Nucleophosmin in the pathogenesis of arsenic-related bladder carcinogenesis revealed by quantitative proteomics

Toxicology and Applied Pharmacology 242 (2010) 126–135

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y t a a p

Nucleophosmin in the pathogenesis of arsenic-related bladder carcinogenesis revealed by quantitative proteomics Shu-Hui Chen a, Yi-Wen Wang b, Jue-Liang Hsu a, Hong-Yi Chang b, Chi-Yun Wang c, Po-Tsun Shen a, Chi-Wu Chiang c, Jing-Jing Chuang d, Hung-Wen Tsai e, Po-Wen Gu f, Fang-Chih Chang g, Hsiao-Sheng Liu h,⁎ , Nan-Haw Chow b,c,i,⁎ a

Department of Chemistry, College of Sciences, National Cheng Kung University, Tainan 701, Taiwan Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan c Graduate Institute of Molecular Medicine, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan d Department of Microbiology and Immunology, National Chiayi University, Chiayi 600, Taiwan e Department of Pathology, National Cheng Kung University Hospital, Tainan 704, Taiwan f Department of Clinical Pathology, Chang Gung Memorial Hospital, Tao-Yuan 333, Taiwan g The Instrument Center, National Cheng Kung University, Tainan 701, Taiwan h Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan i Department of Pathology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan b

a r t i c l e

i n f o

Article history: Received 28 April 2009 Revised 1 September 2009 Accepted 22 September 2009 Available online 7 October 2009 Keywords: Arsenic Bladder Carcinogenesis Proteomics Nucleophosmin Isoflavones

a b s t r a c t To investigate the molecular mechanisms of arsenic (As)-associated carcinogenesis, we performed proteomic analysis on E7 immortalized human uroepithelial cells after treatment with As in vitro. Quantitative proteomics was performed using stable isotope dimethyl labeling coupled with two-dimensional liquid chromatography peptide separation and mass spectrometry (MS)/MS analysis. Among 285 proteins, a total of 26 proteins were upregulated (ratio N 2.0) and 18 proteins were downregulated (ratio b 0.65) by As treatment, which are related to nucleotide binding, lipid metabolism, protein folding, protein biosynthesis, transcription, DNA repair, cell cycle control, and signal transduction. This study reports the potential significance of nucleophosmin (NPM) in the As-related bladder carcinogenesis. NPM was universally expressed in all of uroepithelial cell lines examined, implying that NPM may play a role in human bladder carcinogenesis. Upregulation of NPM tends to be dose- and time-dependent after As treatment. Expression of NPM was associated with cell proliferation, migration and anti-apoptosis. On the contrary, soy isoflavones inhibited the expression of NPM in vitro. The results suggest that NPM may play a role in the As-related bladder carcinogenesis, and soybean-based foods may have potential in the suppression of As/NPM-related tumorigenesis. © 2009 Elsevier Inc. All rights reserved.

Introduction Arsenic (As) is widely distributed in the environment and humans can be exposed to it through environmental, agricultural, and occupational routes. The commonest route of exposure is ingesting water containing inorganic As. Many people living in India, Bangladesh, Inner Mongolia, Taiwan, and North and South America have drunk As-contaminated water. In southwestern of Taiwan, residents of chronic arsenism area caused by drinking artesian well water have blackfoot disease (BFD), a peripheral vascular disease (Tseng, 1977). The association of As exposure in the BFD-endemic area with a high

⁎ Corresponding authors. H.-S. Liu is to be contacted at Fax: +886 6 2766195. N.-H. Chow, Fax: +886 6 2082705. E-mail addresses: [email protected] (H.-S. Liu), [email protected] (N.-H. Chow). 0041-008X/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.taap.2009.09.016

incidence of, as well as mortality from, bladder cancer has been consistently shown in a number of epidemiological studies (Chen et al., 1986; Chiou et al., 1995). In addition, there is a dose–response effect between As exposure and cancer prevalence in the BFDendemic area. Our cohort study also revealed a positive association of As exposure with a higher histological grading of primary tumors, supporting the importance of As in the pathogenesis of human bladder cancer (Chow et al., 1997). Several mechanisms have been proposed to explain for As-related carcinogenesis, including DNA damage, genotoxicity, altered DNA methylation, oxidative stress, altered cell proliferation, co-carcinogenesis, and tumor promotion (Kligerman and Tennant, 2007). However, the mechanism involved in As-related bladder carcinogenesis remains elusive. Proteomics is designed to characterize the diversity of proteins at different levels, including protein identification, post-translational modifications, relative abundance levels, and interactions with other proteins. Most prior reports have focused on measuring global

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

changes between two experimental groups and their relative abundance. In addition to two-dimensional gel electrophoresis (2DGE) (O'Farrell, 1975), stable-isotope labeling with non-gel separation of multidimensional liquid chromatography (LC) has been developed as a mass spectrometry (MS)-based approach for quantifying protein expression (Gygi et al., 1999). The ion intensity of each isotopic pair detected using MS may represent their relative abundance, and has successfully distinguished protein expression between two biological samples. Stable isotope-based dimethyl labeling produces a dimethyl-labeled terminal amine or a monomethylated proline N-terminus using reductive methylation (Hsu et al., 2003). This labeling strategy increases the signal of the a1 ions, and thus is useful for confirmation of the assigned peptide sequences, including post-translational modifications (Fu and Li, 2005). Because As was considered a tumor promoter (Kligerman and Tennant, 2007), E7 immortalized human uroepithelial cells were subjected to subchronic exposure to As in vitro to mimic the molecular mechanism of As-associated carcinogenesis in vivo. In the present study, we investigated the molecular profiling of As-related bladder carcinogenesis using stable isotope-based dimethyl labeling coupled with shot-gun two dimensional peptide separation. Then, both biological effects of candidate gene and its molecular basis of bladder carcinogenesis will be examined in vitro. Materials and methods Chemicals. Both DTT and sodium cyanoborohydride (NaCNBH3) were purchased from Sigma-Aldrich Company (St. Louis, MO); sodium acetate, sodium bicarbonate, and formic acid were obtained from Honeywell Riedel-de Haën (Seelze, Germany). Acetonitrile and ammonium hydroxide were purchased from Mallinckrodt Baker, Inc. (Phillipsburg, NJ). Formaldehyde-D2 was obtained from Aldrich Chemical Company, Inc. (Milwaukee, WI). Iodoacetamide and trypsin were purchased from Fluka (Buchs, Switzerland) and Promega (Madison, WI), respectively. Arsenite (As2O3) (Sigma-Aldrich) was dissolved in 1 M of NaOH at 104 mg/l as a stock solution. It should be noted that, although trivalent arsenicals are more cytotoxic to human urothelial cell line than arsenate (Cohen et al., 2002), there is no epidemiological evidence in support of different consequences of exposure to arsenate or arsenite in human. Cell culture and As treatment. The bladder cancer cell lines, E7 immortalized uroepithelial cells, and primary uroepithelial cells (PE) were maintained as previously described (Cheng et al., 2005). For long-term culture, a total of 5 × 105 E7 cells were plated onto a 100-mm Petri dish and fed with Dulbecco's modified Eagle's medium (DMEM) containing As2O3 (0.05 ppm) and 10% fetal bovine serum (FBS) for 3 weeks. The medium containing As was replaced every 2 to 3 days. Those plates grown to near confluence were subcultured, and fed with As at the same concentration. Levels of soluble arsenic in the culture media were verified using inductively coupled plasma-mass spectrometry (details described in supplement 1). Tryptic digestion and dimethyl labeling. Cells from experimental and control groups (E7 cells) were lysed, and proteins being reduced, digested by trypsin, and then labeled with dimethyl group as previously described (Hsu et al., 2003). Briefly, a total of 70 μg total proteins were dialyzed to remove the unwanted salts and chemicals. Next, the lysates were reduced using 10 mM of DTT at 37 °C for 1 h, and incubated with iodoacetamide (20 mM) in the dark at room temperature (approximately 25 °C) for 2 h. The protein mixtures were then digested by trypsin, with an enzyme-to-substrate ratio of 1:100, at 37 °C for 18 h. The product was then mixed with 4% formaldehydeH2 and formaldehyde-D2 (20 μl) for untreated and treated lysates, respectively. The mixture was incubated with 0.6 M of NaCNBH3

