tRNA32

Dinoflagellates (Protista)

mt mRNA33 mt rRNA34 mt tRNA34

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

Table 1

1

Sommer et al. (1991). See Ju¨hling et al. (2009). 3 Luciano et al. (2004). 4 Powell et al. (1987); Chen et al. (1987). 5 Janke and Pa¨a¨bo (1993). 6 Burger et al. (2009). 7 Li et al. (2011). 8 Yokoboro and Pa¨a¨bo (1995a, b). 9 Luo, et al. (1990). 10 Doria et al. (2009). 11 Volchkov et al. (1995). 12 Thomas et al. (1988). 13 Covello and Gray (1989); Gualberto et al. (1989); Hiesel (1989). 14 Marechal-Drouard et al. (1993); Binder et al. (1994). 15 Hoch et al. (1991). 16 Kugita et al. (2003). 17 Gualberto et al. (1990); Schuster et al. (1990). 18 Yoshinaga et al. (1996). 19 Rubio et al. (2006). 20 Alfonzo et al. (1999). 21 Benne et al. (1986). 22 Shaw et al. (1988). 23 Ru¨dinger et al. (2011). 24 Gott et al. (1993). 25 Bundschuh et al. (2011). 26 Mahendran et al. (1994). 27 Mahendran et al. (1991). 28 Antes et al. (1998). 29 Gott et al. (2005). 30 Gott et al. (2010). 31 Lonergan and Gray (1993). 32 LaForest et al. (1997). 33 Lin et al. (2002). 34 Zauner et al. (2004). Abbreviations: mRNA, messenger RNA; tRNA, transfer RNA; rRNA, ribosomal RNA; ncRNA, non-coding RNA; mt, mitochondrial; cp, chloroplast. 2

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms 573

574

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

gRNA 4

gRNA 2

3′

5′ gRNA 3

5′ gRNA 1 5′

5′

5′ 3′

** mRNA

Figure 6 Editing of a gene region by four overlapping gRNAs. Thick lines in the mRNA are encoded in the mitochondrial DNA. Thin shaded lines are inserted U’s; the two asterisks are deleted U’s (Reproduced from Maslov DA and Simpson L (1992) The polarity of editing within a multiple gRNA-mediated domain is due to formation of anchors for upstream gRNAs by downstream editing. Cell 70: 459–467.). Thin lines in the gRNAs are guide nucleotides (A or G) that pair with inserted U’s. Vertical lines indicate Watson–Crick base pairs; colons indicate G:U wobble base pairs, illustrating formation of well-paired ‘‘anchors’’ between the 50 ends of gRNAs and the corresponding region of the mRNA.

single genes to produce multiple peptides, allowing combinatorial protein diversity. The following sections review several models that explain our current understanding of the molecular and evolutionary basis of numerous forms of RNA editing.

Kinetoplastids: Cryptogenes to Proteins by U Insertion or Deletion Kinetoplastids are a group of unicellular protists that include the pernicious trypanosome and leishmania parasites responsible for deadly human diseases such as African sleeping sickness and Chagas disease. Translation of mitochondrial mRNAs of kinetoplastids is impossible without massive RNA editing of the transcripts by insertion and deletion of uridine (reviewed in Aphasizhev and Aphasizheva, 2011). This editing drastically rewrites the coding regions of the transcripts by introducing and fixing frameshifts as well as creating stop and start codons. In some kinetoplastid mRNAs, editing creates more than 90% of the amino acid codons. Since the DNA copies of many genes are barely recognizable as sources of their cognate mRNAs, they have been named cryptogenes. Although all kinetoplastids display specific, reproducible editing patterns in certain mitochondrial mRNAs, comparison of the editing patterns in a particular gene transcript across a variety of species reveals a trend in the extent of RNA editing within each species. The earlier diverging kinetoplastids exhibit more editing within the cytochrome c oxidase III transcript than their later diverging relatives. This implies that this type of RNA editing is ancient within this lineage and that its use has decreased over evolutionary time. However, the lack of U insertion or deletion editing in any other type of organism suggests that it arose specifically within the kinetoplastid lineage. Cavalier-Smith proposed that glycosomes, special organelles found only in kinetoplastids, may provide a clue to the origin of editing in these protists. Glycosomes permit an efficient anaerobic lifestyle, during which RNA editing may have become fixed by drift in the seldom-used mitochondria of the early kinetoplastids. Guide RNAs (gRNAs) provide the specificity of the kinetoplastid editing mechanism (Blum et al., 1990). They are small RNA transcripts that guide the editing machinery through base pairing with the mRNAs in edited regions. The gRNAs are complementary to small segments of the fully