127

(20 μl) at room temperature for 2 h. The excess formaldehyde-H2 and -D2 was consumed using 4% ammonium hydroxide, and the remaining reagents were removed using a centrifugal filter (Microcon; Millipore, Bedford, MA) with the cutoff set at 10 kDa. Peptide separation. After centrifugation, peptides were mixed and fractionated using a strong cation-exchange cartridge (SCX, HiTrap SP HP; Amersham Biosciences, Uppsala, Sweden). Six fractions eluted with 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, and 1 M of NaCl, respectively, were collected, desalted using a desalting column (Poros OligoR3; Applied Biosystems, Foster City, CA), dried in a freeze drier (SpeedVac VR Mini/Maxi; HETO Lab Equipment, Alleröd, Denmark), redissolved in 5% acetonitrile containing 0.1% formic acid, and finally analyzed using nanoLC-ESI-MS/MS as previously described (Hsu et al., 2003). MS instrumentation and database search. The ESI-MS data were obtained using a high resolution OA-TOF mass spectrometer (Q-TOFmicro; Micromass, Manchester, UK) equipped with a nanoflow HPLC system (LC Packings, Amsterdam, The Netherlands). A total of 30 μl of sample fraction was injected, concentrated using a nano-precolumn cartridge (i.d. = 300 μm × 1 mm, 5 μm) (C18, P/N160458; LC Packings), and separated using a C18 column (i.d. = 75 μm, o.d. = 280 μm × 15 cm, 3 μm) (LC Packings). Mobile phase A consisted of 0.1% formic acid in 5% acetonitrile solution, and mobile phase B consisted of 0.1% formic acid in 80% acetonitrile solution. A linear gradient from 5% to 90% B over a 60-min period at a flow rate of 250 nl/min was used. The outlet of the column was connected to an ESI tip using capillary tubing (i.d. = 20 μm, o.d. = 280 μm). For identification, the MS/MS spectra were performed using survey scans as described (Hsu et al., 2003). Both MassLynx 4.0 and Global ProteinLynx software were used to produce the peak lists and combine all sequential scans with the same precursor. The survey scan was from m/z 400 to 1600 and the MS/MS scan was from m/z 50 to 2000. The threshold to switch from MS to MS/MS was 10 counts, and the reverse experiment was carried out at signals below 3 counts or after 8 s. A quality assurance score of 10 was used to filter out poor quality MS/MS. The settings to generate the pkl-files were (i) background subtraction using a polynomial order of 15 and a 20% peak curve, (ii) peak smoothing using Savitzky Golay mode with 3.00 channels and 2 smooths, and (iii) peak centroid using a minimum of 4 peak widths at half height and an 80% centroid top. Swissprot (human) on an in-house MASCOT server was used for database search. The mass tolerance was set as 0.2 Da for both precursor and product, and the mass was calibrated before each run. Dimethyl labeling onto both N-terminal and lysine residues was chosen for variable modifications; Carbamidomethyl (C) was chosen for fixed modification, and one missed cleavage on lysine was allowed. A cutoff score of 20 was set to eliminate low-score peptides, and only rank-1 (best match for each MS/MS) peptides were included. Other details regarding parameters used for database search are listed in the Supplemental Material (Table 1 in Supplement 2). MS/MS spectra of the dimethylated ions identified were then examined using manual interpretation to confirm the enhanced a1 ion that matches the Nterminal amino acid of the assigned sequence. Only proteins and peptides within significant-hit (p b 0.05) were considered. If peptides matched to multiple members of a protein family, only rank-1 (best match for a set of peptides identified) proteins were reported (Table 2 in Supplement 2). Protein quantitation. For quantitation, MS data were acquired throughout the procedure to ensure the representation of all ionized peptides at any given time point. All of the spectra containing both mass peaks of D4- and H4-labeled peptides were combined to produce composite MS spectra. Typically, 20–60 spectra were combined since an average of peak duration for a peptide was about

128

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

20–60 s. Each individual spectrum was acquired within 1 s with an interscan time of 0.1 s. The ratios of D4- and H4-labeled peptides in the composite MS spectra were calculated from the sum of peak heights of the first three isotopic bands corresponding to each isotopic form, and a signal of 10 counts in peak height was considered the detection limit. Only proteins identified by at least one unique peptide and also detected more than twice were quantified. Moreover, the

non-unique peptides with unusually high or low ratios were excluded in the quantitation. The quantitation ratio of a protein was determined by averaging the ratios of all peptides derived from the same protein, and the final ratio was derived from an average of repeated measurements. The ratios were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal standard. The gene ontology of candidate proteins was analyzed using the

Table 1 Upregulated proteins by arsenic treatment in E7 cells. Accession #

Protein description

Norm. Ratio ± SD

MW (kDa)

Functions

Repeat No.

gi|6470150 gi|12653415

BiP protein [Homo sapiens] Heat shock 70-kDa protein 9B (mortalin-2) Heat shock 70 kDa protein 1A variant Malate dehydrogenase 2, NAD (mitochondrial) Heat shock 70-kDa protein 1-like Chaperonin (HSP60)