edited mRNAs and thus serve as minitemplates to guide the addition and deletion of uridines from the preedited mRNA as they form a locally double-stranded RNA helix. An unpaired A or G in a gRNA signals for an editing event to insert a U into the mRNA. Complete editing of a mRNA often requires a set of many overlapping gRNAs. The affiliated set of overlapping gRNAs sequentially edit the mRNA from its 30 end to its 50 end. During editing, a complex of proteins called the editosome catalyzes the insertion and deletion of uridines until the length of each paired gRNA–mRNA region is maximized. The extent of G–U wobble pairs and conventional A–U and G–C pairs of each gRNA–mRNA pair directs the cascade of editing. Each subsequent gRNA binds the mRNA more stably than the last by possessing more Watson–Crick base pairs (A–U and G–C) in the anchor portion of the gRNA, leading to an overall 30 –50 directionality of editing (Figure 6). Guide RNAs are encoded in the kinetoplastid mitochondrial genome. Kinetoplastids are named after the unusual structure of their mitochondrial genomes, which consist of a kinetoplast, a network of DNA inside a single, large mitochondrion located at the base of the flagellum. In one kinetoplastid subdivision, the trypanosomatids, the kinetoplast consists of a few identical maxicircles of 20–40 kb intertwined with thousands of heterogeneous minicircles of 0.5–3 kb. The maxicircles encode the mitochondrial genes and cryptogenes for respiratory proteins, ribosomal proteins, and rRNA. The only known role of the minicircles is to encode gRNAs. Bodonids, the other group of kinetoplastids, share the presence of a DNA network with the trypanosomatids but have a different structure for their minicircle homologs. In Bodo caudatus, the minicircles are noncatenated 1.4-kb circles. Trypanoplasma borreli has minicircle-like structures of 170 and 200 kb, with tandem 1-kb repeats encoding most gRNAs. How did the gRNAs and minicircles come to exist as they do today? A product of mitochondrial DNA recombination provides a plausible explanation. Lunt and Hyman (1997) identified a minicircle of DNA excised from the major mitochondrial genome circle in a nematode. Similar intramolecular recombination within a kinetoplastid maxicircle might have led to the formation of minicircles encoding tiny portions of mRNAs whereas other unrecombined maxicircles still contained complete functional copies of the mRNA. If the minicircle copy of a gene fragment acquired a promoter that allowed transcription of an antisense RNA, then such a gene-encoding complementary RNA could have

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

given rise to a proto-gRNA. If the protein equipment responsible for catalyzing RNA insertions and deletions simultaneously arose or was recruited from another function to serve in RNA editing, then mutations in the mitochondrial mRNA could have been repaired by editing. Guide RNA-containing minicircles would be selectively retained in the genome, ensuring their survival.

Myxomycetes: Multiple Editing Types in Coding and Noncoding RNAs Physarum polycephalum is a myxomycete, or plasmodial slime mold. It takes on many shapes and sizes throughout its life, morphing from microscopic amoeba to a multinucleate syncytium that can be several feet across and then forming millimeter-scale delicate, mushroom-like fruiting bodies. Mitochondrial transcripts for almost all messenger and structural RNAs in Physarum and related myxomycetes require several types of RNA editing to create functional products (reviewed in Gott and Rhee, 2007). Editing is extensive in Physarum; deep sequencing of total plasmodial mitochondrial RNA revealed 1333 sites of editing (Bundschuh et al., 2011). Most editing events involve the insertion of nonencoded nucleotides, with a total of 1347 nt added at 1324 sites. The vast majority are insertions of cytidine, but there are also a small number of specific and reproducible insertions of uridines, guanosines, an adenosine, and dinucleotides. The remaining editing sites involve three instances of A deletion, the replacement of the 5’ nucleotide of two of the mitochondrially encoded tRNAs (see Mitochondrial tRNA Editing), and four sites of C to U changes. A unique feature of myxomycete editing is that they are the only organisms known to combine multiple types of editing within the same transcript. For example, P. polycephalum’s 1.5-kb transcript encoding cytochrome c oxidase subunit I (coI) undergoes 59 C insertions, a single U insertion, three dinucleotide insertions, and four sites of C-U base conversion (Figure 7). Insertion and base conversion editing have distinct evolutionary histories. The col gene of Stemonitis flavogenita, another myxomycete, shares all three types of insertional editing with P. polycephalum but lacks the C-U conversion editing in this transcript. Even the three

575

types of insertional editing did not all evolve simultaneously because U insertional editing is found in all myxomycetes to date, whereas C insertion and dinucleotide insertion are found only in some slime molds. Studies in isolated mitochondria have demonstrated that multiple editing mechanisms are at work in P. polycephalum mitochondria. Nucleotide insertions occur cotranscriptionally, whereas C-U changes and 5’ tRNA editing are posttranscriptional processes. Sites of nucleotide insertion are sprinkled throughout structural RNAs and in the coding regions of edited mRNAs but are never closer than nine nucleotides. Template regions required for editing fall within B9 bp upstream of and downstream from nucleotide insertion sites, but no consensus sequences have been identified. Nucleotide insertion is remarkably accurate and efficient, with virtually all steady-state RNAs completely edited. Myxomycete insertional editing is clearly different from the posttranscriptional uridine insertion and deletion editing found in the kinetoplastids and, not surprisingly, no evidence for guide RNAs has been found by either deep sequencing or labeling studies. It is also mechanistically distinct from the cotranscriptional polymerase stuttering observed in paramyxoviruses (see Paramyxovirus and Ebola Virus: Polymerase Stutter Unites Reading Frames). The sites of C-U editing in P. polycephalum are all in first or second codon position, similar to the case in plant organelle editing. Also similar is that the process of editing restores the conserved peptide sequence in this region so that the unedited S. flavogenita transcript codes for the same amino acids at these positions as does the edited Physarum transcript. In contrast, insertion sites are biased toward the third codon position, with roughly half of the added nucleotides found at this position.