4.06 ± 0.640 2.58 ± 0.643

72.2 73.9

3 3

2.72 ± 0.643

78.0

2.33 ± 0.732

35.9

3.17 ± 0.643 3.07 ± 0.244

70.2 61.1

3.21 ± 0.169

46.5

4.02 ± 0.901

71.4

gi|177207

4F2 antigen heavy chain

3.02 ± 0.353

58

gi|3288815

Citrate synthase

2.58 ± 0.175

51.9

gi|7331218

Keratin 1

3.95 ± 1.705

66.1

gi|303618

Phospholipase C-alpha

3.17 ± 0.436

57

gi|13606056

DNA dependent protein kinase catalytic subunit Aspartate aminotransferase, mitochondrial precursor (Transaminase A) SET translocation (myeloid leukemia-associated) Thioredoxin peroxidase PMP20 [Homo sapiens] Nucleophosmin anaplastic lymphoma kinase fusion protein NPM, B23

2.77 ± 0.772

470.2

2.72 ± 0.065

47.8

Nucleotide/ATP binding, bridging Nucleotide/ATP binding, unfolded protein binding Nucleotide/ATP binding, unfolded protein binding L-lactate dehydrogenase activity; oxidoreductase activity; L-malate dehydrogenase activity ATP binding; nucleotide binding Nucleotide binding; protein binding; ATP binding; ATP binding; unfolded protein binding Protein disulfide isomerase activity; electron transporter activity; isomerase activity Nucleotide binding; phosphoenolpyruvate carboxykinase activity; phosphoenolpyruvate carboxykinase (GTP) activity; GTP binding; lyase activity; manganese ion binding Catalytic activity; alpha-amylase activity; calcium:sodium antiporter activity Citrate (Si)-synthase activity; citrate (Si)-synthase activity; transferase activity Receptor activity; structural constituent of cytoskeleton; protein binding; protein binding; sugar binding Protein disulfide isomerase activity; cysteine-type endopeptidase activity; phospholipase C activity; electron transporter activity; isomerase activity DNA binding; protein serine/threonine kinase activity; protein binding; transferase activity Aspartate transaminase activity

2.01 ± 0.141

32.1

Nucleosome assembly

2

2.7 ± 0.030

22.2

3

N8

76.1

3.95 ± 0.854

52.8

Peroxidase activity; electron transporter activity; oxidoreductase activity Nucleotide binding; protein serine/threonine kinase activity; transmembrane receptor protein tyrosine kinase activity; receptor signaling protein tyrosine kinase activity; receptor activity; ATP binding; transferase activity Glycine hydroxymethyltransferase activity; transferase activity

7.19 ± 1.329 2.35 ± 0.010

76.3 114.2

2.37 ± 0.422

68.4

3.05 ± 0.103

57.4

2.72 ± 0.406

gi|62089222 gi|12804929 gi|21759781 gi|306890 gi|1710248 gi|2661752

gi|112983

gi|4506891 gi|6166493 gi|7020584

gi|703093

gi|189306 gi|1477646 gi|14250367

gi|339647 gi|2781202

gi|5803013

gi|35038

gi|11139093

Protein disulfide isomerase-related protein 5 Phosphoenolpyruvate carboxykinase (GTP)

Serine hydroxymethyltransferase; glycine hydroxymethyltransferase (EC 2.1.2.1) precursor, mitochondrial-human Nucleolin Plectin [Homo sapiens] Similar to transketolase (Wernicke–Korsakoff syndrome) [Homo sapiens] Thyroid hormone binding protein precursor Chain A, three-dimensional structure of human electron transfer flavoprotein to 2.1 a resolution Endoplasmic reticulum protein 29 isoform 1 precursor [Homo sapiens] Nuclear factor IV [Homo sapiens]

GrpE-like protein co-chaperone [Homo sapiens]

3 3 3 3 3 3

3 2 2 3

3 3

3

2

Nucleotide binding; DNA binding; RNA binding; RNA binding Actin binding; structural constituent of cytoskeleton; structural constituent of muscle Transketolase activity

3 2

2

33.4

Procollagen-proline 4-dioxygenase activity; protein disulfide isomerase activity Electron carrier activity

3.12 ± 0.667

29.0

Protein disulfide isomerase activity

2

3.07 ± 0.006

71.6

2

3.59 ± 0.001

24.3

Nucleotide binding; double-stranded DNA binding; ATP-dependent DNA helicase activity; helicase activity; protein binding; ATP binding; molecular function unknown; hydrolase activity Adenyl-nucleotide exchange factor activity; protein homodimerization activity; unfolded protein binding; chaperone binding

2

2

2

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

GeneCard website (http://www.genecards.org/cgi-bin/carddisp.pl? gene = IBD2). Western blot analysis. The procedure of western blot was described in detail previously (Cheng et al., 2005). Briefly, a total of 50 μg of proteins were prepared on a 12% SDS-PAGE and then transferred to a 0.22-μm polyvinylidene difluoride membrane (Stratagene, La Jolla, CA). The membrane was first hybridized with primary antibody for nucleolin, 14-3-3 proteins (tyrosine 3/tryptophan 5-monooxygenase activation protein) NPM and cyclin D1 (Santa Cruz Biotechnology, Santa Cruz, CA) or proliferating cell nuclear antigen (PCNA) (DAKO A/S, Glostrup, Denmark) at 4 °C overnight, respectively. The phosphorylated Bad (p-Bad), total Bad and caspase 3 (CASP3) antibodies were purchased from Cell Signaling Technology (Danvers, MA). The antibody for CASP3 detects endogenous levels of full length and the large fragment of CASP3. After incubation with secondary antibody (antirabbit or anti-mouse IgG antibody), the blots were developed using an enhanced chemiluminescence detection reagent (Amersham ECL Plus; GE Healthcare (formerly Amersham Biosciences Corp), Piscataway, NJ). The β-actin (ACTB) (Sigma-Aldrich) was used as an internal control. Construction of NPM. The pEGFP-N1, a plasmid containing enhanced green fluorescence protein gene (EGFP) variant and neomycin resistant genes under the control of cytomegalovirus early gene promoter and SV40 early gene promoter, respectively, was purchased from Clontech Laboratories (Palo Alto, CA). Full-length NPM was constructed as follows. First, pDNR-LIB-NPM (BC021983) (Genediscovery) was used as PCR template to amplify

129

NPM (896 bp) containing restriction enzyme digestion site using following PCR primers: CCGGAATTCCGATGGAAGATTCGATGGACAT (sense: the EcoRI cutting site and the translational start site are underlined), and GCGGATCCGCAAGAGACTTCCTCCACTGC (anti-sense: the BamHI cutting site is underlined). The reaction continued for 5 min at 95 °C, followed by 35 cycles of denaturing at 95 °C for 1 min, annealing at 65 °C for 1 min, and elongation at 72 °C for 1 min. The PCR product was subjected to gel electrophoresis and cut at the target site. Then, they were ligated with pEGFP-N1 vector, which was digested by EcoRI and BamHI at 16 °C for 24 h. The construct (pEGFP-N1-NPM) was checked using colony PCR, EcoRI and BamHI digestion, and sequencing. Transient transfection. NPM was transfected using Lipofectamine 2000 (Invitrogen). Briefly, cells (2 × 106) were seeded in 60-mm culture dishes and allowed to reach 80–90% confluence. First, the DNA (10 μg) and the reagent (5 μl) were separately mixed with antibioticfree DMEM supplemented with 10% serum (200 μl). Second, the two were then mixed together at room temperature for 30 min. Third, the mixture was added to the cells and incubated for 6 h. Finally, the antibiotic-free DMEM containing 20% serum was incubated for 18 h and then replaced with normal medium for 24 h. RNA interference. TSGH8301 cells (2 × 105 cells) were seeded in a 6 well plate and cultured in DMEM supplemented with 10% FBS overnight. The next day, cells were transfected with small interfering RNA (siRNA) targeting NPM (sc-29771, Santa Cruz Biotechnology, Santa Cruz, CA), by using Fugene 6.0 transfection reagent (Roche)

Table 2 Downregulated proteins by arsenic treatment in E7 cells. Accession #

Protein description

Norm. Ratio ± SD

MW (kDa)

Functions

Repeat No.