Plant Organelles: C-U and U-C Editing Restores Conserved Amino Acids Plant mitochondria employ rampant RNA editing, often involving hundreds of cytidine to uridine conversions (reviewed in Takenaka et al., 2008; Chateigner-Boutin and Small, 2010). Plant chloroplast RNAs are also edited by C to U changes, but in higher plants these changes are much less frequent (see

CUAUUUUUAGUCUGCAUCUAGCUGGUGUUUCUUCUAUGUUAGGUGCUAUCA AUUUCAUUUGUACCAUUAAAAAUAUGCGUCUUAAAGGAUUAACAGGAGAAC GUUUAUCUUUAUUUGUUUGGGCUGUAUUAGUAACUGUGAUUUUAUUAUUAC UUUCACUGCCUGUCUUAGCAGGUGCUAUCACUAUGUUAUUAACUGAUCGUA AUUUUAAUACAUCUUUUUUUGAUGCAACCGGUGGUGGAGAUCCUAUUUUAU AUCAACAUUUGUUUUGGUUUUUUGGCCAUCCAGAAGUUUACAUUUUAAUUU UACCUGGUUUUGGUAUCGUUUCUAUUAUUAUUCAAGCCUAUGCUAAUAAAG CUAUUUUUGGUUAUUUAGGUAUGGUGUAUGCUAUGUUGUCUAUUGGUAUCU UGGGUUUUAUAGUGUGGGCUCAUCAUAUGUAUACUGUAGGAUUGGAUGUGG AUACUCGCGCUUAUUUCACCGCUGCUACUAUGAUCAUUGCUGUGCCAACCG Figure 7 RNA editing in P. polycephalum. Partial P. polycephalum mRNA sequence for gene encoding cytochrome c oxidase subunit I, with underlined text indicating inserted nucleotides and boxed text indicating C-U substitution events. Reproduced from Gott JM, Visomirski LM, and Hunter JL (1993) Substitutional and insertional RNA editing of the cytochrome c oxidase subunit 1 mRNA of Physarum polycephalum. Journal of Biological Chemistry 268: 25483–25486.

576

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

Stern et al., 2010). A limited number of plant lineages also contain uridine to cytidine changes in chloroplast or mitochondrial RNAs. Although the mechanism for plant organellar editing is not fully understood, when cytidine triphosphate (CTP) residues of in vitro transcripts were labeled on their aphosphate and on their cytosine base, the labels were retained after editing. This indicates that the C-U changes occur through a deamination of cytidine rather than a base or nucleotide substitution. In vitro and in organello experiments have shown that editing signals in plant mitochondria are largely local, with essential sequences falling within B16–20 nt upstream and 0–6 nt downstream of the edited C. The involvement of pentatricopeptide repeat proteins (PPR) in plant organellular editing was first demonstrated by Kotera et al. (2005), who showed that editing of a specific site within the Arabidopsis thaliana chloroplast ndhD gene was dependent on the PPR protein CRR4. Since that time, many other members of the extensive PPR protein family have been linked to editing of specific editing sites in mitochondria or chloroplasts (reviewed in Fujii and Small, 2011). As of yet, however, no enzymatic activity has been demonstrated for these PPR proteins, leaving open the identity of the factor(s) involved in the deamination (or potentially transamination) and amination reactions. RNA editing is present in both the mitochondrial and the chloroplast genomes of land plants, but it is absent in green algae and the liverwort Marchantia polymorpha. This distribution suggests that the plant editing systems share common components and may have arisen simultaneously in both organelles or have been transferred from one to the other. Plants that possess the ability to perform base conversion may exploit the conversions as a mechanism for repairing sequences disturbed by mutational drift. The observation that most of the edited sites in plant genes are in first or second codon positions supports this hypothesis because editing produces nonsynonymous changes in amino acids. Furthermore, Malek et al. (1996) found that the level of mitochondrial editing in plants correlates with G/C content. Indeed, Lu and associates (1998) determined that editing ‘‘reverses’’ all nonsynonymous U-C substitutions at the RNA level in col genes from eight gymnosperm species, eliminating almost all variation in the predicted protein sequences. Editing can regulate translation or enzyme activity; it creates stop and start codons and proteins of varying function. However, the pressure toward loss of editing appears to be greater than any selective advantage it confers since Shield and Wolfe’s (1997) comparison of edited sites over many plant species reveals a high rate of mutation of the genes toward the edited (uridine) nucleotide.

Mitochondrial tRNA Editing: Acceptor Stems and Anticodons Mitochondrial genomes of some organisms seem pressed to economize space. ‘‘Junk’’ DNA is held to a minimum, and genes immediately abut their neighbors. Some tRNA genes overlap their 5’ and 3’ extremities. Base pairing of a tRNA’s 50 and 30 ends is essential to form an acceptor stem for aminoacylation. In mitochondria, incompletely paired tRNA acceptor stems are repaired by exchanging mismatched bases on one side of the acceptor stem for ones that complement those

bases present on the opposing stem (see Knoop, 2011). Thus, editing and the presence of an internal acceptor stem template allow the genome to repair mutations that may occur in response to selection for either nucleotide compositional bias or sequence compression. In land snails, squids, and chickens, the overlapping ends of certain tRNAs disturb the crucial base pairing of the acceptor stems. RNA editing activity restores complementarity to these tRNAs by replacing mismatched 30 guanosine, uridine, and cytidine nucleotides with adenosines, possibly by some form of polyA polymerase. In a platypus tRNA, there are three exchanged nucleotides (U-A, U-C, and A-C) in the 30 half of the stem to complement the 50 half of the acceptor stem, leading to the suggestion that this reaction might be carried out by a CCA-adding enzyme. The introduction of all four nucleotides in the 30 portion of the acceptor stem is required for the maturation of mitochondrial tRNAs in the centripede Lithobius forficatus and the jakobid protist Saculamonas ecuadoriensis, suggesting a requirement for an RNA-dependent RNA polymerase in these cases. A different mechanism is required when nucleotides within the 50 portion of the acceptor stem are replaced using the 30 part of the acceptor stem as template. Initially described in the ameboid protist Acanthamoeba and the fungus Spizellomyces, this form of editing has also been found in the myxomycete P. polycephalum and is predicted to occur in many other species (Table 1). Editing of the Acanthamoeba and Spizellomyces tRNAs involves the removal of uridines, adenosines, and cytidines within the first three 50 positions and replacement with purines complementary to a corresponding pyrimidine on the 30 template side of the stem. This unusual 30 –50 polymerization reaction is likely to be catalyzed by proteins related to Thg1, the enzyme responsible for the addition of a G1 residue to the 50 end of tRNAHis. Thg1-like proteins (or TLPs) from Dictyostelium discoideum have recently been shown to accurately repair truncated tRNA editing substrates (Abad et al., 2011). Mitochondrial tRNAs are also subject to A-to-I and C-to-U editing events (reviewed in Paris et al., 2012). An extreme example of tRNA C to U editing is provided by the tRNAPro from the lycophyte Isoetes engelmannii, which differs from its mitochondrial template at 18 different sites (Grewe et al., 2009). More commonly, editing changes the decoding properties of a tRNA by affecting the anticodon loop. In opossums and other marsupials, the DNA encoding mitochondrial tRNAAsp has the wrong anticodon. Although the rest of the tRNA has a canonical tRNAAsp sequence, the anticodon, GCC, will pair with glycine codons rather than aspartic acid codons. About half of the tRNAAsp transcripts are not edited and consequently are aminoacylated with glycine. The remainder are edited by a C-U change that restores the GUC aspartic acid anticodon. These are charged correctly with aspartic acid since this anticodon is used as a determinant of tRNA charging. Surprisingly, the standard tRNAGly (with a UCC anticodon) is present in the genome as well, and it could theoretically recognize all four GGN glycine codons by wobble. However, a mutation just outside of the anticodon region of this tRNAGly renders it incapable of recognizing the two glycine codons which the mutated tRNAAsp can bind. A second example of anticodon editing occurs in trypanosomatid tRNATrp. In trypansomes, all tRNAs are imported from the

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

cytoplasm. To decode the UGA codon as tryptophan in the mitochondria (but not the cytoplasm), a portion of the imported tRNATrp is edited within the anticodon, which results in a change from CCA to UCA. Bo¨erner and Pa¨a¨bo (1996) suggest that marsupial mitochondrial editing became fixed through two mutational steps. First, a mutation occurred in the anticodon for tRNAAsp, transforming it into a functional tRNAGly. Genomes with this mutation were still viable since the altered tRNA could regain its necessary function as tRNAAsp through editing. A subsequent mutation in the original tRNAGly was not lost because of redundancy in tRNAGly activity: a mutation outside the anticodon of the original tRNAGly eventually left it unable to recognize the two glycine codons that the newly mutated tRNAAsp/Gly could translate. After this second mutation in the original tRNAGly, back mutation of the tRNAGly/Asp anticodon (to form simply a tRNAAsp anticodon) would be deleterious since the mutant tRNAGly/Asp serves double duty by pairing with both aspartic acid and glycine codons. Thus, RNA editing permitted a deleterious change in a genome and then became fixed when a second mutation made editing a requirement for expression of mitochondrial proteins.

Human Apo B and Beyond: Shorter Peptides and Regulatory Possibilities Apolipoprotein B is present in two different forms in both humans and rodents. The long form, apo B100, is part of verylow-density lipoprotein particles that have a role in cholesterol metabolism, whereas the short form, apo B48, contributes to chylomicrons that transport dietary lipids. The two forms of the apo B protein are actually encoded by a single gene with mRNA that undergoes tissue-specific C-U RNA editing at nucleotide position 6666. The editing converts an encoded glutamine codon into a stop codon to create the short form of the peptide (reviewed in Blanc and Davidson, 2010). Editing of the apoB mRNA requires both a cytidine deaminase and an auxiliary factor. The catalytic peptide is apo B RNA editing cytidine deaminase subunit 1 (APOBEC-1), whereas site recognition is conferred by an RNA-binding protein, ACF (APOBEC-1 complementing factor). Specificity of the cytidine deamination is determined by the primary sequence of the apo B RNA transcript, particularly an 11-base mooring sequence, located just five nucleotides downstream of the edited site. In addition to this required mooring sequence, three other efficiency elements are found in the 140-base region surrounding the edited cytidine. These upstream and downstream elements increase the effectiveness of the editing reaction. Although the apoB transcript is the only known APOBEC-1 target within coding regions in normal cells, a recent transcriptome-wide comparison of intestinal mRNAs from wild type and apobec-1 deficient mice identified another 32 APOBEC-1 targets within 30 untranslated regions (30 UTRs). The majority of these new sites occur near sequence elements with significant homology to the apoB mooring sequence, making it likely that these C to U changes are catalyzed by the same enzymatic machinery (Rosenberg et al., 2011). Although the functionality of these editing events has not been demonstrated as yet, most fall within conserved noncoding