Gi|4502101

Annexin I

0.53 ± 0.026

38.9

3

Gi|340021

Alpha-tubulin

0.39 ± 0.054

50.8

Gi|5174735

Tubulin, beta, 2

0.46 ± 0.035

50.2

Gi|7106439 Gi|62897639 Gi|12655009 Gi|9507215 Gi|33563340

Tubulin, beta 5 Tubulin, beta, 4 variant Tubulin, beta 2B Tubulin, alpha 8 Myosin, heavy polypeptide 14

0.44 ± 0.047 0.49 ± 0.035 0.49 ± 0.035 0.40 ± 0.014 0.60 ± 0.021

50.1 50.8 50.4 50.7 228.9

Gi|4503571

0.6 ± 0.016

47.4

0.53 ± 0.073

37.1

Calcium ion binding; calcium-dependent phospholipid binding

2

Gi|35505

Enolase 1 [Homo sapiens]; 2phosphopyruvate-hydratase alpha-enolase, carbonate dehydratase neurone-specific enolase Unnamed protein product Annexin A8-like Pyruvate kinase

Calcium ion binding; calcium-dependent phospholipids binding; diphosphoinositol-polyphosphate diphosphatase activity; phospholipase A2 inhibitor activity Nucleotide binding; GTPase activity; structural molecule activity; protein binding; GTP binding Nucleotide binding; GTPase activity; structural molecule activity; GTP binding; MHC class I protein binding; unfolded protein binding Nucleotide binding; microtubule; GTP binding Nucleotide binding; microtubule; GTP binding Nucleotide binding; microtubule; GTP binding Nucleotide binding; microtubule; GTP binding Cell motility; cell–cell adhesion; cellular morphogenesis; protein binding Magnesium ion binding; DNA binding; phosphopyruvate hydratase activity; plasminogen activator activity; lyase activity

0.63 ± 0.037

58.4

3

Gi|178402

Aldehyde dehydrogenase type III

0.44 ± 0.127

50.7

Gi|285975

Human rab GDI-GDP dissociation inhibitor 2 Vinculin isoform VCL Phosphoribosylaminoimidazole carboxylase

0.33 ± 0.142

51.0

0.51 ± 0.079 0.51 ± 0.162

117.2 47.7

Magnesium ion binding; pyruvate kinase activity; pyruvate kinase activity; protein binding; transferase activity Aldehyde dehydrogenase [NAD(P)+] activity; electron transporter activity; oxidoreductase activity Rab GDP-dissociation inhibitor activity; Rab GDP-dissociation inhibitor activity; GTPase activator activity actin binding; structural molecule activity; protein binding Phosphoribosylaminoimidazole carboxylase activity; phosphoribosylaminoimidazole succinocarboxamide synthase activity; lyase activity; ligase activity L-lactate dehydrogenase activity; protein binding; oxidoreductase activity GTP/UTP/CTP biosynthesis; cell; negative regulation of cell proliferation; nucleotide metabolism; negative regulation of progression through cell cycle DNA binding

Gi|37639

Gi|4507877 Gi|5453539

Gi|34527427

Lactate dehydrogenase A

0.65 ± 0.059

36.9

Gi|66392203

NME1–NME2; Nm23 protein

0.55 ± 0.031

20.7

Gi|5031931

Nascent–polypeptide-associated complex alpha polypeptide

0.63 ± 0.157

23.3

3 3 3 3 3 3 2 3

3 3 2 2

2 3

2

130

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

according to manufacturer's protocol. After 48 h, the cells were serum starved for 24 h, and then total protein was harvested for immunoblotting analysis or image observation, as described above. The scramble siRNA (Santa Cruz Biotechnology, Santa Cruz, CA) was used as a negative control. Preparing total RNA and reverse transcription polymerase chain reaction (RT-PCR). Total RNA extraction and RT-PCR experiments were performed as previously described (Cheng et al., 2005). The primer sequences for PCR were as follows: nucleophosmin (NPM, nucleolar phosphoprotein B23, numatrin) (GenBank accession No. M26697): Forward: ctgtacagccaacggtttcc Reverse: cttcctccactgccagagat PCNA: Forward: AGGCTCCTGAAGCCGAAAC Reverse: TGGCAACAACGCCGC ACTB (β-actin): Forward: AGAGCTACGAGCTGCCTGAC Reverse: AAAGCCATGCCAATCTCATC Real-time PCR. The relative levels of target genes were measured using real-time PCR (LightCycler system; Roche Diagnostics Corporation, Roche Applied Science, Indianapolis, IN) with SYBR Green I labeling. The reactions were performed in a total volume of 10 μl containing 2 μl of cDNA (prediluted 10-fold), 2.5 mM of MgCl2, and 10 μM each of forward and reverse primers, 1 μl of SYBR Green I, and PCR-grade H2O. The reaction was carried out by 50 cycles of denaturing at 95 °C for 5 s, annealing at 65 °C for 10 s, and elongation at 72 °C for 10 s in the glass capillaries. The product was 139 bp. The primer sequences were as follows: ACTB: Forward AGAGCTACGAGCTGCCTG AC Reverse AAAGCCATGCCAATCTCATC NPM (real-time): Forward cccagaactatcttttcggttg Reverse acaatgtgcaactcatcctttg Methylthiazoletetrazolium (MTT) assay. E7 cells were first seeded in a 6-well plate at concentrations of 2 × 105 cells per well. They were grown for 24 h and then treated with medium containing different concentrations of As. MTT labeling reagent (100 μl, final concentration 0.5 mg/ml) was applied to each well, incubated for 4 h, and then treated with 1 ml of DMSO in each well. The absorbance of purple formazan product was measured at 595 nm. Cell cycle analysis. TSGH8301 cells were trypsinized, washed, and fixed with 70% ethanol at −20 °C overnight. Samples were centrifuged and treated with 1 ml of propidium iodide (PI) working solution (8.6 ml PBS, 200 μl of 5% Triton X-100, 200 μl of 1 mg/ml PI, and 1 ml of 2 mg/ml RNase) at room temperature for 30 min. The analysis was done using a FACScan (Becton-Dickinson, Franklin Lakes, NJ).

Results We found that subchronic exposure of E7 cells to As (0.05 ppm) for 3 weeks is non-lethal confirmed by MTT assay. At this dosage, the growth of E7 cells was comparable to that of control cells. Thus, protein profile of E7 cells after As treatment was investigated. The details of parameters used for database search were listed in Table 1 of supplementary 2. A total of 285 proteins were identified as significant hits from among 573 peptides sequenced ( p b 0.05) (supplementary 2, Table 2); and 258 of the 285 proteins were detected by at least two tryptic peptides. The frequency of proteins identified was plotted against the number of unique peptides per protein (supplementary 2, Fig. 1). More than 250 proteins were identified by at least one unique peptide (supplementary 2, Table 2, in bold font). Even so, the multidimensional protein identification technology scoring algorithm provided by MASCOT (Matrix Science Ltd., UK) was used to preclude the identifications derived from low-score peptides. Moreover, the MS/MS spectra for all proteins identified by single peptide were submitted for examination (supplementary 3). The a1 fragment of dimethylated peptides was greatly increased, and was used as the unique mass tag for sequence confirmation. Each peptide sequenced had to contain the unique amino acid residue that matched the observed a1 mass in their N-terminus. All identified proteins were subjected to analysis at the Babelomics website (http://babelomics.bioinfo.cipf.es/fatigoplus/cgi-bin/fatigoplus.cgi). Approximately 89% of the proteins were related to physiological processes and 73.6% were involved in metabolism. Protein bindingrelated function was observed in 43.9% of the proteins, and nucleotide binding in 27.8% of them. Most of the proteins were located in intracellular components (92.13%), intracellular organelles (70.37%), and membrane-bound organelles (44.91%), respectively. For accurate quantitation, only those proteins detected more than twice were included for subsequent analysis. A complete list of all proteins identified and their pertinent information is shown in supplementary 4. Because GAPDH was almost constant after As treatment (unpublished data), GAPDH was chosen as the internal standard for each measurement. The cut-off ratios for upregulation and downregulation were set at 2 (p b 0.001) and 0.65 (p b 0.05), respectively (Table 1 and Table 2). To verify the accuracy of our approach, we used western blot to analyze the expression pattern of nucleolin (C23) and 14-3-3 from the profile (Fig. 1). Patterns of protein expression in E7 cells basically agree with the results of proteomics analysis (C23 in Table 1 and 14-33 in supplementary 2, Table 2). Because NPM had a substantially higher quantitation ratio than others (p b 0.05, by pair t test) and the

3

H-Thymidine incorporation. To evaluate the rate of DNA synthesis, thymidine incorporation was performed as previously describe with slight modification (Su et al., 2000). Briefly, cells (1 × 103) that had been treated with or without siNPM and 3H-thymidine (0.2 mCi/well) for 18 h were counted. Cellular viability was measured by trypan exclusion test. In vitro wound healing assay. TSGH8301 cells with or without siNPM transfection (5 × 106) were plated on a 1-cm cover slide and grown for 1 day, during which the cells formed a monolayer. Cells were then wounded with a yellow tip (Hsu et al., 2006). The images were recorded every 20 min for a total of 48 h and the distance between the wounded edges was compared. Statistical analysis. Statistic analysis was carried out using the appropriate tests as indicated. p- Values b 0.05 were considered statistically significant.

Fig. 1. Western blot screening for the expression of nucleolin (C23) and 14-3-3 proteins in E7 cells after treatment with As (0.05 ppm) for 3 weeks. Patterns of western blot analysis basically agree with the results of proteomics analysis.

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

sequence was identified for many times, it was chosen for subsequent experiments (Fig. 2). Using western blotting, we first examined the baseline expression pattern of NPM in uroepithelial cells. NPM is universally expressed in all of uroepithelial cells examined, implying that NPM may play a role in human bladder carcinogenesis (Fig. 3). It is interesting to note that immortalized E7 cells, the starting material of this study, had the highest levels of NPM. Thus, TSGH8301 bladder cancer cell line

131

showing the lowest levels of NPM expression was chosen for subsequent experiments in vitro. The TSGH8301 cancer cell line was established from a Taiwanese patient with primary grade II, superficial bladder cancer (Yu et al., 2001). A short-term in vitro model using low-NPM TSGH8301 cancer cell line was then established for subsequent investigation. MTT assay revealed that 0.25 ppm As2O3 treatment for 48 h is non-lethal for TSGH8301 cells (supplementary 5). Then, cell cycle status was

Fig. 2. Representative results of NPM in profiling of E7 cells. (A) LC/MS/MS spectrum for the peptide MSVQPTVSLGGFEITPPVVLR derived from NPM. (B) LC-MS spectrum of the doubly charged isotopic pair with one labeled site (⁎MSVQPTVSLGGFEITPPVVLR). (C) Expression of NPM protein was examined by western blot. The result is also consistent with prediction by proteomics analysis. Arsenic treatment significantly up-regulated the expression of NPM compared with control (p b 0.05, by pair t test).

132

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

Fig. 3. Pattern of NPM expression in human uroepithelial cells analyzed by western blot. Primary culture of uroepithelium (PE) was obtained from a patient with non-neoplastic urinary disease. E7 is an immortalized uroepithelial cell line, RT4 is a grade I bladder cancer cell line, TSGH8301 is a grade II bladder cancer cell line, and both J82 and T24 are grade III bladder cancer cell lines. Levels of NPM in the bladder cancer cell lines were higher than that of primary culture. Levels of NPM were also higher in high-grade, invasive cell lines (J82 and T24) than in low-grade, non-invasive cell lines (RT4 and TSGH8301).

pEGFP-N1-NPM into TSGH8301 cells was confirmed using RT-PCR and western blotting with anti-GFP antibody (unpublished data). We know that E7 cell was transformed by HPV-E7 protein, resulting in inactivation of Rb gene and entry into the cell cycle. The unusually high expression of NPM protein in E7 cells seems to imply the involvement of NPM in the cell cycle progression. To test this hypothesis, we examined the cell cycle alteration of TSGH8301 cells subsequent to NPM overexpression. Flow cytometry revealed a significant decrease of G0/G1 phase (p b 0.05) with a slight increase of S phase after transfection of NPM (data not shown). In addition, RTPCR revealed an upregulated PCNA after NPM transfection (Fig. 6A). To confirm this observation, we knocked down the NPM by siRNA and analyzed the biomarkers of cell proliferation or apoptosis (Figs. 6B and C). The cell growth as measured by PCNA expression was suppressed with an increase of cyclin D1, one of key G1 checkpoint proteins (p b 0.05, by pair t test, respectively) (Fig. 6B). The in vitro DNA synthesis was determined by 3H-thymidine incorporation as described (Su et al., 2000). A significant decrease of DNA synthesis was observed when NPM was knocked down compared to controls (p b 0.001, by Mann–Whitney U test) (Fig. 6C). The results support that NPM may play a role in cell proliferation as described for human liver cancer (Yun et al., 2007). In terms of cell apoptosis (Fig. 6B), functional knock-down of NPM was associated with decreased expression of pro-CASP3 and p-Bad without alteration of total Bad protein (data not shown). It was