577

regions, suggesting possible roles in message stabilization, translational efficiency, and localization. Cytidine deamination may also play a role in human tumorogenesis. For example, an imperfect APOBEC-1 mooring sequence and efficiency elements are present within the coding region of the neurofibromatosis type I (NF1) tumor suppressor gene. Despite slight differences in position and sequence context, normal individuals exhibit very low levels of editing. In comparison, tumor tissues from NF1-affected individuals showed more than eight times the normal quantity of edited transcript. The NF1 gene encodes the neurofibromin protein, which is a putative homolog of yeast proteins in the ras signal transduction pathways. The proposed GTPase activating domain of the neurofibromin lies just downstream of the NF1 editing site, and indeed C-U RNA editing at the site transforms an arginine codon into a premature translation stop upstream of the domain. Thus, the editing of the NF1 transcript most likely cripples the tumor-suppressing activity of neurofibromin. APOBEC-1 is part of a family of cytidine deaminases. The related activation-induced cytidine deaminase (AID) also works at the polynucleotide level, but its substrate is DNA rather than RNA. AID is involved in antibody diversification, playing roles in both somatic hypermutation (SHM) and class switch recombination (CSR) via the deamination of genomic cytidines to uridines. A third set of related proteins, the APOBEC3 subfamily, is involved in the suppression of retroelements and restriction of retroviral replication.

A-I Deamination: Multiple Peptides, Multiple Regulatory Possibilities Deamination of another type alters additional RNA sequences in a range of metazoans. Removal of adenosine’s amino group yields inosine, a nucleotide that the translation machinery reads as guanosine (reviewed in Nishikura, 2010). A number of the initially identified A-I transitions cause predicted amino acid changes, most frequently in neurotransmitter receptors and ion channels (reviewed in Pullirsch and Jantsch, 2010). Editing at most sites is not complete, resulting in the generation of multiple protein isoforms within the cell. Editing events within glutamate receptors, for example, adjust the calcium channel permeability and the speed of the desensitization response. Likewise, in the serotonin receptors, protein loops encoded by the edited region of the RNA interact with G proteins to turn on signaling pathways. The editing, along with alternative splicing, allows the exquisite fine-tuning of neural responses by increasing combinatorial protein diversity available from a single transcript. Posttranscriptional regulation demands the expenditure of less time and energy than transcription of multiple gene sequences. More recently, transcriptome-wide and bioinformatics studies have revealed many thousands of additional sites of A to I editing in humans, nearly all within introns and 30 UTRs (e.g., Li et al., 2009). The majority of these changes fall within repetitive elements (especially Alu elements) capable of generating long, partially double-stranded regions of RNA, a key feature of editing targets (see next paragraph). Possible functions of editing within these noncoding regions include alterations in miRNA–mRNA interactions (potentially altering

578

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

the level of translation), creation or elimination of splice sites, and changes in nuclear retention or stability. A family of enzymes called ADARs (adenosine deaminase acting on RNA) is responsible for A-I editing activity. The largely double-stranded RNA regions required for ADAR action within coding regions are elegantly provided by pairing of the exonic sequences with intronic sequences in the pre-mRNAs. Neither mature mRNAs whose introns have been removed by splicing nor pre-mRNAs with mutations disturbing intron–exon complementarity act as substrates for editing in transfected cell lines. Mice genetically disabled for A-I editing at a single site demonstrate the importance of RNA editing in glutamate receptors. Brusa et al. (1995) removed an intron region crucial for creating a double-stranded editing substrate from the mouse GluR-B gene. Heterozygotes for this editingdisabled allele displayed severe epileptic seizures and premature death within 3 weeks of birth. The decrease in edited mRNA levels led to a fivefold increase in the calcium flow into their neurons and serious damage to their nervous systems. At least three different ADAR enzymes are expressed differentially in human tissues, and they display discrete editing abilities at various mRNA sites in vitro. Mice engineered to lack ADAR2 demonstrate a phenotype similar to the GluR-B intron deletion described previously, but these mice can be ‘‘rescued’’ by the introduction of a GluR-B gene that is edited at the Q/R site, indicating that this target is acted on by ADAR2. ADAR3 knockout mice appear normal, but ADAR1 deficient mice are not viable, displaying widespread apoptosis and defects in hematopoiesis. Scott (1995) suggested that ADARs might have evolved for an antiviral function, destabilizing RNA genomes by modification and subsequent unwinding. Interestingly, a devious viral genome coopted this function and uses host adenosine deaminases to its own benefit. Hepatitis delta virus (HDV), a single-stranded RNA subvirus of hepatitis B, has only one known gene product, the delta antigen. The short form of delta antigen stimulates replication of the genome, whereas the long form of the antigen suppresses replication and is necessary for packaging HDV. The short and long forms of the delta antigen differ only by a single A-I base change of the negative strand, or antigenome. The base conversion replaces a stop codon at the end of the shorter peptide’s mRNA with a tryptophan codon to allow read through of the longer peptide. In vitro, ADAR1 is capable of inducing this A-I change on the antigenome of the HDV virus, suggesting that either this or a related enzyme edits HDV in vivo. In exquisite control of the reaction, the long-form delta antigen acts as a repressor of editing in a negative feedback loop. The repression prevents accumulation of unduly high levels of longedited antigen, which would lower the level of viral replication.