analyzed after treatment with As (0.25 ppm) for 24 or 48 h. The G1 phase was decreased by 20% (p b 0.01, by pair t test) with concurrent increase of S phase (p b 0.05, by pair t test) at 48 h (Fig. 4). However, no obvious difference of sub-G1 phase could be found. The inductively coupled plasma-mass spectrometry revealed that concentrations of As decreased for more than 50% at 24 h after treatment (p = 0.003, by pair t test) (supplement 1), suggesting that the observed alteration is a primary effect of As on TSGH8301 cancer cells in vitro rather than a response to stress of As exposure. We found a positive effect of As (0.125 or 0.25 ppm) on NPM expression in TSGH8301 cells revealed by real-time PCR (Fig. 5A). In addition, NPM protein expression showed a time-dependent upregulation after As treatment (0.25 ppm) from 6 to 48 h (Fig. 5B) (p = 0.038, by pair t test). A dose-dependent upregulation of NPM by As treatment was also observed (data not shown). Taken together, these data agree with our findings for E7 cells, supporting the value of short-term model using TSGH8301 cells and the potential of NPM involved in As-related bladder carcinogenesis. The sequence of the NPM construct was verified by cloning PCR, restriction enzyme digestion, and sequencing. The transfection of

Fig. 4. The association of NPM expression with S-phase accumulation in TSGH8301 cells. The cell cycle distribution (G1, S, and G2/M phases) of TSGH8301 cells was measured after treatment with As (0.25 ppm) in 10% FBS and DMEM for 24 and 48 h, respectively. There was a significant decrease of G1 phase (p b 0.01, paired t test) with concurrent increase of S phase (p b 0.05, paired t test) at 48 h. The ratio in Y-axis represents the percent of cell count.

Fig. 5. Expression of NPM in TSGH8301 cells after As treatment. TSGH8301 cells were treated with As at the indicated concentrations for 48 h and analyzed using (A) realtime PCR and (B) western blot, respectively. NPM protein expression showed a timedependent upregulation after As treatment (0.25 ppm) from 6 to 48 h (p = 0.038, by pair t test). The data are means ± SD derived from 3 independent experiments for each group ⁎⁎(p b 0.01, paired t test); ⁎(p b 0.05, paired t test).

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

133

foods could be considered in the prevention of As/NPM-related bladder carcinogenesis. Discussion

Fig. 6. The biological effects of NPM on TSGH8301 cells. (A) The PCNA was up-regulated by NPM transfection in TSGH8301 cells as demonstrated by western blot. P: TSGH8301 parental cells; N1: pEGFP-N1; NPM: pEGFP-N1-NPM; GAPDH: glyceraldehyde-3phosphate dehydrogenase. (B) Knocking down of NPM suppressed the expression of PCNA, pro-CASP3 and p-Bad, with a comparable increase of cyclin D1. (C) In vitro DNA synthesis as determined by 3H-thymidine incorporation revealed a significant decrease in TSGH8301 cells when NPM was knocked down compared to controls (p b 0.001, by Mann–Whitney U test). The values represent a percentage of the incorporation of 3Hthymidine compared to LacZ controls. Parental: TSGH8301 control cells, Si-NPM: transfection of siRNA for NPM, siNC: scramble siRNA as a negative control.

reported that inhibition of p-Bad leads to cell apoptosis and reduced survival (Szanto et al., 2009). In addition, pro-CASP3, a critical executioner of apoptosis, is activated and cleaved in cells committed to apoptosis. So, we treated cancer cells with apoptosis inducercisplatin (Szanto et al., 2009). Cisplatin (2–10 μg/ml) dose-dependently induced the expression of NPM (p b 0.005) (Fig. 7), suggesting that overexpression of NPM may protect cancer cells from apoptosis. The cell migration was also measured by monitoring of wound healing after siNPM transfection (Fig. 8A). Time-lapse recording showed that the distance between the wounded edges was wider in TSGH8301 cells treated with NPM siRNA compared with parental cells ( p b 0.01 and 0.05 at 24 h and 48 h, respectively, by Student t test), supporting the effect of NPM on cell migration (Fig. 8B). The results thus are consistent with As-related cytopathic effects described above; however, the detailed signaling events and regulatory machinery of NPM in human cancer cells deserve intensive investigation. We have shown that soy isoflavones, including genistein, could exhibit a tumor suppression effect on bladder cancer cells in vitro and in vivo at physiologically achievable urine concentrations (5–10 μg/ ml) (Su et al., 2000). As shown in Fig. 9, expression of NPM protein was suppressed in TSGH8301 cells by isoflavones (10 μg/ml) treatment for 72 h (p b 0.01, paired t test), suggesting that soybean

Since As contamination is a global public health problem, identification of mechanisms involved in the As-related bladder carcinogenesis may have impact on reducing the As-induced biohazards worldwide. To address this issue, gene expression profile was produced using cDNA microarray (Su et al., 2006) or oligonucleotide array (Sen et al., 2007). Despite of the fact that more than one hundred genes have been identified, NPM was not altered in these experiments in vitro (Su et al., 2006; Sen et al., 2007). The reason is currently unknown, but different characteristics of immortalized uroepithelial cells chosen may partly explain for the discrepancy. Either SV-HUC-1 or UROtsa cells chosen in these two studies were transformed by simian virus large T antigen (Su et al., 2006; Sen et al., 2007). This is different from our E7 cells that were immortalized by human papillomavirus E7 oncoprotein. It has been shown that coexpression of hTERT and E7 protein induces a limited deregulation of cell cycle checkpoints with a preserved differentiation phenotype (Darimont et al., 2003). However, such differentiation process is blocked in simian virus large T antigen. We demonstrated that expression patterns of both nucleolin and 14-3-3 in E7 cells after As treatment concur with that of predicted by quantitative proteomics. Further support for reliability of this investigation comes from the suggested downregulation of Nm23 protein (gi|gi|5031931|66392203) by As treatment (Table 2). The result is consistent with our hypothesis that inactivation of Nm23 plays a role in the progression of human bladder cancer (Chow et al., 2000). Moreover, a recent model experiment revealed that NPM is one of the nuclear binding proteins of arsenic in human lung cancer cells (Yan et al., 2009). Thus, the proteome of E7 cells may provide important database for additional investigation. Basically, the results of our study agree with prior reports regarding biological significance of NPM in epithelial carcinogenesis. For example, a trend toward higher NPM expression in bladder cancer cell lines than immortalized uroepithelial cells corresponds to prior reports from human cancer tissues (Chan et al., 1989; Yun et al., 2007; Lindström and Zhang, 2008). NPM overexpression is associated with cell proliferation and S phase accumulation of cancer cells in vitro and in vivo (Feuerstein and Mond, 1987; Feuerstein et al., 1990; Derenzini et al., 1995; Yun et al., 2007; Lindström and Zhang, 2008). Taken together, NPM may play a role in the progression of human bladder cancer (Tsui et al., 2004). Since expression of NPM showed a dose- and time-dependent upregulation after As treatment, we propose that NPM is one of the target genes involved in Asrelated bladder carcinogenesis; but the mechanisms underlying Asrelated bladder carcinogenesis remains elusive. Additional experiments are underway to clarify the role of NPM as a tumor marker for As-related bladder cancer, as reported in the carcinomas of liver, ovary, colon, and prostate (Imai et al., 1992; Nozawa et al., 1996; Shields et al., 1997; van Belzen et al., 1998; Subong et al., 1999; Yun et al., 2007).