Paramyxoviruses and Ebola Virus: Polymerase Stutter Unites Reading Frames Two other types of viruses also capitalize on RNA editing processes as a method of increasing information storage while under pressure for genome size constraint. The RNA genomes of the paramyxoviruses have several overlapping genes. Some

of these genes are activated for expression by ribosomal choice, whereas others become available by cotranscriptional RNA editing. The polymerase may slip as it travels through a purine run, adding from one to six extra guanosines, depending on the sequence present in the particular virus species. The stuttering polymerase thereby fuses coding regions together to make extended versions of genes. Many viruses use an apparently similar mechanism to add poly A tails to mRNA transcripts. When the RNA polymerase reaches the U-rich regions, it adds additional nontemplated adenines to create the tails. In paramyxoviruses, RNA editing activity may be related to a process that corrects genome length, maintaining length in multiples of six nucleotides. The substrate for the RNA polymerase is the RNA genome complexed with the capsid in hexamer-length segments. Hausmann and colleagues (1996) note that if the genome length is not a multiple of six, then the polymerase inserts or deletes guanosines or adenines from the same region in which the RNA editing occurs. Another RNA virus, the infamous Ebola virus, uses a comparable mechanism to insert adenines into a sequence to unite two reading frames. In this case, the sequence of the site where adenine addition occurs appears similar to viral poly A addition sites. In contrast to the paramyxovirus editing, the additions occur even when the RNA is produced by a nonnative polymerase and thus must be intrinsic to the template sequence or structure. T7 transcription of the Ebola mRNA in vitro results in edited product, although in a lower quantity than when transcribed by Ebola’s RNA polymerase. Thus, once considered a molecular anomaly unique to protists, RNA editing is now recognized as a vital part of gene expression in a wide distribution of eukaryotes and their viruses. Organisms can alter RNA sequences through many different mechanisms by recruiting enzymes such as deaminases, nucleases, ligases, and special polymerases to specific RNA editing tasks. Editing clearly arose multiple times in evolutionary history in the various forms of both insertional and substitutional editing, all of which profoundly affect the expression of RNAs, the products they form, and the biological processes in which they participate. RNA editing is significant in cancers, cholesterol regulation, and neural function in vertebrates as well as in the de novo creation of coding sequences from obscured mitochondrial genes. Furthermore, the impact of editing on the genomes that employ it is astounding. Genomes that use editing may become increasingly lenient toward persistence of deleterious mutations. Large amounts of genetic information and control devices may be confined to small spaces. Lastly, RNA editing, like gene scrambling, establishes a device for generating combinatorial sequence diversity.

Appendix List of Courses 1. Genetics 2. Microbial Diversity

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

See also: Diversity, Molecular Level. Genes, Description of. Genetic Diversity

References Abad MG, Long Y, Wilcox A, Gott JM, Gray MW, and Jackman JE (2011) A role for tRNA(his) guanylyltransferase (Thg1)-like proteins from Dictostelium discoideum in mitochondrial 50 -tRNA editing. RNA 17: 613–623. Alfonzo JD, Blanc V, Esfevez AM, Rubio MA, and Simpson L (1999) C to U editing of the anticodon of imported mitochondrial tRNA(Trp) allows decoding of the UGA stop codon in Leishmania tarentolae. EMBO Journal 18: 7056–7062. Antes T, Costandy H, Mahendran R, Spottswood M, and Miller D (1998) Insertional editing of mitochondrial tRNAs of Physarum polycephalum and Didymium nigripes. Molecular and Cellular Biology 18: 7521–7527. Aphasizhev R and Aphasizheva I (2011) Mitochondrial RNA processing in trypanosomes. Research in Microbiology 162: 655–663. Benne R, Van Den Burg J, Brakenhoff JP, Sloof P, Van Boom JH, and Tromp MC (1986) Major transcript of the frame shifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA. Cell 46: 819–826. Binder S, Marchfelder A, and Brennicke A (1994) RNA editing of tRNA(Phe) and tRNA(Cys) in mitochondria of Oenothera berteriana is initiated in precursor molecules. Molecular & General Genetics 244: 67–74. Blanc V and Davidson NO (2010) Apobec-1 mediated RNA editing. Wiley Interdisciplinary Reviews Systems Biology and Medicine 2: 594–602. Blum B, Bakalara N, and Simpson L (1990) A model for RNA editing in kinetoplastid mitochondria: ‘‘guide’’ RNA molecules transcribed from maxicircle DNA provide the edited information. Cell 60: 189–198. Bo¨rner GV and Pa¨a¨bo S (1996) Evolutionary fixation of RNA editing. Nature 383: 225. http://www.ncbi.nlm.nih.gov/pubmed/8805696 Brusa R, Zimmermann F, Koh DS, et al. (1995) Early-onset epilepsy and postnatal lethality associated with an editing-deficient GluR-B allele in mice. Science 270: 1677–1680. Bundschuh R, Altmuller J, Becker C, Nurnberg P, and Gott JM (2011) Complete characterization of the edited transcriptome of the mitochondrion of Physarum polycephalum using deep sequencing of RNA. Nucleic Acids Research 39: 6044–6055. Burger G, Yan Y, Javadi P, and Lang B (2009) Group I-intron trans-splicing and mRNA editing in the mitochondria of placozoan animals. Trends in Genetics 25: 381–386. Chateigner-Boutin A-L and Small I (2010) Plant RNA editing. RNA Biology 7: 213–219. Chen S, Habib G, Yang C, et al. (1987) Apolipoprotein B-48 is the product of a messenger RNA with an organ-specific in-frame stop codon. Science 238: 363–366. Covello PS and Gray MW (1989) RNA editing in plant mitochondria. Nature 341: 662–666. Doria M, Neri F, Gallo A, Farace MG, and Michienzi A (2009) Editing of HIV-1 RNA by the double-stranded RNA deaminase ADAR1 stimulates viral infection. Nucleic Acids Research 37: 5848–5858. Fujii S and Small I (2011) The evolution of RNA editing and pentatricopeptide repeat genes. New Phytologist 191: 37–47. Gott JM, Parimi N, and Bundschuh R (2005) Discovery of new genes and deletion editing in Physarum mitochondria enabled by a novel algorithm for finding edited mRNAs. Nucleic Acids Research 33: 5063–5072. Gott JM and Rhee AC (2007) Insertion/deletion editing in Physarum polycephalum. In: Go¨ringer HU (ed.) RNA Editing. Berlin: Springer. Gott JM, Somerlot BH, and Gray MW (2010) Two forms of RNA editing are required for tRNA maturation in Physarum mitochondria. RNA 16: 482–488. Gott JM, Visomirski LM, and Hunter JL (1993) Substitutional and insertional RNA editing of the cytochrome c oxidase subunit 1 mRNA of Physarum polycephalum. Journal of Biological Chemistry 268: 25483–25486. Grewe F, Viehoever P, Weisshaar B, and Knoop V (2009) A trans-splicing group I intron and tRNA-hyperediting in the mitochondrial genome of the lycophyte Isoetes engelmannii. Nucleic Acids Research 37: 5093–5104. Gualberto JM, Lamattina L, Bonnard G, Weil J-H, and Grienenberger J-M (1989) RNA editing in wheat mitochodria results in the conservation of protein sequences. Nature 341: 660–662.

579

Gualberto JM, Weil J-H, and Grienenberger J-M (1990) Editing of the wheat coxIII transcript: evidence for twelve C to U and one U to C conversions and for sequence similarities around editing sites. Nucleic Acids Res 18: 3771–3776. Hausmann S, Jacques JP, and Kolakofsky D (1996) Paramyxovirus RNA editing and the requirement for hexamer genome length. RNA 10: 1033–1045. Hiesel R, Wissinger B, Schuster W, and Brennicke A (1989) RNA editing in plant mitochondria. Science 246: 1632–1634. Hoch B, Maier R, Appel K, Igloi G, and Ko¨ssel H (1991) Editing of a chloroplast mRNA by creation of an initiation codon. Nature 353: 1780180. Hoffman DC and Prescott DM (1997) Evolution of internal eliminated segments and scrambling in the micronuclear gene encoding DNA polymerase alpha in two Oxytricha species. Nucleic Acids Research 25: 1883–1889. Janke A and Pa¨a¨bo S (1993) Editing of a tRNA anticodon in marsupial mitochondria changes its codon recognition. Nucleic Acids Research 21: 1523–1525. Ju¨hling F, Mo¨rl M, Hartmann R, Sprinzl M, Stadler P, and Pu¨tz J (2009) tRNAdb 2009: Compilation of tRNA sequences and tRNA genes. Nucleic Acids Research 37: d159–d162. Knoop V (2011) When you can’t trust the DNA: RNA editing changes transcript sequences. Cellular and Molecular Life Sciences 68: 567–586. Kotera E, Tasaka M, and Shikanai T (2005) A pentatricopeptie repeat protein is essential for RNA editing in chloroplasts. Nature 433: 326–330. Kugita M, Yamamoto Y, Fujikawa T, Matsumoto T, and Yoshinaga K (2003) RNA editing in hornwort chloroplasts makes more than half the genes functional. Nucleic Acids Research 31: 2417–2423. Laforest M, Roewer I, and Lang B (1997) Mitochondrial tRNAs in the lower fungus spizellomyces punctatus: tRNA editing and UAG ‘stop’ codons recognized as leucine. Nucleic Acids Research 25: 626–632. Li JB, Levanon EY, Yoon J-K, et al. (2009) Genome-wide identiification of human RNA editing sites by parallel DNA capturing and sequencing. Science 324: 1210–1213. Li M, Wang I, Li Y, et al. (2011) Widespread RNA and DNA sequence differences in the human transcriptome. Science 333: 53–58. Lin S, Zhang H, Spencer D, Norman J, and Gray MW (2002) Widespread and extensive editing of mitochondrial mRNAs in dinoflagellates. Journal of Molecular Biology 320: 727–739. Lonergan KM and Gray MW (1993) Editing of transfer RNAs in acanthamoeba castellanii mitochondria. Science 259: 812–816. Luciano DJ, Mirsky H, Vendetti NJ, and Maas S (2004) RNA editing of a miRNA precursor. RNA 10: 1174–1177. Luo G, Chao M, Hsieh S-Y, Sureau C, Nishikura K, and Taylor J (1990) A specific base transition occurs on replicting hepatitis delta virus RNA. Journal of Virology 64: 1021–1027. Mahendran R, Spottswood MS, Ghate A, Ling ML, Jeng K, and Miller DL (1994) Editing of the mitochondrial small subunit rRNA in physarum polycephalum. The EMBO Journal 13: 232–240. Mahendran R, Spottswood MR, and Miller DL (1991) RNA editing by cytidine insertion in mitochondria of physarum polycephalum. Nature 349: 434–438. Malek O, La¨ttig K, Hiesel R, Brennicke A, and Knoop V (1996) RNA editing in bryophytes and a molecular phylogeny of land plants. The EMBO journal 15: 1403–1411. Mare´chal-Drouard L, Ramamonjisoa D, Cosset A, Weil J, and Dietrich A (1993) Editing corrects mispairing in the acceptor stem of bean and potato mitochondrial phenylalanine transfer RNAs. Nucleic Acids Research 21: 4909–4914. Maslov DA and Simpson L (1992) The polarity of editing within a multiple gRNAmediated domain is due to formation of anchors for upstream gRNAs by downstream editing. Cell 70: 459–467. Nishikura K (2010) Functions and regulation of RNA editing by ADAR deaminases. Annual Review of Biochemistry 79: 321–349. Nowacki M, Haye JE, Fang W, Vijayan V, and Landweber LF (2010) RNA-mediated epigenetic regulation of DNA copy number. Proceedings of the National Academy of Sciences 107: 22140–22144. Nowacki M, Vijayan V, Zhou Y, Schotanus K, Doak TG, and Landweber LF (2008) RNA-mediated epigenetic programming of a genome-rearrangement pathway. Nature 451: 153–158. Paris Z, Fleming IMC, and Alfonzo JD (2012) Determinants of tRNA editing and modification: Avoiding conundrums, affecting function. Seminars in Cell and Developmental Biology 23: 269–274. Powell L, Wallis S, Pease R, Edwards Y, Knott T, and Scott J (1987) A novel form of tissue-specific RNA processing produces apolipoprotein-B48 in intestine. Cell 50: 831–840.