Fig. 7. The effect of NPM on TSGH8301 cells. The NPM protein level was measured after treatment with cisplatin for 24 h. Cisplatin (2–10 mg/ml) dose-dependently induced the expression of NPM in TSGH8301 cells. The data are means ± SD derived from 3 independent experiments for each group ⁎⁎⁎p b 0.005, ⁎⁎⁎⁎p b 0.001 (paired t test).

134

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135

Fig. 8. Effect of NPM on cell migration in TSGH8301 cancer cells. (A). In vitro wound healing assay was performed in TSGH8301 cells (Reduced from × 200). Briefly, cells were plated on a 30-mm dish with/without transfection of NPM siRNA. Time-lapse recording was then used to evaluate the progression of wound healing produced by a yellow tip. The images were recorded every 20 min for a total of 48 h. (B) Quantitative data of the distance between the wounded edges in relation to siNPM transfection. The distance between the wounded edges was wider in TSGH8301 cells treated with NPM siRNA than that of parental cells ( p b 0.01 and 0.05 at 24 h and 48 h, respectively, by Student t test) ⁎⁎(p b 0.01, paired t test); ⁎(p b 0.05, paired t test).

With reference to functional consequences of NPM, recent experiments demonstrated that NPM is expressed in the nucleoli of liver cancer cells and that NPM is one of the nuclear binding proteins in lung cancer cells, suggestive of its biological importance in cancer cells (Yun et al., 2007; Lindström and Zhang, 2008; Yan et al., 2009). Related to this hypothesis are prior studies showing that increased NPM expression is associated with an improved DNA-repair capability and that chromatin-binding of NPM occurs subsequent to DNA doublestrand breaks (Lee et al., 2005). In addition, the nuclear complex of NPM and phosphatidylinositol 3, 4, 5-triphosphate in PC12 cells was shown to regulate the anti-apoptotic activity of nerve growth factor in vitro (Ahn et al., 2005). The upregulated NPM in bladder cancer cells after cisplatin treatment in this study basically supports most of prior observations, except for Patterson et al. (1995). Taken together with our experiments in vitro, overexpression of NPM may provide cancer cells with growth advantage, cell migration and anti-apoptosis. Bladder cancer is one of the first cancers in which environmental carcinogens were found to play the major role in disease pathogenesis. Of particular importance is the suppression of NPM by isoflavones at concentrations effective in inducing growth arrest and apoptosis of bladder cancer cells in vitro (Su et al., 2000). Our data suggest that NPM could be a therapeutic target in the prevention of

bladder cancer and that soybean food may have potential in the suppression of As/NPM-related carcinogenesis. Confirmation of this hypothesis may improve the screening and prevention of cancer development for people with exposure to As worldwide. In summary, using quantitative proteomic analysis on immortalized human uroepithelial cells and bladder cancer cells in vitro, we discovered that NPM is positively involved in the As-related bladder carcinogenesis. Gi|4502101ven that expression of NPM could be suppressed by isoflavones in vitro, soybean foods may be investigated as a potential chemoprevention agent for As/NPM-related human cancer.

Fig. 9. Modulation of NPM expression by isoflavones. The TSGH8301 cells were treated with isoflavones (10 mg/ml) dissolved in 0.1% DMSO for 72 h. Expression of NPM was examined by western blot. The data for each group represent means ± SD derived from 3 independent experiments. Treatment with isoflavones significantly suppressed the NPM expression compared with controls ⁎⁎(p b 0.01, paired t test).

S.-H. Chen et al. / Toxicology and Applied Pharmacology 242 (2010) 126–135 Conflict of interest statement All authors declare that there is no financial/commercial conflict of interest.

Acknowledgments This study was supported by grant NSC91-2320-B-006-010 and 95-2621-Z-006-010 from the National Science Council, and by grant DOH-TD-B-111-004 from the Department of Health Executive Yuan, TAIWAN. We are grateful to the support of Clinical Proteomic Core, Center of Excellence for Clinical Trial and Research in Oncology Specialty, National Cheng Kung University Hospital, Tainan, TAIWAN. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.taap.2009.09.016. References Ahn, J.Y., Liu, X., Cheng, D., Peng, J., Chan, P.K., Wade, P.A., Ye, K., 2005. Nucleophosmin/ B23, a nuclear PI(3,4,5)P(3) receptor, mediates the antiapoptotic actions of NGF by inhibiting CAD. Mol. Cell 18, 435–445. Chan, W.Y., Liu, Q.R., Borjigin, J., Busch, H., Rennert, O.M., Tease, L.A., Chan, P.K., 1989. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth. Biochemistry 28, 1033–1039. Chen, C.J., Chuang, Y.C., You, S.L., Lin, T.M., Wu, H.Y., 1986. A retrospective study on malignant neoplasms of bladder, lung, and liver in blackfoot disease endemic area in Taiwan. Br. J. Cancer 53, 399–405. Cheng, H.L., Liu, H.S., Lin, Y.J., Chen, H.W., Hsu, P.Y., Chang, T.Y., Ho, C.L., Tzai, T.S., Chow, N.H., 2005. Co-expression of RON and MET is a prognostic indicator for patients with transitional cell carcinoma of the bladder. Br. J. Cancer 9, 1906–1914. Chiou, H.Y., Hsueh, Y., Liaw, K.F., Horng, S.F., Chiang, M.H., Pu, Y.S., Lin, S.N., Huang, C.H., Chen, C.J., 1995. Incidence of internal cancers and ingested inorganic arsenic: A 7year follow-up study in Taiwan. Cancer Res. 55, 1296–1300. Chow, N.H., Guo, Y.L., Lin, S.N., Su, H.J., Tzai, T.S., Guo, H.R., Su, I.J., 1997. Clinicopathologic features of bladder cancer associated with chronic exposure to arsenic. Br. J. Cancer 75, 1708–1710. Chow, N.H., Liu, H.S., Chan, S.H., 2000. The role of nm23-H1 in the progression of transitional cell bladder cancer. Clin. Cancer Res. 6, 3595–3599. Cohen, S.M., Arnold, L.L., Uzvolgyi, E., Cano, M., Cano, M, St John, M., Yamamoto, S., Lu, X., Le, X.C., 2002. Possible role of dimethylarsinous acid in dimethylarsinic acidinduced urothelial toxicity and regeneration in the rat. Chem. Res. Toxicol. 15, 1150–1157. Darimont, C., Zbinden, I., Avanti, O., Leone-Vautravers, P., Gi|4502101usti, V., Burckhardt, P., Pfeifer, A.M.A., Macé, K., 2003. Reconstitution of telomerase activity combined with HPV-E7 expression allows human preadipocytes to preserve their differentiation capacity after immortalization. Cell Death Differ 10, 1025–1031. Derenzini, M., Sirri, V., Trere, D., Ochs, R.L., 1995. The quantity of nucleolar proteins nucleolin and protein B23 is related to cell doubling time in human cancer cells. Lab. Invest. 73, 497–502. Feuerstein, N., Mond, J.J., 1987. “Numatrin,” a nuclear matrix protein associated with induction of proliferation in B lymphocytes. J. Biol. Chem. 262, 11389–11397. Feuerstein, N., Mond, J.J., Kinchington, P.R., Hickey, R., Karjalainen Lindsberg, M.L., Hay, I., Ruyechan, W.T., 1990. Evidence for DNA binding activity of numatrin (B23), a cell cycle-regulated nuclear matrix protein. Biochim. Biophys. Acta 1087, 127–136. Fu, Q., Li, L.J., 2005. De novo sequencing of neuropeptides using reductive isotopic