580

Nucleic Acid Biodiversity: Rewriting DNA and RNA in Diverse Organisms

Prescott DM (1994) The DNA of ciliated protozoa. Microbiology and Molecular Biology Reviews 58: 233–267. Pullirsch D and Jantsch MF (2010) Proteome diversification by adenosine to inosine RNA-editing. RNA Biology 7: 205–212. Rosenberg BR, Hamilton CE, Mwangi MM, Dewell S, and Papavasiliou FN (2011) Transcriptome-wide sequencing reveals numerous APOBEC1 mRNA-editing targets in transcript 30 UTRs. Nature Structural & Molecular Biology 18: 230–238. Rubio MAT, Ragone FL, Gaston KW, Ibba M, and Alfonzo JD (2006) C to U editing stimulates A to I editing in the anticodon loop of a cytoplasmic threonly tRNA in Trypanosoma brucei. Journal of Biological Chemistry 281: 115–120. Ru¨dinger M, Fritz-Laylin L, Polsakiewicz M, and Knoop V (2011) Plant-type mitochondrial RNA editing in the protist Naegleria gruberi. RNA 17: 2058–2062. Schuster W, Hiesel R, Wissinger B, and Brennicke A (1990) RNA editing in the cytochrome b locus of the higher plant Oenothera berteriana includes a U-to-C transition. Molecular and Cellular Biology 10: 2428–2431. Scott J (1995) A place in the world for RNA editing. Cell 81: 833–836. Shaw JM, Feagin JE, Stuart K, and Simpson L (1988) Editing of the kinetoplastid mitochondrial mRNAs by uridine addition and deletion generates conserved amino acid sequences and AUG initiation codons. Cell 53: 401–411. Sommer B, Kohler M, Sprengel R, and Seeburg PH (1991) RNA editing in brain controls a determinant of ion flow in glutamate-gated channels. Cell 67: 11–19.

Stern DB, Goldschmidt-Clermont M, and Hanson MR (2010) Chloroplast RNA metabolism. Annu. Rev. Plant Biol. 61: 125–155. Takenaka M, Verbitskiy D, van der Merwe JA, Zehrmann A, and Brennicke A (2008) The process of RNA editing in plant mitochondria. Mitochondrion 8: 35–46. Thomas SM, Lamb RA, and Paterson RG (1988) Two mRNAs that differ by two nontemplated nucleotides encode the amino co-terminal proteins P and V of the paramyxovirus SV5. Cell 54: 891–902. Volchkov VE, Becker S, Volchkova VA, et al. (1995) GP mRNA of Ebola virus is edited by the Ebola virus polymerase and by T7 and vaccinia virus polymerases. Virology 214: 421–430. Yokobori S-I and Pa¨a¨bo S (1995a) Transfer RNA editing in land snail mitochodria. Proceedings of the National Academy of Sciences of the USA 92: 10432–10435. Yokobori S-I and Pa¨a¨bo S (1995b) tRNA editing in metazoans. Nature 377: 490. Yoshinaga K, Iinuma H, Masuzawa T, and Uedal K (1996) Extensive RNA editing of U to C in addition to C to U substitution in the rbcL transcripts of hornwort chloroplasts and the origin of RNA editing in green plants. Nucleic Acids Research 24: 1008–1014. Zauner S, Grellinger D, Laatsch T, Kowallik KV, and Maier UG (2004) Substitutional editing of transcripts from genes of cyanobacterial origin in the dinoflagellate Ceratium horridum. FEBS Letters 577: 535–538.