135

methylation and investigation of ESI QTOF MS/MS fragmentation pattern of neuropeptides with N-terminal dimethylation. Anal. Chem 75, 7783–7795. Gygi, S.P., Rist, B., Gerber, S.A., Turecek, F., Gelb, M.H., Aebersold, R., 1999. Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat. Biotechnol. 17, 994–999. Hsu, J.L., Huang, S.Y., Chow, N.H., Chen, S.H., 2003. Dimethyl stable-isotope labeling for quantitative proteomics. Anal. Chem. 75, 6843–6852. Hsu, P.Y., Liu, H.S., Ho, C.L., Cheng, H.L., Tzai, T.S., Chang, T.Y., Guo, HR, Chow, N.H., 2006. Collaboration of RON and EGFR in human bladder carcinogenesis. J. Urol. 176, 2262–2267. Imai, H., Ochs, R.L., Kiyosawa, K., Furuta, S., Nakamura, R.M., Tan, E.M., 1992. Nucleolar antigens and autoantibodies in hepatocellular carcinoma and other malignancies. Am. J. Pathol. 140, 859–870. Kligerman, A.D., Tennant, A.H., 2007. Insights into the carcinogenic mode of action of arsenic. Toxicol. Appl. Pharmacol. 222, 281–288. Lee, S.Y., Park, J.H., Kim, S., Park, E.J., Yun, Y., Kwon, J., 2005. A proteomics approach for the identification of nucleophosmin and heterogeneous nuclear ribonucleoprotein C1/C2 as chromatin-binding proteins in response to DNA double-strand breaks. Biochem. J. 388, 7–15. Lindström, M.S., Zhang, Y., 2008. Ribosomal protein S9 is a novel B23/NPM-binding protein required for normal cell proliferation. J. Biol. Chem. 283, 15568–15576. Nozawa, Y., Van Belzen, N., Van der Made, A.C., Dinjens, W.N., Bosman, F.T., 1996. Expression of nucleophosmin/B23 in normal and neoplastic colorectal mucosa. J. Pathol. 178, 48–52. O'Farrell, P.H., 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250, 4007–4021. Patterson, S.D., Grossman, J.S., D'Andrea, P., Latter, G.I., 1995. Reduced numatrin/B23/ nucleophosmin labeling in apoptotic Jurkat T-lymphoblasts. J. Biol. Chem. 270, 9429–9436. Szanto, A., Bognar, Z., Szigeti, A., Szabo, A., Farkas, L., Gallyas, F. Jr.., 2009. Critical role of Bad phosphorylation by Akt in cytostatic resistance of human bladder cancer cells. Anticancer Res. 29, 159–164. Sen, B., Wolf, D.C., Turpaz, Y., Bugrim, A., Retief, J, Hester, S.D., 2007. Identification of interspecies concordance of mechanisms of arsenic-induced bladder cancer. Toxicol. In Vitro 21, 1513–1529. Shields, L.B., Gercel-Taylor, C., Yashar, C.M., Wan, T.C., Katsanis, W.A., Spinnato, J.A., Taylor, D.D., 1997. Induction of immune responses to ovarian tumor antigens by multiparity. J. Soc. Gynecol. Investig. 4, 298–304. Su, P.F., Hu, Y.J., Ho, I.C., Cheng, Y.M., 2006. Distinct gene expression profiles in immortalized human urothelial cells exposed to inorganic arsenite and its methylated trivalent metabolites. Environ. Health Perspect. 114, 394–403. Su, S.J., Yeh, T.M., Lei, H.Y., Chow, N.H., 2000. The potential of soybean foods as a chemoprevention approach for human urinary tract cancer. Clin. Cancer Res. 6, 230–236. Subong, E.N., Shue, M.J., Epstein, J.I., Briggman, J.V., Chan, P.K., Partin, A.W., 1999. Monoclonal antibody to prostate cancer nuclear matrix protein (PRO:4-216) recognizes nucleophosmin/B23. Prostate 39, 298–304. Tseng, W.P., 1977. Effects and dose–response relationship of skin cancer and blackfoot disease with arsenic. Environ. Health Perspect. 19, 109–119. Tsui, K.H., Cheng, A.J., Chang, P.L., Pan, T.L., Yung, B.Y., 2004. Association of nucleophosmin/B23 mRNA expression with clinical outcome in patients with bladder carcinoma. Urology 64, 839–844. van Belzen, N., Dinjens, W.N., Eussen, B.H., Bosman, F.T., 1998. Expression of differentiation-related genes in colorectal cancer: possible implications for prognosis. Histol. Histopathol. 13, 1233–1242. Yan, H., Wang, N., Weinfeld, M., Cullen, W.R., Le, X.C., 2009. Identification of arsenicbinding proteins in human cells by affinity chromatography and mass spectrometry. Anal. Chem. Epub ahead of print. Yu, D.S., Hsieh, D.S., Chang, S.Y., 2001. Detection of chromosomal alterations in bladder cancer by comparative genomic hybridization. B.J.U. Int. 87, 889–893. Yun, J.P., Miao, J., Chen, G.G., Tian, Q.H., Zhang, C.Q., Xiang, J., Fu, J., Lai, P.B.S., 2007. Increased expression of nucleophosmin/B23 in hepatocellular carcinoma and correlation with clinicopatho-logical parameters. Br. J. Cancer 96, 477–484.